ID: 1170204285

View in Genome Browser
Species Human (GRCh38)
Location 20:13781661-13781683
Sequence CTGGACACACAGAGCTCCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 324
Summary {0: 1, 1: 1, 2: 1, 3: 32, 4: 289}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170204285_1170204289 8 Left 1170204285 20:13781661-13781683 CCCTGGGAGCTCTGTGTGTCCAG 0: 1
1: 1
2: 1
3: 32
4: 289
Right 1170204289 20:13781692-13781714 CCTTTTTCTAATTTGCATAAAGG 0: 2
1: 8
2: 51
3: 144
4: 687

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170204285 Original CRISPR CTGGACACACAGAGCTCCCA GGG (reversed) Intronic
900167878 1:1251219-1251241 GGGGACACACCGTGCTCCCAGGG + Intergenic
900288002 1:1910969-1910991 CTGGACCCACAGGGCTCCCTTGG - Intergenic
900432161 1:2607504-2607526 CAGGACACACACAGGCCCCAGGG - Intronic
901656952 1:10774815-10774837 CCTGACACTCAGAGCTCCCGCGG + Intronic
901744336 1:11362654-11362676 CTGGACACACATCTCTGCCACGG + Intergenic
902718012 1:18285931-18285953 GTGAACACACAGAGAGCCCAGGG - Intronic
902918152 1:19651156-19651178 CTGGAGTCACACAGCTCCTAAGG + Intronic
903484041 1:23676495-23676517 CTGGAGGGACAGAGCACCCAGGG - Intergenic
903884028 1:26530762-26530784 CTGGAGCCACAGAGCCCTCAAGG - Intronic
904002212 1:27345292-27345314 CTGGGCACACGGAGCTTCCTGGG - Exonic
904328703 1:29744316-29744338 CTGCTCACACAGAGCTCCCTTGG - Intergenic
905276378 1:36821369-36821391 CTGGACACCCAGCTCTCCAAAGG - Intronic
905733947 1:40313770-40313792 CTGATACCACAGAGCTCCCAGGG - Intronic
907372726 1:54013705-54013727 CTAGACTCTCAGGGCTCCCAGGG + Intronic
907851149 1:58256284-58256306 CGGTACTCACAGAGCTGCCATGG - Intronic
910505544 1:87946294-87946316 TTGGGCACAAAGGGCTCCCAAGG + Intergenic
910598605 1:89005999-89006021 GGGGACACAGTGAGCTCCCAGGG + Intergenic
918621313 1:186609195-186609217 GTGGACAGACAGACCTCCAAGGG - Intergenic
918993568 1:191729019-191729041 CTGGAGAGACAGAGCCCACATGG - Intergenic
919638743 1:200029429-200029451 CTGGAAACACAGTTCTTCCAGGG - Intronic
922209125 1:223474127-223474149 TGGCACACACTGAGCTCCCAAGG - Intergenic
922898529 1:229118997-229119019 CTGGGGACCCAGAGCTCACAAGG + Intergenic
923269304 1:232340525-232340547 CGGGACACACAGAGTTCTCAAGG + Intergenic
923279456 1:232428946-232428968 CTGGACAACCAGAGCCCCGATGG + Intronic
1063026256 10:2181818-2181840 CTGGATAGCCAGAGCTCCAAAGG + Intergenic
1063159150 10:3407239-3407261 CGAGACTTACAGAGCTCCCAGGG + Intergenic
1063374397 10:5545376-5545398 CTGGACACACACAGCTCCTTGGG - Intergenic
1064006101 10:11700321-11700343 TTGGACACACAGAGACACCAGGG + Intergenic
1065186935 10:23177634-23177656 ATAGCCACACAGAGCTGCCATGG + Intergenic
1065187456 10:23182796-23182818 CTAGACAGACAAAGCTACCATGG - Intergenic
1065841160 10:29702440-29702462 ATGGACCCACAGAGCAGCCACGG + Intronic
1066145605 10:32554464-32554486 CAGGACCCAGTGAGCTCCCAGGG + Intronic
1067057868 10:43062823-43062845 CTGCAGACACAGAAGTCCCAGGG - Intergenic
