ID: 1170201529

View in Genome Browser
Species Human (GRCh38)
Location 20:13749532-13749554
Sequence CTGAATGGGTAGATTGAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 184}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170201529 Original CRISPR CTGAATGGGTAGATTGAGCA AGG Intronic
904824847 1:33267420-33267442 CTGCATGTATAGATGGAGCAAGG - Intronic
905924489 1:41740116-41740138 GTGGATGGGTAGGTTGAGTATGG - Intronic
905935147 1:41817499-41817521 CTGCATGGCTAGGCTGAGCAGGG + Intronic
907378538 1:54065425-54065447 TTGTAAGGGTAGGTTGAGCATGG + Intronic
919525926 1:198650373-198650395 CTGAATGGGAGGATGGAGAAAGG + Intronic
922281676 1:224131180-224131202 CTGAATGTGTAGATTCATCTGGG - Intronic
924904924 1:248442027-248442049 GTAAATGAGTGGATTGAGCATGG - Exonic
924922961 1:248650015-248650037 GTAAATGAGTGGATTGAGCATGG + Exonic
1064978387 10:21142410-21142432 CTGAATGGGTAGTTTTGCCATGG - Intronic
1066379529 10:34889465-34889487 TTTAATGGGTAGAAAGAGCAGGG + Intergenic
1066561691 10:36676537-36676559 CTGACTGATTGGATTGAGCAGGG - Intergenic
1067878689 10:50025441-50025463 CTGAATGGTGAAATTGTGCACGG + Intergenic
1069168740 10:65198190-65198212 CAGTCTGGGTAGATAGAGCAGGG + Intergenic
1070656377 10:78274482-78274504 CTGAATGGGCTGTTTAAGCAAGG - Intergenic
1078261929 11:9717558-9717580 CTGAAAGGGTGGTTTGAGCCTGG + Intronic
1080347459 11:31340882-31340904 CAGAATGAGTAGATAGAGAAGGG + Intronic
1081662404 11:44896110-44896132 CTGACTGGGTGGATTGAGGGAGG + Intronic
1082135023 11:48538344-48538366 CTGAATGAGTACAGTGATCAGGG + Intergenic
1082619723 11:55405272-55405294 CTGAATGGGTATAATGAACAGGG + Intergenic
1082620625 11:55417294-55417316 CTGAATGAGTATAGTGAACAGGG + Intergenic
1082623025 11:55447551-55447573 CTGAATGGGTATAATGAACAGGG + Intergenic
1082625585 11:55480742-55480764 CTGAATGGGTATAATGAACAGGG + Intergenic
1083293668 11:61703652-61703674 GTGAGTGGGTAGATGGAGGATGG + Intronic
1086079408 11:82887897-82887919 CTGAATGGGGAAACTCAGCAAGG - Intronic
1087580650 11:100047749-100047771 TTGAATCAGTAGATTGAGTAAGG + Intronic
1088126839 11:106436758-106436780 CAGAATGGGGAAATTGATCAAGG + Intergenic
1088857962 11:113773374-113773396 CAGAATGTGTGGATTGAGGAGGG - Intronic
1089890052 11:121871749-121871771 CTGAAGGGAAAGAATGAGCAAGG + Intergenic
1090121679 11:124035977-124035999 ATAAATAGGTAGATTGAGCCAGG + Intergenic
1091334202 11:134754344-134754366 CTGAATGAGCAGAAGGAGCAAGG - Intergenic
1092206241 12:6615823-6615845 CTGATTGTGTACACTGAGCAGGG - Intergenic
1093348754 12:18071065-18071087 CTGAATGCGAAGATGGAACAAGG + Intergenic
1093809835 12:23478295-23478317 TTGAATTGGTAGATTGCTCAGGG - Intergenic
1094010037 12:25798207-25798229 TTGACTGGGTAGTTTAAGCAAGG - Intergenic
1098556066 12:71820327-71820349 GTGACTGAGTAGAATGAGCAAGG - Intergenic
1098834481 12:75405474-75405496 TTTATTGGGTAGAATGAGCAGGG + Intronic
