ID: 1170205249

View in Genome Browser
Species Human (GRCh38)
Location 20:13791139-13791161
Sequence AAACTCAACATATCTAAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 401
Summary {0: 1, 1: 0, 2: 5, 3: 51, 4: 344}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170205249_1170205255 24 Left 1170205249 20:13791139-13791161 CCTGTTTTAGATATGTTGAGTTT 0: 1
1: 0
2: 5
3: 51
4: 344
Right 1170205255 20:13791186-13791208 ATAAATAGCTGGCAGGTAGTTGG 0: 1
1: 0
2: 1
3: 21
4: 229
1170205249_1170205252 -3 Left 1170205249 20:13791139-13791161 CCTGTTTTAGATATGTTGAGTTT 0: 1
1: 0
2: 5
3: 51
4: 344
Right 1170205252 20:13791159-13791181 TTTGAGATGGCAGTGGAATATGG 0: 1
1: 0
2: 1
3: 25
4: 256
1170205249_1170205253 13 Left 1170205249 20:13791139-13791161 CCTGTTTTAGATATGTTGAGTTT 0: 1
1: 0
2: 5
3: 51
4: 344
Right 1170205253 20:13791175-13791197 AATATGGTAGTATAAATAGCTGG 0: 1
1: 0
2: 2
3: 24
4: 205
1170205249_1170205254 17 Left 1170205249 20:13791139-13791161 CCTGTTTTAGATATGTTGAGTTT 0: 1
1: 0
2: 5
3: 51
4: 344
Right 1170205254 20:13791179-13791201 TGGTAGTATAAATAGCTGGCAGG 0: 1
1: 0
2: 0
3: 9
4: 101
1170205249_1170205251 -10 Left 1170205249 20:13791139-13791161 CCTGTTTTAGATATGTTGAGTTT 0: 1
1: 0
2: 5
3: 51
4: 344
Right 1170205251 20:13791152-13791174 TGTTGAGTTTGAGATGGCAGTGG 0: 1
1: 1
2: 8
3: 62
4: 354

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170205249 Original CRISPR AAACTCAACATATCTAAAAC AGG (reversed) Intronic
902054988 1:13593283-13593305 AAACTCATCATATCTAAAGCCGG - Intronic
903743091 1:25569643-25569665 GAACTCAATATGTCTAAAAATGG + Intergenic
906557671 1:46727186-46727208 AAGCTCAACAAATCCTAAACAGG + Intergenic
906881232 1:49593469-49593491 AAACTCTATATACCAAAAACTGG + Intronic
907095704 1:51778455-51778477 ACACTAAACATAGCAAAAACTGG + Intronic
907657262 1:56356906-56356928 GAACTCTAAATATCTGAAACAGG + Intergenic
907774277 1:57498175-57498197 GAATTCAACATACCCAAAACAGG - Intronic
908327680 1:63039614-63039636 AAACTTACCATATCTAAAACTGG + Intergenic
908434891 1:64095778-64095800 AAACTCAACATTCTTAAAACTGG + Intronic
910390585 1:86739067-86739089 AAACTTAACATATTTAAAACTGG - Intronic
911355317 1:96811009-96811031 AAACTTAAAATATATAACACTGG + Intronic
911619783 1:100053600-100053622 AAAATTAATATGTCTAAAACTGG - Intronic
912074209 1:105851541-105851563 TAACCCAAAATATCTACAACAGG - Intergenic
912307960 1:108590060-108590082 AACCTCAAAATATCCAAAACTGG + Intronic
913025943 1:114840603-114840625 CAACTCAAGCTAACTAAAACAGG - Intergenic
914337381 1:146727560-146727582 AAATTCAACATATAGGAAACTGG + Intergenic
915998583 1:160591322-160591344 TATCTCAAAATAGCTAAAACAGG - Intergenic
916148224 1:161760507-161760529 AATCTCGACATCTCTAAAAGTGG + Intergenic
917511289 1:175671200-175671222 AAACCCAACATGTCCAAAGCTGG - Intronic
918953687 1:191175767-191175789 AAAGGCAACAGATCTAAAGCTGG - Intergenic
919538272 1:198815471-198815493 AAACTCAATATCTCTAATTCAGG + Intergenic
919965949 1:202525184-202525206 CAAACCAACATATCTAAAACTGG - Intronic
921686114 1:218091038-218091060 CAGCTCAACATATCCAAAATTGG - Intergenic
921924940 1:220703571-220703593 AAACTCACCTTATCTGTAACGGG + Intergenic
922029364 1:221783089-221783111 AAACTCCTCATCTGTAAAACAGG + Intergenic
922152803 1:223019829-223019851 AAACCCAACGTATCTGAGACAGG - Intergenic
923081726 1:230663475-230663497 AAACAGAAGATCTCTAAAACAGG - Intronic
923747514 1:236716250-236716272 AACTTCAACCTATCAAAAACAGG - Intronic
923842005 1:237683121-237683143 AAACTCAATAGATAGAAAACTGG + Intronic
