ID: 1170204541

View in Genome Browser
Species Human (GRCh38)
Location 20:13784520-13784542
Sequence CCGAGAGAGGGGAAGGCGAC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 267
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 251}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170204541 Original CRISPR CCGAGAGAGGGGAAGGCGAC CGG Intronic
901158799 1:7159351-7159373 CAGGGAGAAGGGAAGGTGACCGG - Intronic
901373132 1:8817521-8817543 GCGAGAGAGGGGAAAAGGACGGG + Intronic
901642378 1:10699217-10699239 CCAGGAGAGGGGAAGGAGAACGG - Intronic
901728554 1:11261791-11261813 CCGAAAGGGGGGAAGGTGGCTGG + Intronic
903824029 1:26129451-26129473 CCCAGAGAGGAGAGAGCGACTGG + Intergenic
904919717 1:33997526-33997548 CTGAGAGAGGGGAGGAAGACAGG - Intronic
905933614 1:41806843-41806865 CCAAGAGAGGTCAAGACGACAGG + Intronic
906382276 1:45340346-45340368 CTGGGAGAGGGGAAGGCCTCGGG + Exonic
906678240 1:47708627-47708649 CCCAGGGAGGGGAAGGCCAGGGG + Intergenic
907051171 1:51330597-51330619 CCGGGGGCGGGGAAGGCGGCGGG + Intronic
910928499 1:92420041-92420063 CCTAGAGGAGGGAAGGCGAGGGG + Intergenic
912642982 1:111364840-111364862 GGGAGAGAGGGGAAAGGGACGGG + Intergenic
912976559 1:114336253-114336275 CAGAGAGAGGGGAACAAGACTGG + Intergenic
915355825 1:155254887-155254909 CCGAGCGAGGCGCAGGCAACCGG - Exonic
920387401 1:205578722-205578744 CTGAGAGAGGGGAGGGGGAAAGG - Intronic
922864375 1:228847129-228847151 TGGAGAGAGGGGATGGAGACTGG - Intergenic
923226098 1:231940165-231940187 CAGAGAGAGGGGAAGGACAGAGG - Intronic
924239481 1:242027364-242027386 CCCAGTGAGGGGAAGGGGACAGG + Intergenic
924660162 1:246008453-246008475 CCGAGGGAGGGGAAGCCCAGAGG - Intronic
1067479696 10:46586921-46586943 CCGAGAGAGTGGGAGGGGCCAGG + Intronic
1067615041 10:47754876-47754898 CCGAGAGAGTGGGAGGGGCCAGG - Intergenic
1069754033 10:70762294-70762316 CCCAGGGAGGGGAGGGCAACAGG - Exonic
1069890060 10:71646988-71647010 ACCAGAGAGGGGCAGGCGCCTGG + Intronic
1070160718 10:73865313-73865335 CAGAGAGAGGGGAACGCCGCAGG + Intronic
1071491463 10:86139387-86139409 CAGAGGGAGGTGAAGGGGACTGG - Intronic
1072616033 10:97049399-97049421 CAGAGAGAGGGAAAGGTGAGTGG - Intronic
1074116037 10:110458100-110458122 CCGAGGGAGGGGCAGGCCCCAGG - Intergenic
1075592538 10:123703126-123703148 CCCAGAGAGGGGAAGGGACCTGG + Intergenic
1075915105 10:126160116-126160138 ACAAGAGAGGGGAAGGGGAAGGG + Intronic
1076478786 10:130770256-130770278 CTGAGAGAGGGCCAGGCGAGGGG - Intergenic
1076725594 10:132411488-132411510 CCGACAGAAGGGAAGGCCCCAGG + Intronic
1078340473 11:10495111-10495133 CAGAGGGAGGGGAAGGGGCCAGG - Intronic
1079360314 11:19765451-19765473 CAGAGGGAGGGGAAGGGGAAGGG - Intronic
1083285090 11:61653552-61653574 GCGAAAGAGGGGCAGGAGACAGG - Intergenic