1099552672 12:84067784-84067806 CTGAATGGGAAACTTGAGAATGG + Intergenic
1103198861 12:119069939-119069961 ATAAATGGGTAGAGTGAGCCAGG + Intronic
1106143841 13:27034768-27034790 TTGAATGGGTGGGTGGAGCAAGG - Intergenic
1107189159 13:37559117-37559139 TTTATTGGGTAGAATGAGCAGGG - Intergenic
1107847842 13:44535916-44535938 ATGAAAGGGTAGGTTGGGCATGG - Intronic
1110246146 13:73326842-73326864 CTGATTAGGTAGCTTGAGAATGG + Intergenic
1112170784 13:96969802-96969824 CTGAAAGGGCAGACTGAGGAGGG + Intergenic
1112837811 13:103537138-103537160 CTGAATGGGCAGGCTGAGCTTGG + Intergenic
1116527246 14:45920050-45920072 TTTATTGGGTAGAATGAGCAGGG + Intergenic
1116588645 14:46742522-46742544 CTGAATGTGCAGCTTGAGGATGG + Intergenic
1118693337 14:68360890-68360912 CTGAGGGGGTAGACAGAGCAAGG + Intronic
1120356027 14:83435160-83435182 ATGGATGGGTAGATTGAACATGG + Intergenic
1120484342 14:85092197-85092219 TTGAATTGGTAGACTGAGTAAGG + Intergenic
1120833807 14:89022324-89022346 CTAAATGAGTAAATTGAACATGG + Intergenic
1121740861 14:96251498-96251520 TTGAATTGGTAGACTGAGTAAGG - Intronic
1121851873 14:97228660-97228682 TTGAATGGGTAGGCTGGGCATGG - Intergenic
1121888941 14:97571516-97571538 CAGAATGTGTATATTGAGGAGGG - Intergenic
1130272021 15:82456718-82456740 CTGAATGGGTCCATTGAGGCTGG - Intergenic
1130464374 15:84184107-84184129 CTGAATGGGTCCATTGAGGCTGG - Intergenic
1130488314 15:84410715-84410737 CTGAATGGGTCCATTGAGGCTGG + Intergenic
1130499894 15:84489430-84489452 CTGAATGGGTCCATTGAGGCTGG + Intergenic
1130586665 15:85188740-85188762 CTGAATGGGTCCATTGAGGCTGG - Intergenic
1130919872 15:88334944-88334966 ATGAATGGGTATGTTGAGCTGGG - Intergenic
1131875985 15:96807031-96807053 CAGACTGGGTAGCTTAAGCAAGG - Intergenic
1132891898 16:2208736-2208758 CTGGAGGGGGAGATTGTGCAGGG - Intronic
1137579717 16:49626590-49626612 GTGGATGGGTAGATGGAGGATGG - Intronic
1137579736 16:49626700-49626722 ATGGATGGGTAGATGGAGGATGG - Intronic
1137579754 16:49626775-49626797 ATGGATGGGTAGATGGAGGATGG - Intronic
1137579771 16:49626850-49626872 ATGGATGGGTAGATGGAGGATGG - Intronic
1137579781 16:49626892-49626914 ATGGATGGGTAGATGGAGGATGG - Intronic
1137579793 16:49626951-49626973 ATGGATGGGTAGATGGAGGATGG - Intronic
1137579802 16:49626986-49627008 ATGGATGGGTAGATGGAGGATGG - Intronic
1137579819 16:49627061-49627083 ATGGATGGGTAGATGGAGGATGG - Intronic
1137579829 16:49627103-49627125 ATGGATGGGTAGATGGAGGATGG - Intronic
1137579857 16:49627229-49627251 ATGGATGGGTAGATGGAGGATGG - Intronic
1137579868 16:49627276-49627298 ATGGATGGGTAGATGGAGGATGG - Intronic
1137579879 16:49627323-49627345 ATGGATGGGTAGATGGAGGATGG - Intronic
1137579901 16:49627418-49627440 ATGGATGGGTAGATGGAGGATGG - Intronic
1137579912 16:49627465-49627487 ATGAATGGGTAGATGGAGGATGG - Intronic
1137579924 16:49627524-49627546 ATGGATGGGTAGATGGAGGATGG - Intronic
1137579935 16:49627568-49627590 ATGGATGGGTAGATGGAGGATGG - Intronic