1067059378 10:43070204-43070226 CTGGACAGACAGAGCAAGCAGGG + Intergenic
1067297915 10:44985286-44985308 CTGGATACACAGTGTTCCCAGGG - Intronic
1069596730 10:69676757-69676779 CATGAGACACAGAGCTCCAATGG - Intergenic
1069821302 10:71230331-71230353 CTGAACACACAGAGAAGCCAAGG + Intronic
1070475426 10:76824673-76824695 CTGGACATCCAGATGTCCCAAGG + Intergenic
1070843645 10:79505169-79505191 AGGGCCACACAGAGCTGCCATGG - Intergenic
1070930021 10:80254431-80254453 AGGGCCACACAGAGCTGCCATGG + Intergenic
1072473735 10:95738242-95738264 ATGCACACACAGAGATTCCAGGG - Intronic
1074828656 10:117232736-117232758 CTGACCTCACTGAGCTCCCAGGG + Intergenic
1075948860 10:126460407-126460429 CTGGGCACTCTGAGCTCCCAAGG - Intronic
1076045615 10:127292026-127292048 TTGGACACACAGACTTTCCAAGG - Intronic
1076243066 10:128925004-128925026 CGGGACACAGAGAGAGCCCAAGG - Intergenic
1077326372 11:1965766-1965788 CTGGAGCCACAGAACGCCCATGG + Intronic
1078326508 11:10385916-10385938 ATGGATTCACAGAGCTGCCAGGG - Intronic
1080153125 11:29076724-29076746 CAGGACCCAGTGAGCTCCCAGGG + Intergenic
1080442879 11:32311579-32311601 CAACACACACAGAGCTCACAAGG + Intergenic
1081614894 11:44584988-44585010 CTGGGCAGACCGAGCTCCCACGG + Intronic
1084147733 11:67273923-67273945 CTGGACACACAAAGTCTCCAAGG - Intronic
1084216315 11:67648668-67648690 CTGGCCACCCAGAGCCCCCCAGG - Intronic
1084567608 11:69940292-69940314 CTGGGGACCCAGAGCACCCAAGG + Intergenic
1086676088 11:89608664-89608686 CTGGACACACAGACATCCCAGGG - Intergenic
1088586359 11:111363197-111363219 CAGGACTCCCACAGCTCCCACGG + Intronic
1088847920 11:113683117-113683139 ATGGACCCAGAGGGCTCCCAGGG + Intergenic
1089116959 11:116103168-116103190 CTGGTCACCCAGAGCTTTCAGGG - Intergenic
1089169911 11:116504752-116504774 CTGCAGACACACAGCGCCCAGGG - Intergenic
1089396305 11:118138115-118138137 CTGGGCACACAGAACTCCCCAGG + Intronic
1090260190 11:125313948-125313970 CTTTACACACAGAACTCACAGGG - Intronic
1090737024 11:129618913-129618935 CTGGAAATAGAGAGCTACCAGGG + Intergenic
1090927439 11:131260961-131260983 CTGGGCACTGAGAGTTCCCAAGG - Intergenic
1202809353 11_KI270721v1_random:20945-20967 CTGGAGCCACAGAACGCCCATGG + Intergenic
1094856595 12:34405637-34405659 TTGCACACACAGAGCACCCCGGG + Intergenic
1096878366 12:54647837-54647859 ATGGACACAGAGAGCTAGCAGGG + Intronic
1097218802 12:57434776-57434798 CTGGACACACACTTCTTCCAGGG + Exonic
1097450628 12:59733548-59733570 CAGGAGACACAGAGCCCCAAAGG + Intronic
1101002663 12:100372317-100372339 TTGGACACACAGAGACACCAGGG - Intronic
1101761916 12:107665680-107665702 CTGCACTCACAGAGCCCCCTGGG + Intergenic
1102785569 12:115601495-115601517 CTGCACATGCAGAGGTCCCAGGG - Intergenic
1103564675 12:121809732-121809754 CTGGACACACCCAACTCCTATGG + Exonic
1103794534 12:123494299-123494321 CTGAACTCACAGAGCTCCAAGGG + Intronic
1103849493 12:123922760-123922782 TTGGACACACAGAGACACCAGGG - Intronic
1104542186 12:129676098-129676120 CTGCTCACACAGAGCTCAGAAGG + Intronic