1083417773 11:62536428-62536450 CAGAGAGAGGCGGAGGTGACGGG - Intronic
1083886982 11:65577685-65577707 CCCAGAAAGGGGAAGCGGACAGG - Intronic
1084941977 11:72617829-72617851 CAGAGAGAGGGAAAGGGGGCAGG - Intronic
1085532228 11:77198649-77198671 CAGACAGAGGGGAAGGAGAGGGG + Intronic
1089820144 11:121218255-121218277 CCAAAAGAGGGGAAGGAGAGAGG + Intergenic
1090437050 11:126695744-126695766 CTGAGAGAGGGGAAGGAGGCAGG + Intronic
1091214037 11:133889298-133889320 CAGAGAGAGAGGTAGGCGAGAGG + Intergenic
1091405065 12:203844-203866 CCGGGAGAGGGGAGTGCGGCGGG + Intronic
1091671426 12:2454797-2454819 ACGTGAAAGGGGAAGGAGACGGG - Intronic
1096191284 12:49621912-49621934 TCCAGAGAGGGGAAGACGATGGG + Intronic
1097176142 12:57144091-57144113 CAGGGAGATGGGAAGGGGACCGG - Intronic
1100490406 12:95073149-95073171 CCGGGAGAGGCGGGGGCGACAGG - Intronic
1101399930 12:104378313-104378335 CCCAGAAAGGGGAAGGCCAGGGG + Intergenic
1101431528 12:104631505-104631527 CCCAGAGATGGGAAGGAGGCTGG + Intronic
1101718121 12:107328946-107328968 CAGGGAGAGGGGAAGCCGGCGGG - Intronic
1103348305 12:120265578-120265600 CCGAGGGAGGAGGAGGCGAGAGG - Intronic
1103763814 12:123268483-123268505 CGGAGAGAGGGGCAGGTGCCGGG - Intronic
1104939456 12:132388039-132388061 CAGAGAGAGGGGAGGGAGATGGG + Intergenic
1112412755 13:99178216-99178238 CCTGGAGAGGGGAAGGAGAGTGG - Intergenic
1114216326 14:20660282-20660304 CAGAGGGAGAGGAAGGCCACAGG - Intergenic
1115960850 14:38835461-38835483 CCCAGAGAGGAGAAGGCCTCCGG + Intergenic
1117647238 14:57865512-57865534 CCGTGAGAGGGCAAGGGGCCCGG - Intronic
1118033507 14:61840984-61841006 CCAAGTGAGGGGAAGGCAATGGG + Intergenic
1118514150 14:66508307-66508329 CCGCGGGAGGGGAAGGAGTCAGG - Exonic
1118533912 14:66737247-66737269 CCGAAAGAGGGGAAAGGGAAGGG - Intronic
1118870127 14:69734392-69734414 CAGAGAGAGGGCAAGGGCACAGG + Intronic
1119205511 14:72790986-72791008 CCGAGAGAGGGAAGAGAGACAGG + Intronic
1120255019 14:82107459-82107481 AAGAGAGAGGGGAAGGGGGCTGG + Intergenic
1120387554 14:83865130-83865152 GGGAGAGATGGGAAGGGGACGGG - Intergenic
1122904350 14:104795182-104795204 CCGAGAGAAGGGACGCCGCCGGG - Intronic
1125831371 15:42719083-42719105 TGGAGAGAAGGGAATGCGACAGG + Intronic
1131176326 15:90211771-90211793 CTGAGAGTGGGGGAGGCCACTGG + Intronic
1132273147 15:100544288-100544310 CCGCGAGCGGGGAGCGCGACTGG + Intronic
1132665831 16:1080926-1080948 CCGGGAGAGGGAACGGGGACAGG + Intergenic
1132872162 16:2120133-2120155 CCCAGAGAGGTCAAGGCTACAGG + Intronic
1134520365 16:14916762-14916784 CCCAGAGAGGTCAAGGCTACAGG - Intronic
1134551210 16:15139212-15139234 CCCAGAGAGGTCAAGGCTACAGG + Intronic
1134708039 16:16315413-16315435 CCCAGAGAGGTCAAGGCTACAGG - Intergenic