1137579959 16:49627688-49627710 ATGGATGGGTAGATGGAGGATGG - Intronic
1137580000 16:49627866-49627888 ATGGATGGGTAGATGGAGGATGG - Intronic
1137580017 16:49627941-49627963 ATGGATGGGTAGATGGAGGATGG - Intronic
1137580085 16:49628245-49628267 ATGGATGGGTAGATGGAGTATGG - Intronic
1141024721 16:80535203-80535225 CTGACTGGGTAGAATAAACATGG - Intergenic
1141854894 16:86674102-86674124 ATGAATGGGTAGATGGATGAAGG - Intergenic
1143619567 17:8073259-8073281 CTGAATCGGTGGATTCCGCATGG + Exonic
1144532255 17:16050635-16050657 CTGGATGGGCTGATTGAGAAAGG - Intronic
1155453145 18:25983875-25983897 CTGAATGGGTAGCAGGAACAAGG + Intergenic
1155887618 18:31227240-31227262 ATGAATGGGAAGATTGAGAGAGG - Intergenic
1159186151 18:64977103-64977125 ATGATTGGGTAGGTTGGGCAGGG + Intergenic
1160389904 18:78522083-78522105 CTGGATGGGGAGGTTGAGGATGG - Intergenic
1162062796 19:8107078-8107100 ATGAATGGGTGGATGGGGCATGG + Intronic
1162062823 19:8107196-8107218 ATGAATGGGTAGATGGGGGATGG + Intronic
1162062871 19:8107378-8107400 ATGAATGGGTAGATGGAGAATGG + Intronic
1162062935 19:8107688-8107710 ATGAATGGGTAGATGGAGGATGG + Intronic
1162829968 19:13278269-13278291 CTGAATGGTCAGATCGTGCAGGG - Intronic
1163609862 19:18295226-18295248 ATGAATGGGTAGATGGTGGATGG - Intergenic
1163609877 19:18295284-18295306 GTGGATGGGTAGATGGTGCATGG - Intergenic
1163685618 19:18710222-18710244 CTGGGTGGGTAGATGGAGGAAGG - Intronic
1167019745 19:46864127-46864149 CTGATTGGGTAGAGTTAGAAAGG + Intergenic
1167112101 19:47468612-47468634 CTGAAAGGGCAGAGAGAGCAAGG - Intronic
925423565 2:3730609-3730631 TTTATTGGGTAGAATGAGCAGGG + Intronic
926558778 2:14392334-14392356 CTGAATGAGTAGACTGAGTGCGG - Intergenic
927394857 2:22638104-22638126 CTGTAAGGGATGATTGAGCAAGG + Intergenic
931803880 2:65785873-65785895 CTGAAAGGGTGGAGGGAGCAAGG + Intergenic
935088416 2:99870510-99870532 CTGCATGGGTAGATCCAGCAGGG - Intronic
935116819 2:100143978-100144000 CTGAAGAGGTAGAATGGGCAGGG - Intergenic
935734047 2:106092035-106092057 ATGAATGGGTAGACAGAGCATGG - Intergenic
936125457 2:109785876-109785898 CTGAATGGGTAGACTGAGGATGG + Intergenic
936219236 2:110585592-110585614 CTGAATGGGTAGACTGAGGATGG - Intergenic
937336392 2:121064909-121064931 CTGGATGGCTAGACTGGGCAGGG - Intergenic
937981025 2:127615491-127615513 TTTATTGGGTAGAATGAGCAGGG + Intronic
938926747 2:136050167-136050189 CTGTAGGGGAAGCTTGAGCAGGG - Intergenic
939692543 2:145283009-145283031 CTGAATGGGCAGTTGGAGGATGG + Intergenic
939774367 2:146366141-146366163 TTGAGTTGGTAGATTGAGTAGGG + Intergenic
940688406 2:156883274-156883296 TTGAATTGGTAGACTGAGTAAGG - Intergenic
942816686 2:180060711-180060733 CTGAATGCGAAGATGGAACAAGG + Intergenic
943724104 2:191235401-191235423 TTGAATAGGTAGTTTGATCATGG + Intergenic
944344045 2:198639169-198639191 TTGAATTGGTAGACTGAGTAAGG + Intergenic
947613120 2:231536122-231536144 CTGCATGGGTGGGGTGAGCATGG + Intergenic