1104844813 12:131841440-131841462 CAGGCCCCACAGAGCCCCCAGGG + Intronic
1105322849 13:19345036-19345058 CTGAGCACACGGAGCTCCCTCGG - Intergenic
1105626477 13:22117800-22117822 CTGGCAACACTGAGGTCCCATGG - Intergenic
1106663607 13:31828025-31828047 GTGCACACTGAGAGCTCCCAGGG + Intergenic
1107381876 13:39865274-39865296 CAAGGCACACAGAGCTCCCCTGG + Intergenic
1107666324 13:42694298-42694320 GTGGACCCATTGAGCTCCCAGGG + Intergenic
1108574253 13:51777998-51778020 CTGGTCACACAGAGACTCCATGG - Intronic
1112286141 13:98106094-98106116 CTGCACACAGAGAACTTCCATGG + Intergenic
1112378432 13:98865663-98865685 CTGGGCAAAAAGAGCTCCCTGGG + Intronic
1112694943 13:101937414-101937436 CTGGACACACAGAGATCCCAGGG + Intronic
1112987252 13:105466389-105466411 ATGGCAGCACAGAGCTCCCAGGG + Intronic
1113694985 13:112338779-112338801 CTGGACACAGACAGGTGCCATGG - Intergenic
1115380931 14:32738171-32738193 CTGCACACACACAGCTCAAAGGG - Intronic
1117410130 14:55442869-55442891 CTGGACACACAGAGACACCAGGG + Intronic
1118922857 14:70165948-70165970 TTGGAGAAGCAGAGCTCCCAGGG - Intronic
1119424186 14:74525063-74525085 CTGGACAGACACAGCTCACAGGG + Intronic
1121998090 14:98621578-98621600 CTGGTCACAAAGTGCTCCAATGG + Intergenic
1122786352 14:104166021-104166043 CTGCACCCACAGTGCCCCCAGGG - Intronic
1124595099 15:31085809-31085831 CTGGACACAGACAGCAGCCAGGG + Intronic
1125311595 15:38385132-38385154 CTGGCCACCCAGAACTCCCTGGG + Intergenic
1127581363 15:60341894-60341916 CTGGAAACCCAGCTCTCCCAGGG + Intergenic
1128580261 15:68805076-68805098 CAGGACTCACAGGGCCCCCAGGG - Intronic
1128723219 15:69968382-69968404 CTGGGCACACAGTCCTCCCTGGG - Intergenic
1128827113 15:70729533-70729555 AGGGACCCACCGAGCTCCCAGGG + Intronic
1129293906 15:74588902-74588924 CTGGACACACAGGTCTCCAGAGG - Intronic
1129671871 15:77612140-77612162 CTGGACCCAAGGAGTTCCCAAGG + Intergenic
1131510512 15:93047344-93047366 CAAGGCACCCAGAGCTCCCATGG - Intronic
1131952421 15:97694942-97694964 CTGCACACACAGAGAGTCCAGGG + Intergenic
1131968944 15:97873472-97873494 TTGGACACACAGAGATACCAGGG - Intergenic
1132682757 16:1150121-1150143 CAGGGGACACAGAGCCCCCAAGG + Intergenic
1134100021 16:11445585-11445607 CAGGACACGCAGAGGTCCCGAGG + Intronic
1134809144 16:17152276-17152298 CTGCACACACATACCTCCCTGGG - Intronic
1136093084 16:27934653-27934675 CTGGAGCCACAGCTCTCCCATGG - Intronic
1136627001 16:31467387-31467409 CTGGACACACAGATCTTGCTTGG + Intergenic
1138439890 16:57027825-57027847 CTGGCCACACTGAGCTGCAAGGG + Intronic
1138770933 16:59662763-59662785 CTGGACATACAGAGATCCATAGG - Intergenic
1143248276 17:5503588-5503610 CCTGACAGACAGAGCCCCCAGGG - Intronic
1143923357 17:10348585-10348607 CTGCACACACACAGCTGCTAGGG + Intronic
1143987156 17:10924654-10924676 GTAGACACACAGAGCTGCAAGGG - Intergenic
1144714215 17:17422893-17422915 CTGGCCAGACAGAGTTCCCTGGG - Intergenic
1144776944 17:17789587-17789609 CTGGAATCACATAGCACCCAGGG - Intronic