924117186 1:240759690-240759712 AAACTATACATATCTTAAAGTGG + Intergenic
1064487798 10:15814150-15814172 ATATTTAACAAATCTAAAACAGG + Intronic
1065797656 10:29322066-29322088 AAAGTCAACATTTCAAAGACAGG + Intergenic
1066116741 10:32247355-32247377 AAACTAAACAAATTTCAAACTGG + Intergenic
1066164226 10:32768749-32768771 AATCTCGACATATTTAAAAATGG - Intronic
1067121025 10:43472257-43472279 AAGCTCAACATGATTAAAACTGG + Intronic
1067513850 10:46919844-46919866 AAACACAACATATTAATAACAGG - Intronic
1067648404 10:48131990-48132012 AAACACAACATATTAATAACAGG + Intergenic
1072266259 10:93730790-93730812 AAAGTCTACATACCTAAAGCAGG - Intergenic
1072504655 10:96053057-96053079 GAACTCCACAAATTTAAAACAGG - Intronic
1072858871 10:98981730-98981752 CCCCTCAATATATCTAAAACTGG + Intronic
1073080540 10:100857384-100857406 AAGCTCAACGTGTCTAAAAATGG + Intergenic
1074096762 10:110320030-110320052 AAATTCAACATATTCAAAACGGG - Intergenic
1074241870 10:111647735-111647757 AAATTCCACATACCTACAACTGG + Intergenic
1078042961 11:7885211-7885233 AAACTCAAGATATTTATAAGAGG - Intergenic
1078644144 11:13123473-13123495 AAACTCCACATGGCCAAAACTGG + Intergenic
1078759974 11:14243965-14243987 AAACTCATCATGTCCAAAATGGG + Intronic
1079412576 11:20202946-20202968 AAAGTCAACTTAACTAAAAGTGG + Intergenic
1079486375 11:20939848-20939870 AAACTCAACATGCCTAAACCTGG - Intronic
1080405513 11:31975364-31975386 AAATTCAACATTTTTAAAAATGG - Intronic
1085926443 11:81029022-81029044 AAAATCAATATATTTAAAGCAGG + Intergenic
1086734548 11:90289833-90289855 ATACTTAACATATGAAAAACTGG + Intergenic
1087747172 11:101961949-101961971 AAACTCAACATATAAATAATTGG + Exonic
1088326958 11:108610500-108610522 AAAATCAGCTTATCTAAAAAAGG - Intergenic
1090687409 11:129138959-129138981 AAACCTACCATGTCTAAAACAGG + Intronic
1090913704 11:131144023-131144045 ATACTCAGCATATCTAAAAACGG - Intergenic
1091617907 12:2063874-2063896 AAACCCAAAATAACTAAAAATGG - Intronic
1091819615 12:3465956-3465978 AAACTCTACATAGCTGAAAGGGG + Intronic
1093219984 12:16408631-16408653 AATCTCAACAAATGTAAAATAGG - Intronic
1093351638 12:18109586-18109608 AAATTTAACATGTCTAAAACTGG - Intronic
1094017063 12:25876422-25876444 GAACTCAAAATATCTGAGACAGG + Intergenic
1094187484 12:27660545-27660567 AAACATAACGTTTCTAAAACAGG - Intronic
1094290413 12:28841888-28841910 AAACACGACATATCAAAATCTGG + Intergenic
1095555495 12:43499102-43499124 AAACTCAAAGTATCTCAAAAGGG + Intronic
1095592309 12:43917035-43917057 TAACTCATCACATCTAAAACTGG - Intronic
1095921845 12:47539649-47539671 GAGCTCAGCATATCTAAAATCGG - Intergenic
1097329011 12:58312891-58312913 GAACCCCAAATATCTAAAACAGG + Intergenic
1098020972 12:66156251-66156273 AAACTTAACATGGCCAAAACTGG + Intronic
1098883212 12:75937545-75937567 AGACTCAACATAGCTAAAGATGG - Intergenic
1098900176 12:76104221-76104243 TAGCTCAAGATATCTAAAAGTGG + Intergenic
1098967227 12:76803707-76803729 CAAGTCAACATATATATAACGGG - Intronic
1099423862 12:82499193-82499215 AAACTCAACATACACAAAATAGG - Intergenic
1099543373 12:83944126-83944148 AAATTAAACTTTTCTAAAACAGG + Intergenic
1104469344 12:129017109-129017131 AAACTGATCAAATCTAAATCTGG - Intergenic
1105908942 13:24842528-24842550 AAAATCAACATTTCTACAAATGG - Intronic
1106278309 13:28237039-28237061 AAACTCCACATAACAAAAGCAGG - Intronic
1106550130 13:30763849-30763871 AAACCCCATATATCTAAAAGGGG + Intronic
1106674168 13:31940111-31940133 AAACTCAGCATGTATAAAACTGG - Intergenic
1106976298 13:35220716-35220738 AAACTCTACAAATCTTAAGCAGG - Intronic
