ID: 1170195090

View in Genome Browser
Species Human (GRCh38)
Location 20:13681316-13681338
Sequence CCATCAGGACATTAGGAACT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170195090_1170195101 28 Left 1170195090 20:13681316-13681338 CCTAGTTCCTAATGTCCTGATGG No data
Right 1170195101 20:13681367-13681389 CTTGATAACCTGTTCTGTTCAGG No data
1170195090_1170195102 29 Left 1170195090 20:13681316-13681338 CCTAGTTCCTAATGTCCTGATGG No data
Right 1170195102 20:13681368-13681390 TTGATAACCTGTTCTGTTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170195090 Original CRISPR CCATCAGGACATTAGGAACT AGG (reversed) Intergenic
No off target data available for this crispr