1144838760 17:18172735-18172757 TTGGATACACAGAGATACCAGGG - Intronic
1147328253 17:39680563-39680585 CTGGAGACACAGAGGTCTCTAGG - Intronic
1147623177 17:41881756-41881778 CTGGCTACACAGATCTACCAAGG + Intronic
1147673975 17:42192549-42192571 CTGGACGCACTGAGGTCCCCAGG - Exonic
1147879096 17:43642489-43642511 ATGGAGACCCAGAGGTCCCAGGG + Intronic
1148038379 17:44686339-44686361 CTAGACACACAGAACTTCCTTGG + Intronic
1150430377 17:65110880-65110902 CTGGACAGACAGAACTCCAAGGG + Intergenic
1153476337 18:5502708-5502730 CAGGACAGACAGAGCTCCCTGGG - Intronic
1153643067 18:7172280-7172302 CTGGAGACACAGGGCTACCAGGG + Intergenic
1155551632 18:26971793-26971815 CTGGAAGGACAGAGCGCCCATGG + Intronic
1156066849 18:33152489-33152511 CTGGAAACCCAGAGCTCGCCAGG + Intronic
1156260110 18:35438627-35438649 TGGGAGACACAGAGTTCCCAGGG - Intergenic
1158069890 18:53458659-53458681 CTGGACACTCAGTGATGCCAAGG + Intronic
1158693678 18:59683961-59683983 CTGGACCACCAGAACTCCCAGGG + Intronic
1159913412 18:74167218-74167240 CTGGGCACACAGAGACACCAGGG + Intergenic
1160327865 18:77967347-77967369 CTGGGCACACAGAGTCACCAAGG + Intergenic
1161357118 19:3825331-3825353 CTGGCCACAGAGAGCCCCCCCGG - Exonic
1161472742 19:4468316-4468338 GTGGAAGCACAGACCTCCCATGG - Intergenic
1163691513 19:18741169-18741191 GGGGACACACAGAACTCTCATGG - Intronic
1165145721 19:33728784-33728806 CTGGGCTCACAGGCCTCCCAGGG - Intronic
1165467538 19:35983884-35983906 GTGGAAACAGACAGCTCCCATGG - Intergenic
1166972371 19:46577838-46577860 ATGGTGACTCAGAGCTCCCAAGG + Intronic
1168124917 19:54277823-54277845 CTGGACACTCAAAGCTGCCCTGG + Intronic
925670243 2:6303281-6303303 CCTGCCACACAGAGCTTCCATGG - Intergenic
925679008 2:6397168-6397190 TTGGATACACAGAGATACCAGGG - Intergenic
928794296 2:34997600-34997622 CTGGACATCTAGAGATCCCAGGG + Intergenic
929916970 2:46144207-46144229 CTGGACCCACAGAGCCCACGTGG - Intronic
931650819 2:64467304-64467326 CTGGACACACAGAGAACACCAGG + Intergenic
932715122 2:74095082-74095104 CTGGGCAGACAGGGCTTCCAGGG + Intronic
933657687 2:84903195-84903217 CTGGTAACACACAGCCCCCAAGG - Intronic
934648612 2:96073675-96073697 CTGGACACTCAGATAGCCCAGGG - Intergenic
934861254 2:97765097-97765119 CTGGACACACGGACCACCCACGG + Intronic
935015039 2:99173817-99173839 CAGACCACACAGAGCTCCAAAGG + Intronic
935357877 2:102221384-102221406 CTGGAAACGCAGAGCTGTCATGG - Intronic
936073946 2:109389883-109389905 CTCCACCCAAAGAGCTCCCAGGG - Intronic
938962215 2:136354068-136354090 TTGGACACACAGAGATATCAGGG + Intergenic
939769482 2:146298376-146298398 GGGGACACAGAGAGTTCCCAGGG - Intergenic
940280840 2:151988305-151988327 CTGGACCCACTGAGCTCTCTAGG + Intronic
940345358 2:152622973-152622995 CTGGACACACTGTGTCCCCATGG - Intronic
941850390 2:170174248-170174270 CGGTACACACAGAGATCCCTGGG - Intergenic
944161128 2:196661430-196661452 TTGGACACACAGAGACACCAGGG - Intronic
944432167 2:199645157-199645179 GGGGACTCACAGAGCTGCCATGG + Intergenic