1107089312 13:36459706-36459728 AAATTCAATATATCCCAAACTGG + Intergenic
1107224288 13:38028432-38028454 AAATTCAATATCTCAAAAACTGG - Intergenic
1107761945 13:43688792-43688814 GAACTCAGCTTGTCTAAAACTGG - Intronic
1109112994 13:58347001-58347023 AACATAAACATATCTATAACTGG - Intergenic
1110494738 13:76154100-76154122 AAACTTAACAAATGTTAAACTGG + Intergenic
1111518903 13:89373530-89373552 AAACTCAAAATATTTAAGAAGGG + Intergenic
1111592298 13:90365222-90365244 AAATTCAACATATCTAATTTTGG + Intergenic
1112155525 13:96812737-96812759 TAATTCCTCATATCTAAAACAGG - Intronic
1112382071 13:98901000-98901022 TAACTAAAAATATGTAAAACTGG + Intronic
1112495698 13:99902465-99902487 AAAATCAGCATATTTTAAACTGG + Intergenic
1113052710 13:106231620-106231642 AAACTTAAAATGTCTAAAACAGG - Intergenic
1114620404 14:24093215-24093237 AAACTCAGCATATCTATGATGGG - Intronic
1115198352 14:30826298-30826320 AGGCTCAACATATGTATAACTGG + Intergenic
1115311034 14:31978228-31978250 AAAATTAACATAGCCAAAACTGG - Intergenic
1116171627 14:41409603-41409625 AATCTCAACATAACTCAAATGGG + Intergenic
1117607897 14:57449761-57449783 AAACACAACATATCAAAATTTGG - Intergenic
1118154584 14:63226610-63226632 AAACTCAGCATATGTATAACTGG + Intronic
1122839884 14:104452088-104452110 AAACACAACATACCAAAATCAGG + Intergenic
1124605432 15:31166815-31166837 AAAATAAACATTTTTAAAACTGG - Intergenic
1125099626 15:35896321-35896343 AAATTCAATTTATTTAAAACAGG + Intergenic
1125152919 15:36553770-36553792 AAACACAACATATCAAAATATGG + Intergenic
1125365181 15:38905846-38905868 AAACTCAACATTTGTAAGGCAGG + Intergenic
1126114076 15:45193190-45193212 GAACTCAAAATATCTGAGACAGG + Intronic
1129567826 15:76642808-76642830 AATCTCAAAATGTCTCAAACTGG - Intronic
1130456421 15:84114553-84114575 CAACTGAACATATCCCAAACTGG + Intergenic
1136009836 16:27356392-27356414 GGACTCCACATTTCTAAAACCGG + Intronic
1136224687 16:28851188-28851210 AAAACCAACCTATCCAAAACAGG + Intronic
1137904415 16:52305709-52305731 AAACAAAACATCTCAAAAACAGG - Intergenic
1138745337 16:59356715-59356737 GAAATGAACCTATCTAAAACAGG - Intergenic
1138780828 16:59783162-59783184 AAACTCACCATATTTATTACTGG - Intergenic
1139138998 16:64238436-64238458 CAACCCAACATTTCTAAAATGGG - Intergenic
1139996898 16:70989766-70989788 AAATTCAACATATAGGAAACTGG - Intronic
1143592637 17:7894761-7894783 ACAATCAACATTTCTGAAACTGG + Intronic
1144137124 17:12306982-12307004 AAACTAAACATTACTAAAATAGG - Intergenic
1145832937 17:27931973-27931995 AAACTCAACATGACCCAAACTGG - Intergenic
1145844648 17:28028135-28028157 AATCTGAACATATCAACAACAGG + Intergenic
1146570421 17:33947851-33947873 AAACTGAAAATATTTAACACTGG - Intronic
1148970923 17:51480621-51480643 AACCTTAGCATATCTCAAACAGG - Intergenic
1150057415 17:62031056-62031078 GAAAGCAAAATATCTAAAACAGG + Intronic
1150155354 17:62848635-62848657 AAACTCAATATACCTGAAACTGG - Intergenic
1151336471 17:73442879-73442901 AAACTCAAAATATAAAAAAAAGG - Intronic
1151520526 17:74626031-74626053 AAACTCACCATGTCTAATATAGG + Intergenic
1151923706 17:77177550-77177572 CAACTAACCATAGCTAAAACTGG - Intronic
1153526262 18:5997810-5997832 GAACTCAAAATATCTGAGACAGG - Intronic
1153862740 18:9230622-9230644 AAACACAACATACCAAAACCTGG - Intronic
1154314178 18:13291051-13291073 AAACTAAATAAACCTAAAACAGG + Intronic
1154457774 18:14545293-14545315 AAACTCACCCAATCTAAAATAGG - Intergenic
1155056441 18:22187698-22187720 TAACTCAAAATTTGTAAAACTGG + Intronic
1155335558 18:24761362-24761384 AAACTTACCATCTCTAACACAGG - Intergenic