1170201529 20:13749532-13749554 CTGAATGGGTAGATTGAGCAAGG + Intronic
1171355351 20:24541104-24541126 ATTAATGGGGTGATTGAGCAAGG - Intronic
1172617237 20:36297467-36297489 CTGAAGGTGTGGAGTGAGCAAGG - Intergenic
1173332856 20:42089699-42089721 CAGAATGGGTGAATTCAGCAGGG + Intronic
1173660596 20:44730765-44730787 TTTATTGGGTAGAATGAGCAGGG - Intergenic
1175227365 20:57452437-57452459 CTGAATGGAGAGAATGAGCCAGG + Intergenic
1183694726 22:39415296-39415318 CTGATGGGGTAGCGTGAGCATGG + Intronic
1184293024 22:43508418-43508440 ATGAATGGATAGATGGGGCATGG - Intergenic
951216990 3:20034491-20034513 GTGAAGGAGTATATTGAGCATGG + Intergenic
951872918 3:27385183-27385205 CTGAATGGGAAAATGGAGCAAGG + Intronic
953442319 3:42928950-42928972 CTGAATGGCTTGAGAGAGCAGGG - Intronic
954940191 3:54365093-54365115 GTGAATTGGTAAATTGAGCCAGG - Intronic
957298151 3:78358495-78358517 TTGAATTGGTAGACTGAGTAGGG - Intergenic
960401238 3:117201702-117201724 CAGAATGGATAGTTTTAGCAAGG + Intergenic
961203315 3:125061498-125061520 CTGAAGGGGGAGAGTGAGCTGGG + Intergenic
961240420 3:125405936-125405958 TTGAATGGGTAAATTGATGAAGG - Intergenic
961529070 3:127528831-127528853 ATGAATGCGTAGAATTAGCATGG + Intergenic
963176886 3:142307460-142307482 CTGAATGCATTGATTGAGCAAGG + Exonic
964633655 3:158838458-158838480 TTGAATGGGTAAATTCAGGAAGG + Intergenic
965214400 3:165843173-165843195 CTGAATGAGTATATTCATCAAGG - Intergenic
966119575 3:176507107-176507129 CTGAAAGGGGAGACTGAGGAGGG - Intergenic
967649747 3:191972666-191972688 CTGAATGGATGGAATGAGCTGGG - Intergenic
973822651 4:54676583-54676605 CTGCATGGGTGGAGGGAGCAGGG + Intronic
982400232 4:154958761-154958783 TTGAATTGGTGGATTGAGTAAGG - Intergenic
985085582 4:186309212-186309234 CTGACTGGGTAGATTTGGGATGG + Intergenic
985095433 4:186408218-186408240 GTGAATGAGCAGAATGAGCATGG + Intergenic
985516989 5:352058-352080 ATGCATGGGGAGACTGAGCAGGG - Intronic
987608977 5:20177620-20177642 TTGAGTTGGTAGACTGAGCATGG + Intronic
988933314 5:36058636-36058658 TTTATTGGGTAGAATGAGCAGGG - Intronic
988933527 5:36060519-36060541 TTTATTGGGTAGAATGAGCAGGG - Intronic
989564337 5:42886582-42886604 GTGAATGAGTGTATTGAGCATGG + Intronic
990315923 5:54583343-54583365 CTGAATGAAAACATTGAGCATGG + Intergenic
990402746 5:55455832-55455854 CTGATTGAGAAGATTTAGCATGG - Intronic
990822680 5:59860184-59860206 GAGAATGGATAGGTTGAGCAAGG + Intronic
992276401 5:75124914-75124936 TTAAATGGATATATTGAGCAGGG - Intronic
993233210 5:85267006-85267028 CTTAATAGCTAGATTGAACAAGG - Intergenic
993524885 5:88953145-88953167 CTGAAAGTGGAGATTCAGCAAGG + Intergenic
994776341 5:104039671-104039693 TTGAATGGGTAGACTGAGTAAGG + Intergenic
995904438 5:117106518-117106540 ATGCATGGAGAGATTGAGCATGG + Intergenic
997854022 5:137357225-137357247 CTGAATGGATGGAGTTAGCACGG - Intronic
998251711 5:140557811-140557833 GTGAATGTGGAGATTGTGCAGGG - Exonic