1134715252 16:16355446-16355468 CCCAGAGAGGTCAAGGCTACAGG - Intergenic
1134951563 16:18353232-18353254 CCCAGAGAGGTCAAGGCTACAGG + Intergenic
1134959505 16:18396713-18396735 CCCAGAGAGGTCAAGGCTACAGG + Intergenic
1136406932 16:30053506-30053528 CCCAGAGAGGGGAAGGGGCCCGG - Intronic
1137447551 16:48540957-48540979 CCGAGAAAGGGAAAGGGGACAGG + Exonic
1139636942 16:68263865-68263887 CAGAGGGAGGGGAAGGGGGCAGG + Intergenic
1140481132 16:75263501-75263523 CCCAGAGAGGGGAAGGAGCCAGG - Intronic
1141692967 16:85606897-85606919 CCGAGGCAGGGGAAGGGGGCTGG - Intergenic
1142158891 16:88547092-88547114 CAGAGGGTGGGGAAGGCGAGGGG + Intergenic
1142158900 16:88547116-88547138 CAGAGGGTGGGGAAGGCGAGGGG + Intergenic
1142158909 16:88547140-88547162 CAGAGGGTGGGGAAGGCGAGGGG + Intergenic
1142158918 16:88547164-88547186 CAGAGGGTGGGGAAGGCGAGGGG + Intergenic
1142158927 16:88547188-88547210 CAGAGGGTGGGGAAGGCGAGGGG + Intergenic
1142158936 16:88547212-88547234 CAGAGGGTGGGGAAGGCGAGGGG + Intergenic
1142158945 16:88547236-88547258 CAGAGGGTGGGGAAGGCGAGGGG + Intergenic
1142158954 16:88547260-88547282 CAGAGGGTGGGGAAGGCGAGGGG + Intergenic
1142158963 16:88547284-88547306 CAGAGGGTGGGGAAGGCGAGGGG + Intergenic
1142158988 16:88547352-88547374 CAGAGGGTGGGGAAGGCGAGGGG + Intergenic
1142158997 16:88547376-88547398 CAGAGGGTGGGGAAGGCGAGGGG + Intergenic
1142159004 16:88547400-88547422 CAGAGGGTGGGGAAGGTGACCGG + Intergenic
1142159046 16:88547520-88547542 CAGAGGGTGGGGAAGGTGACTGG + Intergenic
1142159054 16:88547544-88547566 CAGAGGGTGGGGAAGGTGACGGG + Intergenic
1142159063 16:88547568-88547590 CAGAGGGTGGGGAAGGCGAGGGG + Intergenic
1142159070 16:88547592-88547614 CAGAGGGTGGGGAAGGTGACCGG + Intergenic
1142159080 16:88547616-88547638 CAGAGGGTGGGGAAGGCGAGGGG + Intergenic
1142159089 16:88547640-88547662 CAGAGGGTGGGGAAGGCGAGGGG + Intergenic
1142159098 16:88547664-88547686 CAGAGGGTGGGGAAGGCGAGGGG + Intergenic
1142159107 16:88547688-88547710 CAGAGGGTGGGGAAGGCGAGGGG + Intergenic
1142159116 16:88547712-88547734 CAGAGGGTGGGGAAGGCGAGGGG + Intergenic
1142159125 16:88547736-88547758 CAGAGGGTGGGGAAGGCGAGGGG + Intergenic
1142159134 16:88547760-88547782 CAGAGGGTGGGGAAGGCGAGGGG + Intergenic
1142159142 16:88547784-88547806 CAGAGGGTGGGGAAGGCGACGGG + Intergenic
1142159150 16:88547808-88547830 CAGAGGGTGGGGAAGGCGACGGG + Intergenic
1143905865 17:10208641-10208663 GCGAGAGAGGGGAAGGAGGTGGG + Intergenic
1143906980 17:10216792-10216814 CCGGGGGAGGGGGAGGAGACAGG - Intergenic
1144322642 17:14145003-14145025 CCTAGAAAGTGGAAGGGGACAGG + Intronic
1144692964 17:17280907-17280929 CCGAGGGAGGGGAGGCCGGCCGG + Intronic
1145235738 17:21207041-21207063 CAGAGAGTTGGGAAGCCGACTGG - Intronic
1148332165 17:46819428-46819450 CCGAGAGCAGGAAATGCGACTGG - Intronic