1155817550 18:30332732-30332754 AAACGAAACATATCTTAAACTGG - Intergenic
1158321203 18:56266778-56266800 AAATTCAACTCATCCAAAACAGG - Intergenic
1159382117 18:67674110-67674132 AAACTTAACATGTCCCAAACTGG + Intergenic
1159681862 18:71363728-71363750 TAACCAATCATATCTAAAACTGG - Intergenic
1160305209 18:77727277-77727299 AAACACCTCATCTCTAAAACAGG - Intergenic
1161650158 19:5479478-5479500 AACATCAACATATTTAAAATTGG - Intergenic
1161674729 19:5639053-5639075 TAATGCCACATATCTAAAACTGG + Intronic
1164814965 19:31191188-31191210 AAACTCAACAAATCATAAACAGG + Intergenic
1166031207 19:40131028-40131050 AAAATCAACAAACCTAAAATTGG + Intergenic
1168139916 19:54378874-54378896 ATACTTAACATATGTACAACTGG + Intergenic
925475389 2:4207648-4207670 GAACAGAACATATCTAAAAATGG - Intergenic
925754637 2:7121693-7121715 AAACTCCACATCCCCAAAACAGG + Intergenic
926140004 2:10362841-10362863 AAACTCACCCTCTCTAACACAGG - Intronic
926250197 2:11151320-11151342 AAACCCAAAATATCTGAGACAGG - Intergenic
926390788 2:12390462-12390484 AAACTCAGAATTTCCAAAACTGG - Intergenic
926942517 2:18153411-18153433 AAACACAACATATCTCTAGCCGG + Intronic
927122305 2:19977319-19977341 AAAATCAACATATCCAACAGAGG + Intronic
927904452 2:26847263-26847285 AAAATAAACAAATCTAAAAAAGG - Intergenic
929064049 2:37955022-37955044 AAAATCAACATATAAAAATCAGG - Intronic
929607881 2:43247372-43247394 AAACTCACAAGTTCTAAAACTGG + Intronic
930590597 2:53322159-53322181 AACCTTAACATATGCAAAACTGG + Intergenic
930601946 2:53453800-53453822 AAAATAAACATAGCTAAAATGGG + Intergenic
930732853 2:54744746-54744768 AAACTCAGCATGTCTGAAATAGG - Intronic
931183832 2:59930553-59930575 ACAGGCAACATAACTAAAACTGG - Intergenic
931754550 2:65360894-65360916 AAACCCAACATTTCTAAATTTGG - Intronic
932383119 2:71304082-71304104 AAACTCTACATGTCTAAACAAGG + Intronic
933407725 2:81882211-81882233 AAACTCCACATACATAAAAGAGG - Intergenic
935096669 2:99951593-99951615 AAACTGACCATTTGTAAAACTGG - Intronic
935534374 2:104276605-104276627 AATCTCAGCATCTCTAAAACTGG + Intergenic
936663554 2:114569133-114569155 AAAGTCAGCATATCTAAACCAGG - Intronic
937709209 2:124960070-124960092 AAACACAACATAATTAAAAATGG + Intergenic
937722214 2:125114330-125114352 ACAATGAACATATCTTAAACTGG - Intergenic
938371752 2:130773223-130773245 AAACACAACATACCAAAACCTGG + Intergenic
940063928 2:149605323-149605345 AAAGTCAAAATATGGAAAACAGG - Intergenic
940943131 2:159585599-159585621 ATACTTAACATATTTAAAAATGG - Intronic
941356011 2:164492464-164492486 AAAATCAACATATTTCAAAATGG + Intergenic
941721273 2:168815821-168815843 AAAGTCAATATGTCTAAAACAGG + Intronic
941786185 2:169501119-169501141 AAACTTGGCATACCTAAAACTGG + Intronic
941810076 2:169746950-169746972 AAATTCAACATATAAATAACTGG + Intronic
942479452 2:176368390-176368412 CAACTCAATATGTCCAAAACTGG - Intergenic
943053283 2:182943493-182943515 AAACTCTCCAAATCTAAAACTGG + Intronic
943445195 2:187976613-187976635 AAACTCCACATAATTAAAAATGG + Intergenic
944333008 2:198494535-198494557 AAAACCAACATATCTGAAATTGG + Intronic
945073068 2:206010681-206010703 AAATTCAGGAAATCTAAAACAGG + Intronic
945392478 2:209280691-209280713 AAAATCAACATATTTTAAAGAGG + Intergenic
945868790 2:215204782-215204804 GAACCCCAAATATCTAAAACAGG - Intergenic
947368709 2:229423308-229423330 AAACTCAGTATATCTTAAAATGG - Intronic
947378472 2:229521611-229521633 AAACTCTACATGGCTAAAAGGGG - Intronic
948250750 2:236526716-236526738 ACACAGAACATCTCTAAAACAGG - Intergenic
948397476 2:237657274-237657296 AAAGGCAACATATGTAAAATTGG + Intronic