945647582 2:212518819-212518841 CTGGACAAACAGTGATTCCAGGG + Intronic
948063557 2:235060280-235060302 CTGGGCACACAGAGGGTCCAAGG + Intergenic
948204483 2:236156067-236156089 CTGGTCACCCAGAGCTCTCGAGG - Intergenic
948727930 2:239946092-239946114 CCGAACACACACAGCTGCCAAGG - Intronic
1169867068 20:10213676-10213698 ATGGACATATGGAGCTCCCAGGG + Intergenic
1170204285 20:13781661-13781683 CTGGACACACAGAGCTCCCAGGG - Intronic
1170354150 20:15473992-15474014 CTAGACTCACAGAGCTAACAGGG - Intronic
1172948668 20:38707662-38707684 CTGAAGCCACAGAGCTACCATGG - Intergenic
1173398427 20:42702505-42702527 CTTGACACACTGAACCCCCATGG + Intronic
1174076616 20:47941932-47941954 CTGGTCACACATTGCTCCCTTGG + Intergenic
1174767786 20:53270226-53270248 TTGCACACACAGAGCACCCTTGG + Intronic
1175424768 20:58856255-58856277 CTGCACACACACAGCTCGCCTGG + Intronic
1176144847 20:63561003-63561025 CTGCACACACAGGGCACCCCAGG + Intronic
1177905598 21:26967787-26967809 CTGGACAGCCAGAGAGCCCAGGG + Intergenic
1178142417 21:29699381-29699403 CTGGACACACAGATATACCAGGG + Intronic
1178825635 21:36014176-36014198 CCTGACACACAGAGCTGCTAAGG + Intergenic
1179646902 21:42781846-42781868 CTGCACACAGGCAGCTCCCATGG + Intergenic
1179731987 21:43373157-43373179 CCGGAGCCACAGAGCTGCCAGGG + Intergenic
1180723143 22:17924255-17924277 CTGCAGACACAGAGCTCTCCAGG - Intronic
1181085691 22:20438347-20438369 CTGCGCACTCAGAGCTCGCAAGG + Intronic
1181479610 22:23190139-23190161 TTGGACACAGAGAGATGCCAGGG - Intronic
1181482987 22:23212701-23212723 CTCAACACACACAGCTTCCATGG + Intronic
1182071164 22:27464741-27464763 CTGGCCACACTGAGCTACAAGGG + Intergenic
1182567776 22:31212633-31212655 CTGGAGACAGAGGGCTCCGAGGG + Intronic
1182569258 22:31224080-31224102 CTGCATACACAGAGCGCACAAGG + Intronic
1182737705 22:32542906-32542928 CTGGACAAGCAGGGCTCCCGTGG - Intronic
1182742800 22:32580970-32580992 CTGTGCACACAGATCACCCAGGG - Intronic
1183048547 22:35241571-35241593 CGGGATCCACTGAGCTCCCAGGG + Intergenic
1183347949 22:37318317-37318339 CCTGGCACACAGAGCTGCCAGGG + Intergenic
1184457722 22:44621004-44621026 ATGGAAACACACACCTCCCACGG + Intergenic
1184775115 22:46619239-46619261 CAGCACACACACAGCTCCCTGGG - Intronic
1185180528 22:49358249-49358271 CTGCACCCACAGAGCTCTGAGGG + Intergenic
950376182 3:12574219-12574241 CTGGACAGACTGAGCTTACAAGG + Intronic
950625582 3:14244334-14244356 TTGGACACACAGAGACCCCAGGG - Intergenic
952505346 3:34002287-34002309 CAGGATACAGAAAGCTCCCAAGG - Intergenic
954116362 3:48468964-48468986 CAGGACACACACAGCACACATGG + Exonic
954116369 3:48469004-48469026 CTGGACACACACAGCACACATGG + Exonic
954292944 3:49659290-49659312 CTGCAGGCACAGAGGTCCCATGG + Intronic
954422516 3:50426096-50426118 CTGCCCTCCCAGAGCTCCCAGGG - Intronic
954763352 3:52893559-52893581 CTGTTCACACAGAGCACACAGGG + Intronic
954786786 3:53099216-53099238 CTGGTGCCACAGAGATCCCAGGG + Intronic
955461715 3:59190150-59190172 GGGGACACAGTGAGCTCCCAGGG + Intergenic