1152036250 17:77874908-77874930 CAGGGAGAGGGGAGGGCGCCAGG + Intergenic
1152069141 17:78126523-78126545 CAGAGAGAGCGGGAGGTGACAGG - Exonic
1152396643 17:80036906-80036928 CCGAGAGAGGACAAAGGGACAGG - Intronic
1152970764 18:158856-158878 CCGGGAGAGGGGACGGTGCCTGG - Intronic
1153262235 18:3235773-3235795 CCGAGAGAGGGGAACGCTGTGGG + Intergenic
1153946647 18:10023823-10023845 CTGTGAGAGGGGAGGGCCACTGG + Intergenic
1157833585 18:50879102-50879124 CCGAGAGAGGGGAGGGCGCGAGG - Exonic
1160495973 18:79375635-79375657 CTGAGTGAGGGGAAGGGGCCGGG + Intronic
1160688136 19:446815-446837 CCCAGAGAGGGGATGGCACCTGG + Intronic
1160698995 19:497335-497357 CCGGGAGAGGGGAGGGGGCCCGG + Intronic
1160800106 19:963745-963767 CCTAGGGAGGGGAAGGGGATGGG - Intronic
1162330747 19:10027747-10027769 CCCAGGGAGGGGAAGGCGGGCGG + Intergenic
1162366461 19:10252454-10252476 GCGAGCGAGGGTAAGGCAACCGG + Exonic
1162775204 19:12975139-12975161 CAGAGAGATGGGAACGGGACAGG + Intergenic
1164844682 19:31421999-31422021 GCAAGAGAGGGGACGGCGGCTGG + Intergenic
1165336769 19:35176003-35176025 CAGAGAGAGGGGGAGGTGCCAGG - Intergenic
1165861228 19:38910650-38910672 CCGAGAGAGGCGGAGGAGAGAGG - Exonic
1166301181 19:41913008-41913030 CTGGGAGAGGGGAAGGCCCCGGG - Intronic
927198318 2:20563302-20563324 CCCAGAGAGGGAAGGGCCACAGG + Intronic
927910291 2:26893029-26893051 CCCCTAGAGTGGAAGGCGACAGG - Intronic
929014972 2:37484967-37484989 CCCAGAGTGGGGAGGGAGACAGG + Intergenic
933215824 2:79629063-79629085 TGGAGAGTGGGGAAGGAGACAGG - Intronic
934526350 2:95054202-95054224 CAGAGAGAGGGGAAGCCATCTGG - Intergenic
935264776 2:101384889-101384911 AAGAGAGAGGGGAAGGTGCCAGG - Intronic
936713885 2:115162316-115162338 CCGAGGGAGGGAGAGGCGGCCGG + Intronic
937258942 2:120573167-120573189 CCAAGAGAGGGGGAGCCCACAGG - Intergenic
937943719 2:127311633-127311655 CCTAGAGAGGGGAGGGGGAGTGG - Intronic
940098996 2:150011920-150011942 CTGAGAGAGGGGAAGGCCTCTGG - Intergenic
942451734 2:176112487-176112509 CCGGGAGAGGGGCAAGCGGCAGG - Intronic
945891515 2:215435933-215435955 CAGAGGGTGGGGAAGGGGACGGG + Exonic
948476941 2:238226492-238226514 CCGAGAGTGGGGAGGGCGGTGGG + Intronic
948815396 2:240507739-240507761 CTGACAGAGGGGAAGGCCCCAGG + Intronic
1169386063 20:5150562-5150584 CGGAGAGAAGGGGAGGTGACAGG + Intronic
1170031411 20:11947971-11947993 ATGGCAGAGGGGAAGGCGACTGG + Intergenic
1170204541 20:13784520-13784542 CCGAGAGAGGGGAAGGCGACCGG + Intronic
1172094621 20:32454599-32454621 CCGAGGCAGGGGCAGGAGACAGG - Intronic
1174301557 20:49585913-49585935 CAGAGAAAGAGGAAGGGGACAGG + Intergenic
1174449303 20:50609781-50609803 CCCAGAGAGGAGAAGTCGACAGG - Intronic
1174860460 20:54086466-54086488 CCAAGAGTGGGGCAGGGGACAGG - Intergenic