1169346437 20:4832053-4832075 AAAGTCAACATATGTATAATTGG + Intergenic
1169353734 20:4891029-4891051 AAACTCCCCAAATTTAAAACAGG + Intronic
1169406828 20:5328287-5328309 AAACCAAACATCTCTAAAATAGG - Intergenic
1169601408 20:7265186-7265208 AAACTCAACCCATATTAAACAGG + Intergenic
1170205249 20:13791139-13791161 AAACTCAACATATCTAAAACAGG - Intronic
1170818467 20:19735423-19735445 AAACTCAACACATTTAAAAAAGG + Intergenic
1171498465 20:25574727-25574749 AAACTCAACATATTCCAGACTGG - Intronic
1174466899 20:50724793-50724815 AGACTCCACACATTTAAAACTGG - Intergenic
1174715480 20:52753359-52753381 AAACTCAACATCCAAAAAACAGG + Intergenic
1176816382 21:13608015-13608037 AAACTCACCCAATCTAAAATAGG + Intergenic
1177161866 21:17556430-17556452 AATCTAAACATATCTAATAACGG - Intronic
1177329883 21:19644842-19644864 ACACCTAACATTTCTAAAACAGG - Intergenic
1177595574 21:23237499-23237521 AAGCTCCACATATCTAAATTAGG + Intergenic
1177980406 21:27907296-27907318 AAGCTCAACTTAACTAAAAATGG + Intergenic
1179682433 21:43033020-43033042 AAACTCAACAAGAATAAAACTGG - Exonic
1180579206 22:16813411-16813433 AAACTCGAGATTTCTATAACTGG + Intronic
1183137535 22:35903603-35903625 AAACTCAACATGCCCAAAATTGG + Intronic
1183139421 22:35922583-35922605 AAACTAGACATGTCTAAATCAGG + Intronic
951081865 3:18460768-18460790 AAAATGTACATATTTAAAACAGG + Intergenic
951713462 3:25611050-25611072 AAACTCAGCATGTCTGAAACTGG - Intronic
952225599 3:31372412-31372434 AAATTCGACATATCTGAAACTGG - Intergenic
953600224 3:44355832-44355854 AAATTTTACATATCTAAAAAAGG - Intronic
953862416 3:46556496-46556518 AAGCTAAACAAATCTAAATCAGG - Intronic
955513175 3:59701178-59701200 AACGGCAAGATATCTAAAACTGG - Intergenic
955551761 3:60092898-60092920 AAACTAAACATATTTCAAGCTGG + Intronic
956802702 3:72776311-72776333 TATCTCAACATATCTAAATATGG - Intronic
957376287 3:79363199-79363221 AAACTCATCATGGCTAAGACTGG - Intronic
958038164 3:88194100-88194122 GAACTCAAAATATCTGAGACAGG - Intergenic
958038199 3:88194472-88194494 AAACTCAAAATATCTGAGACAGG - Intergenic
958156665 3:89763207-89763229 GAACTTAAAATATCAAAAACTGG - Intergenic
958728176 3:97931532-97931554 AAACCCAACATCTCTAAACCTGG + Intronic
958774470 3:98465386-98465408 AAATTCAAAACATCTAAAAGTGG - Intergenic
958904112 3:99923339-99923361 ATACTCAACATGTCTAAACCAGG + Intronic
959946452 3:112130517-112130539 AAACTCAACATATCAGAAACAGG + Exonic
960034637 3:113090016-113090038 AAACTTGAGATATCTCAAACTGG + Intergenic
960811329 3:121630246-121630268 AACCTCAACATCTCTAGAAGAGG + Exonic
962622409 3:137192808-137192830 AAAATCATCATATCCCAAACAGG - Intergenic
963737264 3:149033372-149033394 AATCTCAAGATATCTTAAATGGG + Intronic
963990666 3:151649726-151649748 AAATTCAACATGTCTGAAACAGG + Intergenic
964538003 3:157746896-157746918 AAACACAACATCTCCAAATCAGG - Intergenic
966059875 3:175741818-175741840 GAACTCAAGATATCTAAGATAGG + Intronic
966427198 3:179792240-179792262 AAACTTAACACATCTTAAACTGG - Intergenic
966617038 3:181924773-181924795 AAAATCAGCATATTCAAAACTGG + Intergenic
967542833 3:190689454-190689476 AAGCTCAACATATCCAACACTGG - Intergenic
967899941 3:194439631-194439653 TATCTTAACATCTCTAAAACTGG + Intronic
968193490 3:196688287-196688309 ACACTCCAAATATCGAAAACTGG - Intronic
969727017 4:8925920-8925942 AAAATCAACAAATCTTTAACTGG + Intergenic
970453646 4:16199465-16199487 AATCTTAAAATATCTAAAAAAGG + Intronic
971364996 4:25970520-25970542 AAACTCAAATCATCAAAAACCGG + Intergenic
971374513 4:26046049-26046071 AAACTCAACATAGCACAAACTGG - Intergenic