956209650 3:66789803-66789825 CTGCACACACAGAGGTCCTTAGG + Intergenic
957189869 3:76993755-76993777 CTGAAAACACATAACTCCCATGG - Intronic
957629786 3:82704140-82704162 CTGGACACATAGAGCCTCCCAGG - Intergenic
959688942 3:109177648-109177670 CTGGAGAAACACAGTTCCCAGGG + Intergenic
959881957 3:111454291-111454313 ATGGACCCACAGAGGTGCCATGG + Intronic
960317885 3:116200563-116200585 CAGGAGACACATAGCCCCCAGGG + Intronic
961571421 3:127801980-127802002 CTGGCCAGACAGAGCTCTCAAGG - Intronic
961658685 3:128457063-128457085 ATGGAGACACAGAGATGCCAAGG - Intergenic
963360053 3:144260420-144260442 CTGGACACATACACCTCCCATGG - Intergenic
963919818 3:150894539-150894561 CTGTAGACACAGAGCAGCCACGG - Intronic
964160550 3:153640581-153640603 GGGGACCCACTGAGCTCCCAGGG - Intergenic
967463853 3:189779495-189779517 GTGGACACAAATGGCTCCCATGG - Intronic
968550593 4:1221750-1221772 CTGCACACAGACAGCTCCCTCGG - Intronic
968799468 4:2732753-2732775 CAGGAGACAGAAAGCTCCCAAGG + Intergenic
968817061 4:2827693-2827715 CTACACACCCAGAGCTCCCCGGG - Intronic
968830305 4:2930226-2930248 CTGGACACCCTGAGTTCCCGTGG - Intergenic
968893956 4:3388074-3388096 CTGGCCACGCAGAGATCCCCTGG + Intronic
970697670 4:18697015-18697037 CTGGACACACAGGCCTCGCTGGG - Intergenic
971029404 4:22620688-22620710 CTGGAAGGACAGAGCGCCCATGG + Intergenic
971612932 4:28749173-28749195 CTGGATGCCCAGAGATCCCAAGG - Intergenic
972135243 4:35885006-35885028 CAGGACACAGATAGCTCCTATGG - Intergenic
972140179 4:35949404-35949426 CTGTTCACAAAGAACTCCCATGG - Intronic
973142142 4:46782008-46782030 CTGGTCGCACTGACCTCCCAAGG + Intronic
976777681 4:88723784-88723806 CTGGGGACACAAAGCTGCCATGG - Intergenic
976918799 4:90411042-90411064 CTGGACACATACACCTCCTAAGG + Intronic
977020097 4:91747391-91747413 GGGGACACAGCGAGCTCCCAGGG + Intergenic
977303887 4:95299212-95299234 TTGGACACACAGAGACACCAGGG + Intronic
981927774 4:150158217-150158239 GTGGACACACACAGATGCCAGGG - Intronic
985574899 5:669483-669505 CAGGACAGACAGAGGCCCCAAGG - Intronic
985674386 5:1223374-1223396 CTGGACACACACAGTGCCCAAGG - Exonic
986021358 5:3806879-3806901 CTGGATTCACAGTGTTCCCAGGG + Intergenic
986721079 5:10562481-10562503 CTGGACCCACTGTCCTCCCAGGG - Intergenic
987765778 5:22227309-22227331 CTAGATACTCAGAGATCCCAAGG + Intronic
989196971 5:38725501-38725523 CTGATCCCACACAGCTCCCAGGG - Intergenic
992415573 5:76549742-76549764 CAGGGCACAGAGAGCTCCCAGGG - Intronic
992914037 5:81429908-81429930 CTTGACACAGAGAGCTCCAATGG - Intronic
993300192 5:86199152-86199174 TTGGACGCACAGAGATGCCAAGG - Intergenic
994845464 5:104983008-104983030 CTAGACACATACAACTCCCAAGG - Intergenic
995181434 5:109234365-109234387 CTGAACACACAAAGTTCCCAGGG - Intergenic
997907754 5:137836412-137836434 ATGAAATCACAGAGCTCCCAGGG + Intergenic
998540761 5:142979435-142979457 CTGGATGCACAGGGTTCCCAAGG - Intronic
999242450 5:150135824-150135846 CTGGAACCACAGATCTCTCAGGG - Exonic