1000847631 5:166301184-166301206 CTGATGGGATAGATTGAGAAAGG - Intergenic
1002866569 6:1127218-1127240 CTGGATGGGCAAAGTGAGCAAGG - Intergenic
1007280936 6:40711964-40711986 TGGAATGGGTAGATAGGGCATGG - Intergenic
1007788588 6:44296501-44296523 CAGAATGGTTAGATTTAGCTGGG - Intronic
1007999791 6:46348488-46348510 GGGAATGGGAAGATTGGGCAGGG - Intronic
1018272372 6:162094109-162094131 CTGACTGAGTAGGTAGAGCAAGG + Intronic
1019605226 7:1906806-1906828 CTGACTGTGTAGCTTGCGCAGGG - Intronic
1020201526 7:6083808-6083830 CTGAATATGCAGATTGAGTAAGG - Intergenic
1020763779 7:12296548-12296570 CTGAGTGGGCAGAGTGAGCCTGG + Intergenic
1021331526 7:19344174-19344196 TTGAATGTGTAGATTAAGCTGGG + Intergenic
1022327073 7:29342180-29342202 ATGAATGGGTAGATGGATGAGGG + Intronic
1023022736 7:36025144-36025166 CTGAATGGATAAATTGAATATGG - Intergenic
1024553769 7:50585214-50585236 CTGATTCAGTAGGTTGAGCAAGG - Intergenic
1026904276 7:74053907-74053929 ATGAATGGGTAGATGGATGAGGG + Intronic
1030031853 7:105376964-105376986 GTGAATAGGAAGATAGAGCAGGG - Intronic
1031700495 7:124918928-124918950 CTGAATGGGGAGGATGGGCAGGG + Intronic
1032500062 7:132393342-132393364 GTGAATGGGTACCTTGATCATGG + Intronic
1036485979 8:9179036-9179058 CTGAATAGGCAGATTTAACAGGG - Intergenic
1036802879 8:11805892-11805914 CTTAAAGGGTTGATTGAGTAAGG + Intronic
1039304743 8:36249351-36249373 CTGAGTGGGGAAACTGAGCAAGG + Intergenic
1039328342 8:36509528-36509550 CTGAGTGGGGAAACTGAGCAAGG - Intergenic
1039482850 8:37887918-37887940 CTGAATGGGTAGATAAACTATGG - Intronic
1039903048 8:41766940-41766962 CTGGCCGGGTAGATTCAGCAGGG - Intronic
1041224232 8:55682859-55682881 GTGAATCTGTAGACTGAGCAAGG - Intergenic
1042440549 8:68821025-68821047 CTGAGTGGGCAGAGTGTGCATGG + Intergenic
1042802228 8:72732025-72732047 CTGAAGGAGGAGATTCAGCAGGG - Intronic
1043459663 8:80446626-80446648 ATGAGTGGGCAGAATGAGCAGGG + Intergenic
1044084798 8:87931269-87931291 CTTAAAGGGGAGATTGAGTATGG - Intergenic
1044760293 8:95510505-95510527 CTGAAATGGTAAATTGAGCTTGG - Intergenic
1047572259 8:126111834-126111856 CTGAATGGGTAGAGTCAGACTGG - Intergenic
1049371973 8:142272301-142272323 GTGGATGGGTAGATGGAGGAAGG - Intronic
1049397742 8:142409423-142409445 ATGAATGGGGAGCTTGTGCATGG + Intergenic
1057561357 9:96130451-96130473 CTGAATAGGAAGATGGCGCATGG + Intergenic
1057978069 9:99628141-99628163 AGGTATGGGTAGATGGAGCAGGG - Intergenic
1059442780 9:114319159-114319181 CTGAATGGGAAGAATGGGGAGGG - Intergenic
1061212206 9:129200374-129200396 GTGAAAGGGAAGATAGAGCAGGG - Intergenic
1061700368 9:132410696-132410718 CTGATTGGGAAGATTGAATAGGG + Intronic
1186150435 X:6669189-6669211 ATGAATGGATAGATTGATGATGG + Intergenic
1189073815 X:37894702-37894724 TTGAATTGGTAGACTGAGTAGGG + Intronic
1190578454 X:51866748-51866770 CTGAATGGGTAGAGTTACCATGG - Intronic
1193676697 X:84463204-84463226 TTGAGTGGGTAGAGTTAGCAGGG - Intronic