971613429 4:28756776-28756798 AAATACAACATATCTAAAGTAGG + Intergenic
972135860 4:35892408-35892430 AAAGTCAACATCTCCAGAACTGG + Intergenic
972341944 4:38159727-38159749 AAACTCACCAGATCTCAAATTGG + Intergenic
972703920 4:41521932-41521954 AATCTCAATATATATAAAAGAGG + Intronic
973080487 4:45985549-45985571 AAAATCATAAAATCTAAAACAGG - Intergenic
973604217 4:52570622-52570644 AAATTCTACATATCTAATAATGG + Intergenic
973695874 4:53490537-53490559 GAGCTCAACATATGTAAAGCTGG + Intronic
974491933 4:62575385-62575407 AAACTCAATTTCTCAAAAACAGG - Intergenic
974499157 4:62675929-62675951 AAACACAACATATCAAAACTTGG - Intergenic
975496356 4:75039809-75039831 AAAGGCAATATATCTGAAACAGG - Intronic
976041454 4:80890291-80890313 AAAATCAACATATAAAAATCAGG + Intronic
976915280 4:90366029-90366051 AAGCTCAATATTTCTATAACAGG + Intronic
977232182 4:94465054-94465076 AAACTCAAGTTATATTAAACGGG - Intronic
977924885 4:102688684-102688706 AATCTCAAAATATGTAAAATAGG - Intronic
978630255 4:110735720-110735742 AAAGTCTACATATATAAACCTGG - Intergenic
978637101 4:110822679-110822701 AAACTCAACACAATTAAAACTGG - Intergenic
979337249 4:119477277-119477299 TAACACAACAAATCTAAAAAAGG - Intergenic
979353377 4:119672557-119672579 AAATTCAAAAGATCCAAAACAGG - Intergenic
980560256 4:134463143-134463165 ACACTCAACATTGCTAGAACTGG - Intergenic
981283366 4:142986703-142986725 ATTCTGAACATATCTATAACTGG - Intergenic
981662028 4:147178872-147178894 AAACTAGAAATATCCAAAACTGG + Intergenic
981744774 4:148042088-148042110 AAACCCAACATGCCTACAACCGG + Intronic
982590035 4:157296898-157296920 AAACTAGACAAATATAAAACAGG + Intronic
983293533 4:165836922-165836944 AAACAAAACATATTTATAACAGG - Intergenic
983555109 4:169052961-169052983 AAACTCAACGCATCAAAAGCTGG + Intergenic
983658968 4:170112861-170112883 AAAGTCAACTTAATTAAAACAGG + Intergenic
983688839 4:170443032-170443054 CATCTAAACATATCTAAACCTGG - Intergenic
983833504 4:172361128-172361150 CCACTCAATATATCTAAAATTGG + Intronic
984739801 4:183150037-183150059 AAACTGAACATACCTAGAAAGGG + Intronic
985052547 4:186006867-186006889 AAAATCAACATACCAAAAATTGG - Intergenic
985700751 5:1370797-1370819 ATACTCAACAGATCTAAAGCCGG - Intergenic
986517961 5:8582957-8582979 AATCTCCACATATCCAAAAAGGG + Intergenic
986688307 5:10293037-10293059 AAACTCAAAAGATTTAGAACTGG + Intronic
987439123 5:17933693-17933715 AAACTCAGAAATTCTAAAACTGG + Intergenic
987483749 5:18495574-18495596 AAACTCAAAATAACCAAAATAGG + Intergenic
989010920 5:36872021-36872043 AAACTTAAAACATCTAAAATAGG - Intergenic
989559152 5:42831189-42831211 AAACATAACATATCTAGATCAGG + Intronic
990168709 5:53023062-53023084 AAACTCAACATATTTAACAAAGG - Intronic
990676292 5:58189680-58189702 AAACTCTAGATAACTAAAATTGG - Intergenic
990729228 5:58790134-58790156 AAACTCAGCATGTCCAAAATAGG + Intronic
991943461 5:71877337-71877359 AAACTGAACATAAGTCAAACAGG + Intergenic
992587604 5:78257333-78257355 AAAATCAACATACCAAAATCAGG + Intronic
992810583 5:80383898-80383920 AAACTCAACATCTCCAAATATGG + Intergenic
993106070 5:83602369-83602391 AAACTTAACAGGTCTAAAACTGG + Intergenic
993126141 5:83838093-83838115 AAAGTCCACATCTGTAAAACAGG - Intergenic
993482555 5:88442439-88442461 TATCTAAACATATCTAAAAGAGG + Intergenic
993519731 5:88885512-88885534 AAACTCAACATTTGAAAAACCGG - Intronic
993921408 5:93808883-93808905 AAAATCAAAATATTTTAAACAGG + Intronic
993973396 5:94447115-94447137 AAACTCACCATAACCAAATCTGG - Intronic
994556253 5:101308858-101308880 AAACTTAACATAACTAATATTGG - Intergenic