999574876 5:152964768-152964790 CTGTAGACACTGAGCTCCGATGG + Intergenic
1001052738 5:168426009-168426031 CTGGAGCCACAGAGCTGACATGG - Intronic
1001527541 5:172439500-172439522 CTGGTCACAGACAGCTTCCAGGG + Intronic
1002070078 5:176673974-176673996 CGGGACCCACAGAGCTCCAGGGG + Intergenic
1002813747 6:659701-659723 GGGGACACAGTGAGCTCCCAGGG - Intronic
1003029529 6:2589732-2589754 GGGGACCCAAAGAGCTCCCAGGG + Intergenic
1004163491 6:13235167-13235189 GTGGACACACAGAGACCTCAGGG + Intronic
1005298317 6:24447827-24447849 GTAGACACACAGAGCAGCCATGG + Intronic
1007642727 6:43355650-43355672 CTTCACTCTCAGAGCTCCCAAGG + Exonic
1009798426 6:68502437-68502459 GGGGACACAGTGAGCTCCCAAGG - Intergenic
1012445203 6:99300264-99300286 CTGGACACTCAGAGAATCCATGG + Intronic
1014842219 6:126233524-126233546 CTGGCCACACATAGCTGCAAGGG + Intergenic
1017017087 6:150110187-150110209 TTGGACACACAGAGATGCCAGGG + Intergenic
1018698920 6:166412062-166412084 CTGGTGACACGGAGCTCTCAAGG + Exonic
1018839072 6:167506085-167506107 CTGCACCCCCAGAGCTCCCCTGG - Intergenic
1021373203 7:19876187-19876209 CAGGAGACCCAGAGCTTCCAGGG - Intergenic
1022289849 7:28990369-28990391 CCTGACACACACAGCACCCAGGG + Intergenic
1022614998 7:31920259-31920281 CTGGACACACAGATATCTCCAGG + Intronic
1023701165 7:42893113-42893135 GGGGACCCAGAGAGCTCCCAGGG - Intergenic
1026532016 7:71207725-71207747 ATGGGCACACAAGGCTCCCAAGG - Intronic
1026895187 7:74006343-74006365 CTGGAAGGAGAGAGCTCCCATGG + Intergenic
1027263638 7:76481996-76482018 CTGGAAACACATAGTTTCCAGGG - Intronic
1028927846 7:96379573-96379595 GTGCACACACAGAGCACTCAAGG - Intergenic
1030750933 7:113231924-113231946 CTGGCCCCAAATAGCTCCCAAGG - Intergenic
1030935893 7:115584893-115584915 CGGGGCACAGTGAGCTCCCAGGG - Intergenic
1031920079 7:127593868-127593890 GTGGATACACAGACATCCCAAGG + Exonic
1032076501 7:128838550-128838572 CTGGACACACACAGCTGCCCCGG - Intronic
1032076532 7:128838703-128838725 CTGCACATACAGACCTGCCATGG + Exonic
1032448538 7:132005172-132005194 AGGGAAACACAGAGCTCCCTAGG - Intergenic
1033243893 7:139702723-139702745 CTGGGCACACAGAGGACCCCTGG + Intronic
1034066716 7:148144024-148144046 CTGGAAACACAGAGATTCCAGGG + Intronic
1034969785 7:155411640-155411662 CTGGAGCCACAGAGCGACCAAGG + Intergenic
1035448636 7:158959895-158959917 CTGCAAACACAGCGCTCCAACGG - Intergenic
1035448640 7:158959925-158959947 CTGCAAACACAGGGCTCCAACGG - Intergenic
1038236988 8:25769043-25769065 GGGGACACAGTGAGCTCCCAGGG - Intergenic
1039846976 8:41332418-41332440 GTGGAGACACAGAGATCCCAAGG - Intergenic
1040558398 8:48501343-48501365 TTGTTCACAGAGAGCTCCCAGGG - Intergenic
1040698568 8:50033676-50033698 TAGGACACACAGAGATACCAGGG - Intronic
1042941740 8:74115014-74115036 CTGGCCACAGGGAGCTCCCTAGG + Intergenic
1044114392 8:88316622-88316644 CTGGTCACCCAGAGCTCTGATGG + Intronic
1044715422 8:95095398-95095420 CTGGGCACAGAGAGCGGCCAAGG - Intronic
1045398609 8:101787266-101787288 CTAGAGACTCAAAGCTCCCAAGG + Intronic