1175648501 20:60696285-60696307 GCCAGAGAGGGCAAGGAGACAGG - Intergenic
1176286056 21:5020330-5020352 CCGAGAGAGGGGACGCCGCGTGG - Intergenic
1178259768 21:31088374-31088396 CAGAGAGAGGTGAAGCCGGCTGG - Intergenic
1178476350 21:32940630-32940652 TCAAGAGAGGAGGAGGCGACTGG + Intergenic
1179871125 21:44243145-44243167 CCGAGAGAGGGGACGCCGCGTGG + Intergenic
1181433967 22:22899669-22899691 CCAAGAGCGGGGAAGGAGAGGGG - Intergenic
1181434904 22:22905039-22905061 CCAAGAGCGGGGAAGGAGAGGGG - Intergenic
1183378146 22:37476982-37477004 CTGAGAGAGAGGAAGGCCAAGGG + Intronic
1183503335 22:38194402-38194424 CAGAGGGAGGGGATGGGGACTGG + Intronic
1185409902 22:50676362-50676384 CCTGGGGATGGGAAGGCGACGGG + Intergenic
949979752 3:9494707-9494729 GGGAGAGAGTGGGAGGCGACGGG - Intergenic
950161434 3:10764038-10764060 GTGAGTGAGGGGAAGGCAACAGG - Intergenic
950366400 3:12488149-12488171 CTGAGGGAGGGGAAGGTGAGTGG - Intronic
953025013 3:39139751-39139773 CCCAGAGAGGGGAAGGGACCCGG - Intergenic
953850163 3:46459897-46459919 CCGAGAGAGAGGGAGGAGTCTGG - Intronic
954186279 3:48919199-48919221 CCGAGAGCTGAGAAGGCGGCGGG - Exonic
954996696 3:54888307-54888329 CCGAGAGAGAGGGAGGCGGAAGG + Intronic
956552182 3:70473860-70473882 GCGAGAGAGGAGAAGGTGCCAGG - Intergenic
956613660 3:71149835-71149857 AGGAGAGAAGGGAATGCGACAGG + Intronic
957116511 3:76033848-76033870 CGGAGAGACGGGAGGGTGACAGG - Intronic
957118263 3:76055491-76055513 CCAAAAGGGGGGAGGGCGACAGG - Intronic
960130468 3:114050643-114050665 CTGATGGAGGGGAAGGAGACTGG + Intronic
961545806 3:127632151-127632173 CCCAGAGTGGGGAAGGAAACAGG + Intronic
961811665 3:129525470-129525492 CCCAGAGAGGGGAAGGAAGCAGG + Intergenic
962746769 3:138402536-138402558 CCGAGAGAGGGGGAGGAACCGGG - Exonic
964256169 3:154776876-154776898 CCTAGAGAGGGGTAGGTGAGGGG - Intergenic
966793565 3:183694385-183694407 GGGAGAGAAGGGAAGGGGACTGG - Intergenic
968091362 3:195900244-195900266 CCGAGAGAGAGGAGGGGAACAGG + Intronic
968487749 4:872066-872088 CCGAGGGAGGGCAGGGAGACGGG + Intronic
968700919 4:2058211-2058233 CCTGGAGAGGGGCAGGGGACGGG - Intergenic
968903739 4:3442550-3442572 CCGAGGGCGGGGAAGGTGTCAGG + Intronic
971266468 4:25100248-25100270 CCCAGATAGGGGAGGGAGACAGG + Intergenic
972266549 4:37465479-37465501 CCCAGAGAGGGGAGGGCGAAGGG + Intronic
972356022 4:38280165-38280187 CCGAGAGAGGGGCAGGCTGCAGG - Intergenic
975689347 4:76949386-76949408 CCGGGAGAAGGAAGGGCGACCGG - Intergenic
981325683 4:143444761-143444783 ACCAGAGAGGGGAAGGAGGCAGG - Intronic
983389391 4:167110008-167110030 CCTAGAGAGAGGAAGGCATCAGG - Intronic
987875649 5:23677174-23677196 ACTAGAGTGGGGAAGGAGACAGG + Intergenic
990513870 5:56514508-56514530 CAGAGACAGGGGAAGGTGCCAGG - Intronic