994739363 5:103598793-103598815 AAATTAAACATGCCTAAAACTGG - Intergenic
994942885 5:106347510-106347532 TTACTCAGCATGTCTAAAACTGG + Intergenic
995253073 5:110016595-110016617 GAACTCAACATGTCCTAAACTGG + Intergenic
995265969 5:110161082-110161104 AAACTCAAGTTGTCTAAAATTGG + Intergenic
995447026 5:112255846-112255868 AAATTCAACATGTTCAAAACGGG + Intronic
998499446 5:142619374-142619396 AAACCCAGCATATACAAAACAGG + Intronic
998902681 5:146872689-146872711 AAACTCAACTCATCCAAGACTGG + Intronic
999332936 5:150689871-150689893 AAATTCTGCAAATCTAAAACAGG + Intergenic
1000391439 5:160727157-160727179 AAACTCAGAAAATCTAAGACAGG - Intronic
1002257576 5:177969529-177969551 AAACTCAACATACAAAAATCAGG + Intergenic
1002768294 6:263420-263442 AATCTCAACAAATATAAAACAGG - Intergenic
1002895083 6:1374227-1374249 AAAGTCAACATATCTACAAATGG + Intergenic
1003475157 6:6474909-6474931 GAACCCAAAATATCTGAAACAGG + Intergenic
1003585593 6:7386235-7386257 ACACTGAAGATATATAAAACAGG + Intronic
1003719152 6:8681138-8681160 AAACTCAGCAGATGCAAAACTGG - Intergenic
1004521436 6:16364601-16364623 CACCTCAAAATATCTAGAACTGG - Intronic
1004696383 6:18037343-18037365 AAACTGAACAGATCTTTAACAGG + Intergenic
1006571548 6:35009452-35009474 AAACTTAACACATTTGAAACCGG - Intronic
1008049588 6:46886603-46886625 AAACTGAGGATATTTAAAACCGG - Intronic
1008218851 6:48829534-48829556 AAAGTAAACATATCTAACTCAGG + Intergenic
1008313891 6:50014992-50015014 AAACTCTACATGTCCAAAATTGG + Intronic
1010002488 6:70961834-70961856 AAAATTAAAATATGTAAAACAGG + Intergenic
1011293087 6:85797619-85797641 AAACTCAAGATGTCTGAAAATGG - Intergenic
1011452126 6:87504440-87504462 GAAATCAACATATCTAAATAAGG - Intronic
1011556883 6:88579485-88579507 AAACTCACCCGATATAAAACAGG - Intergenic
1012638247 6:101575533-101575555 AAACTAAACATATCTGAATATGG + Intronic
1013191756 6:107809704-107809726 GAACTCAACGTTTCCAAAACTGG - Intronic
1013323054 6:109014105-109014127 AAACACTACATTTCTAAAAGAGG - Intronic
1013793045 6:113857704-113857726 AAACTCAACAGATCCAAGAGGGG - Exonic
1013878825 6:114868241-114868263 TAACACAACACAACTAAAACAGG + Intergenic
1014466160 6:121759577-121759599 AAACTAAACAAAACTATAACAGG - Intergenic
1014991627 6:128086881-128086903 AAACTTAATATAATTAAAACTGG + Intronic
1016418953 6:143864332-143864354 AAAATCAACTCATCAAAAACAGG - Intergenic
1016772830 6:147870933-147870955 AAAGTCCACATTTGTAAAACAGG + Intergenic
1017686096 6:156914740-156914762 AAAATCAACATATCCAAAGCGGG + Intronic
1018089599 6:160334168-160334190 AATTTCAACATGTCTAAAACTGG + Intergenic
1018153374 6:160961691-160961713 AAATTCAAAATATATAAAAATGG + Intergenic
1018426102 6:163683231-163683253 AAACTCAACAAATCTCAAGTAGG - Intergenic
1018538270 6:164847779-164847801 AAACTCAATATTTCTATCACTGG + Intergenic
1018611315 6:165650291-165650313 AAAATCAAAATGTATAAAACGGG + Intronic
1018766239 6:166935277-166935299 AAACTCAATATATCAAAAATAGG - Intronic
1019099857 6:169620766-169620788 TAAATCAAAATATCTAAGACAGG - Intronic
1019101387 6:169633343-169633365 AAACACCACGTATCTAAAGCTGG - Intronic
1020099457 7:5386771-5386793 AAACTAAAAATAAATAAAACAGG + Intronic
1021017926 7:15558806-15558828 AAACTTTAAATATCTAAAAAAGG - Intronic
1021685967 7:23186280-23186302 TGACTCAACATGTCTACAACTGG - Intronic
1022608623 7:31844633-31844655 AAACTCAGCAAACCTAAAACAGG - Intronic
1022965841 7:35470481-35470503 AAAATCTACATATATAAAAATGG - Intergenic
1023100051 7:36708164-36708186 TATCTCAACATTTATAAAACGGG - Intronic
1024369841 7:48569290-48569312 AAACACAACATATCAAAACATGG - Intronic
