ID: 1170196532

View in Genome Browser
Species Human (GRCh38)
Location 20:13694643-13694665
Sequence CAGTGTGACTAGAGGGACTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170196532_1170196543 18 Left 1170196532 20:13694643-13694665 CCCAAGTCCCTCTAGTCACACTG No data
Right 1170196543 20:13694684-13694706 GACACGGTGTGGCTTTGGTGAGG No data
1170196532_1170196541 7 Left 1170196532 20:13694643-13694665 CCCAAGTCCCTCTAGTCACACTG No data
Right 1170196541 20:13694673-13694695 GAGTTGGCAGAGACACGGTGTGG No data
1170196532_1170196538 2 Left 1170196532 20:13694643-13694665 CCCAAGTCCCTCTAGTCACACTG No data
Right 1170196538 20:13694668-13694690 TCCCTGAGTTGGCAGAGACACGG No data
1170196532_1170196542 13 Left 1170196532 20:13694643-13694665 CCCAAGTCCCTCTAGTCACACTG No data
Right 1170196542 20:13694679-13694701 GCAGAGACACGGTGTGGCTTTGG No data
1170196532_1170196536 -9 Left 1170196532 20:13694643-13694665 CCCAAGTCCCTCTAGTCACACTG No data
Right 1170196536 20:13694657-13694679 GTCACACTGCCTCCCTGAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170196532 Original CRISPR CAGTGTGACTAGAGGGACTT GGG (reversed) Intergenic
No off target data available for this crispr