992349680 5:75916292-75916314 ACGAGAAAGGGGAAGGGGAAGGG - Intergenic
999262796 5:150247876-150247898 CAGAGAGACGGGAGGGCCACGGG + Intronic
1001411507 5:171515609-171515631 CCGAGAGAGGGGAAGGGGCCAGG + Intergenic
1001953195 5:175830413-175830435 CCGGGGGCGGGGAAGGAGACAGG - Intronic
1002394138 5:178940487-178940509 ACGAGGGAGAGGAAGGCGCCTGG - Intergenic
1004017056 6:11741785-11741807 GAGAGAGAGGGGAAGGGGGCAGG - Intronic
1005622268 6:27630977-27630999 CAGAGGGAGGGGCAGGCGGCGGG + Intergenic
1006395088 6:33782051-33782073 CTGTGTTAGGGGAAGGCGACAGG - Intronic
1006922104 6:37633882-37633904 CCCAGAGTGGGGAAGGGGAGTGG - Exonic
1009809237 6:68639441-68639463 CAAAGAGAGGGGAAGGTGAGCGG + Intronic
1011419336 6:87155412-87155434 CCGAGGGAGGTGAAGGCAAGGGG - Intronic
1012054784 6:94392724-94392746 CAGAGAGAGGGGAAGGAGTGTGG - Intergenic
1013178812 6:107700780-107700802 GGGAGAGAGGGGAAGGGGATTGG - Intergenic
1013590850 6:111618669-111618691 ACGAGAAAGGGGAAGGAGAGAGG - Intergenic
1017043615 6:150327251-150327273 CCCAGAGAGGGGAAGTCAAGAGG - Intergenic
1019119939 6:169794464-169794486 CCGGGAGAGGCCAAGGGGACGGG + Intergenic
1019148515 6:169988899-169988921 CCGTGGGAGGGGGAGGCCACTGG - Intergenic
1020257334 7:6509417-6509439 CCCAGAGAGGGAAAGGAGAGTGG - Intronic
1020347682 7:7182869-7182891 CGGAGAGGGGGGAGGGCGAGGGG - Intronic
1020461564 7:8434406-8434428 GGGAGAGAGGGGAATGCGCCGGG - Exonic
1021451341 7:20785702-20785724 CCGAGAGGGAGGAGGGAGACGGG + Exonic
1021697062 7:23286192-23286214 GAGAGAGAGGGGAAGGAGAGGGG - Intergenic
1021911099 7:25386573-25386595 CTGAGAGAGGGGAGAGTGACTGG + Intergenic
1022552020 7:31249880-31249902 CTGAGAGAGCAGAAGTCGACAGG - Intergenic
1022910691 7:34897483-34897505 GCAAGAGACGGGAAAGCGACAGG + Intergenic
1023608829 7:41954401-41954423 CCTGGAGAGGGGAAGGGGGCTGG + Intergenic
1024553342 7:50581973-50581995 CTGAGAGAGGGGAAGGGTAGTGG - Intergenic
1025766866 7:64464036-64464058 CCGAGAGAGAGGGAGGGGGCTGG + Intergenic
1025801912 7:64794595-64794617 CCGAGAGAGGGGGAGGGAGCTGG + Intronic
1026392232 7:69913042-69913064 CAGAGAGTGGGAAAGGCAACTGG - Intronic
1026795692 7:73364562-73364584 CCGAGAGTAGGAAAGGCGGCGGG + Intergenic
1029046653 7:97636409-97636431 CCGATAGTAGGGCAGGCGACAGG - Intergenic
1029423396 7:100483379-100483401 CCGAGGGTGGGGAACGGGACGGG - Intergenic
1029691048 7:102182039-102182061 ATGAAAGAGGGGAAGGGGACAGG - Intronic
1030143562 7:106330221-106330243 CCAAGAGAGGGGAAGGGCTCTGG + Intergenic
1031866000 7:127039652-127039674 GCAAGAGAGGGGAAGGGGAAGGG + Intronic
1031866008 7:127039674-127039696 GCAAGAGAGGGGAAGGGGAAGGG + Intronic
1031866027 7:127039740-127039762 ACAAGAGAGGGGAAGGAGAAGGG + Intronic
1032383177 7:131504508-131504530 GCTAGAGTGGGGAAGGTGACCGG + Exonic