1045504217 8:102767222-102767244 CTGGAAAAACAAAGCTCCCCTGG - Intergenic
1045531728 8:102991395-102991417 CCGGGAACACAGAGCTACCAGGG - Intergenic
1046711039 8:117512005-117512027 CAGAACACACAAAGCCCCCAGGG + Intergenic
1047372965 8:124271381-124271403 TTGGACACAGAGAGATACCAGGG + Intergenic
1047504963 8:125472136-125472158 ATGGACACACAGAGGTCCCTAGG - Intergenic
1049026590 8:139995243-139995265 ATAGCCAGACAGAGCTCCCAGGG + Intronic
1049278759 8:141733306-141733328 CAGGAGGGACAGAGCTCCCAGGG + Intergenic
1051122870 9:13771201-13771223 CAGGAAACACAGCGCTACCAGGG - Intergenic
1051182193 9:14423259-14423281 CTGGTCACTCCGTGCTCCCATGG - Intergenic
1051340347 9:16104541-16104563 CTGGACCCACAGAGATTTCAGGG + Intergenic
1053727771 9:41021858-41021880 GTGGCCACACATAGCTCCAAGGG - Intergenic
1054700741 9:68410249-68410271 GTGGCCACACATAGCTCCAAGGG + Intronic
1055548075 9:77402721-77402743 CTGGACAAACAGGGACCCCAAGG - Intronic
1056477472 9:86966995-86967017 CTTGAGACACAGAGTTCCCCAGG - Intergenic
1057564924 9:96159309-96159331 GTGGGCCCACAGAGTTCCCATGG - Intergenic
1058580757 9:106454009-106454031 TTGGACACACAGAACACACAGGG - Intergenic
1059033646 9:110729731-110729753 AAGGACACAAGGAGCTCCCATGG - Intronic
1060245908 9:121946186-121946208 GTGGACACACAGAGTGCCCTGGG + Intronic
1060927078 9:127462470-127462492 AGGGCCACACAGAGATCCCAAGG + Intronic
1061551301 9:131336341-131336363 CTGGACAGCCAGGGCTCCCAAGG - Intergenic
1061710052 9:132481189-132481211 TTGGGCCCAGAGAGCTCCCAAGG - Intronic
1061719697 9:132543937-132543959 CTGGACACACGCACCTCCCCCGG - Intronic
1062066143 9:134527375-134527397 CTGCACACACAGACCTTCCCTGG - Intergenic
1062195035 9:135268308-135268330 CCAGCCACACAGAGCTTCCAGGG + Intergenic
1062373233 9:136250960-136250982 CAGGACACACGGAGCTGCCAAGG - Intergenic
1203775386 EBV:70170-70192 CTGGACACACATGGCACTCATGG - Intergenic
1185461801 X:336301-336323 ATGGACACACAGAGGAACCACGG + Intronic
1187549749 X:20290366-20290388 CTGGCCACACTGAGTTGCCAGGG - Intergenic
1188738078 X:33742436-33742458 AGGGACCCACCGAGCTCCCAGGG + Intergenic
1189472176 X:41322824-41322846 CAGGACACACATAGCACACACGG + Intergenic
1190846856 X:54200888-54200910 ATAAATACACAGAGCTCCCAAGG + Intronic
1191965334 X:66751281-66751303 GGGGACCCAGAGAGCTCCCAGGG + Intergenic
1192227957 X:69242306-69242328 CTGTTCACACAGGGCTCGCAGGG - Intergenic
1192758000 X:74066349-74066371 CAGGACACACACAGCACGCACGG - Intergenic
1193643969 X:84044490-84044512 CTGGATTCAGTGAGCTCCCAGGG + Intergenic
1195042124 X:101024170-101024192 GTGGACACACAGAGACACCAAGG + Intronic
1195404976 X:104502887-104502909 CAGGACAAACACTGCTCCCAAGG + Intergenic
1196136564 X:112216207-112216229 CCTGACAGACAGAGCTCCAAAGG - Intergenic
1197726120 X:129777603-129777625 CTGGTCACGCAGAGCCCCAAAGG + Intergenic
1198843144 X:140880555-140880577 AGGGACCCAGAGAGCTCCCAGGG - Intergenic
1200071171 X:153530228-153530250 CTAGACACCCAGATCCCCCAGGG + Intronic