1034344847 7:150379628-150379650 CCGAGGGTGGGGAGGGCGCCAGG + Intronic
1034412087 7:150947111-150947133 CCGGGAGTGGGGAAGGGGAAGGG + Intronic
1035782512 8:2239655-2239677 CCCAGAGAGGGGAGGGTGGCAGG - Intergenic
1035809608 8:2479933-2479955 CCCAGAGAGGGGAGGGTGGCAGG + Intergenic
1036500190 8:9307135-9307157 GGGAGAGAGGGGCAGGAGACAGG + Intergenic
1037616116 8:20520300-20520322 CAGAGAGAGGGGAAGGAGAGTGG - Intergenic
1039092787 8:33850237-33850259 CCTAGAGAGGGGAAGGAGAGAGG - Intergenic
1040638808 8:49306613-49306635 CAGTGAGAGGTGAAGCCGACTGG + Intergenic
1046651088 8:116837325-116837347 CCGAGAGATGGGAAGCCATCGGG + Intronic
1048266307 8:132990565-132990587 CAGAGGGAGGGGGAGGAGACAGG - Intronic
1048830483 8:138472124-138472146 CCGAGAGAGAGGACAGAGACAGG + Intronic
1050090609 9:2014750-2014772 CAGAGAGAGAGGGAGGGGACGGG - Intergenic
1053010222 9:34628765-34628787 CGGAGAGAGGGGCAGAGGACAGG + Intergenic
1053681083 9:40485894-40485916 CCGACAGAGGAGAAGGCCCCAGG + Intergenic
1053931070 9:43114208-43114230 CCGACAGAGGAGAAGGCCCCAGG + Intergenic
1054282630 9:63139040-63139062 CCGACAGAGGAGAAGGCCCCAGG - Intergenic
1054294169 9:63321409-63321431 CCGACAGAGGAGAAGGCCCCAGG + Intergenic
1054392191 9:64625898-64625920 CCGACAGAGGAGAAGGCCCCAGG + Intergenic
1054426838 9:65131109-65131131 CCGACAGAGGAGAAGGCCCCAGG + Intergenic
1054503537 9:65890431-65890453 CCGACAGAGGAGAAGGCCCCAGG - Intronic
1056332713 9:85534886-85534908 GAGAGAGAGGAGAAGGAGACAGG - Intergenic
1057453077 9:95182879-95182901 CTGGGACAGGGGAAGGTGACTGG + Intronic
1057997168 9:99828799-99828821 CCGAGAGGCGGGAAGGCCAGCGG - Exonic
1059450720 9:114370191-114370213 CTGAAAGAGGGGGAGGCGGCGGG - Intronic
1060237879 9:121878878-121878900 CCCAGGGAGGAGGAGGCGACTGG - Intronic
1060799927 9:126537342-126537364 CCGAGGGATGGGCAGGCGATGGG - Intergenic
1061128133 9:128689525-128689547 GGGAGAGAAGGGAAGGCGAAGGG - Intronic
1061248099 9:129411801-129411823 CCTGGAGAGGGGAAGGAGATGGG - Intergenic
1061680245 9:132239510-132239532 CCCAGAGAGGGAAGGGCCACTGG - Intronic
1061987990 9:134141332-134141354 GGGAGGGAGGGGAAGGGGACTGG + Intronic
1062144595 9:134981981-134982003 CAGGGAGAAGGGATGGCGACAGG + Intergenic
1185459517 X:328291-328313 CGGGGAGAGGGGAGGGGGACGGG - Intergenic
1189299745 X:39943908-39943930 TGGAGAGAGAGGCAGGCGACTGG + Intergenic
1189330728 X:40143275-40143297 AAGAGAGAGGGAAAGGCGGCAGG - Intronic
1189332612 X:40152896-40152918 CCGAGAGGGCGGGAGGAGACAGG + Intronic
1189543868 X:42021531-42021553 CCAAGAAAGGGGAAGGGAACTGG - Intergenic
1190561933 X:51694932-51694954 GAGAGAGAGGGGAAGGGGAAGGG + Intergenic
1192617524 X:72643148-72643170 CAGAGAAAAGGGAAGGAGACTGG + Intronic
1201294552 Y:12452637-12452659 CTCAGAGAGGGGAATGTGACAGG + Intergenic