1024823367 7:53360592-53360614 AAACTCAAAATGGCTAAAATTGG - Intergenic
1024886644 7:54149534-54149556 AAATTTAACATGTCTGAAACTGG - Intergenic
1025776454 7:64564917-64564939 AAACTCAACTTTTCAAAATCAGG - Intergenic
1027334221 7:77131204-77131226 TTACTCAACATATCAGAAACAGG + Intronic
1027839908 7:83296352-83296374 GAACTCAACAGAAATAAAACAGG - Intergenic
1028225463 7:88246730-88246752 AAACACAACACAACCAAAACAGG - Intergenic
1029781629 7:102740394-102740416 TTACTCAACATATCAGAAACAGG - Intergenic
1030419951 7:109296539-109296561 GAATTCAATATATCTAAAACGGG - Intergenic
1030939673 7:115630479-115630501 AAACTGAACAGTTCCAAAACAGG - Intergenic
1031588017 7:123556238-123556260 AAACTTAACATGTCCAAAATGGG - Intronic
1032370958 7:131351355-131351377 CAACTGAACATATCTAGAATAGG - Intronic
1033120059 7:138659747-138659769 GAACCCAACATATCTGAGACAGG - Intronic
1034325796 7:150230971-150230993 AAATTGATAATATCTAAAACAGG - Intergenic
1035746418 8:1964709-1964731 AAATTCAACATATGTACATCTGG + Intergenic
1035961739 8:4145852-4145874 AAACTCAACAAATTCAAAGCTGG - Intronic
1036024898 8:4895884-4895906 AAATTCAACGTATTTACAACAGG - Intronic
1042507253 8:69573775-69573797 AAATGCAACATTTCTAAAATGGG + Intronic
1043533972 8:81180124-81180146 AAAGTCAACATAGCTGCAACTGG - Intergenic
1044278194 8:90326415-90326437 AAACTCAACATGTCTAAAAATGG + Intergenic
1044288378 8:90437834-90437856 AAACTCAAGATCTCAAAAATTGG + Intergenic
1044821168 8:96157196-96157218 AAACCAAACAAACCTAAAACAGG - Intronic
1044965549 8:97570606-97570628 TAACTCAACATCTCAGAAACTGG + Intergenic
1046497116 8:115028789-115028811 AAACACTACATATCAAAAATTGG - Intergenic
1046559670 8:115819754-115819776 AAACTCAACGTACCCCAAACAGG + Intergenic
1046703912 8:117429012-117429034 ATACTCAACATATGTAATATAGG - Intergenic
1046825270 8:118683538-118683560 AAACACAACTCATCAAAAACTGG - Intergenic
1047541892 8:125775819-125775841 AAACTGAAAATGACTAAAACTGG + Intergenic
1048160468 8:132016250-132016272 AAATTTAACACATCCAAAACAGG - Intergenic
1049811301 8:144574226-144574248 AAACTGAAAATATTTAAAAGTGG + Intronic
1050102487 9:2133581-2133603 AAACTAAACAAAACAAAAACTGG - Intronic
1051322898 9:15928739-15928761 AAACATAAAATATCAAAAACTGG + Intronic
1051397725 9:16643902-16643924 GAACTCAAGATTTTTAAAACTGG - Intronic
1051905133 9:22086107-22086129 TAATTCAACATATTTAAAATTGG + Intergenic
1052109239 9:24560119-24560141 AAATTCAACATATCCAGAAATGG - Intergenic
1052165519 9:25321914-25321936 AAACTCAGCATAGCTAGAATAGG - Intergenic
1052789081 9:32857424-32857446 CAACTCAACATATCTAAATTTGG + Intergenic
1053223087 9:36327583-36327605 AAACTCAACATATCCAAATATGG - Intergenic
1054894047 9:70287178-70287200 AAGCTGCACATATCAAAAACAGG - Intronic
1055620765 9:78122671-78122693 AAACTTAACATGTCCAAAAATGG + Intergenic
1058154367 9:101498133-101498155 AATCTAAACTCATCTAAAACTGG - Intronic
1058444034 9:105038261-105038283 AAACCCAACATATATAAGAAAGG - Intergenic
1059682696 9:116601747-116601769 AAACTCAACACATTCAAAACTGG - Intronic
1060245355 9:121941455-121941477 AAAGTCAACCTGTCTAAAACTGG + Intronic
1060652104 9:125337167-125337189 AGACACAACATATCTAACAAAGG - Intronic
1203530975 Un_GL000213v1:141452-141474 AAACTCACCCAATCTAAAATAGG - Intergenic
1185964368 X:4583771-4583793 GAACTCAAAATATCTAAGACAGG - Intergenic
1186441978 X:9594304-9594326 AAAATAAAGATATCTAGAACTGG - Intronic
1186570193 X:10706872-10706894 ATAGTCAACTTATCCAAAACAGG + Intronic
1188403537 X:29778291-29778313 AATTTCAAAATATCTAAAATAGG + Intronic
1188416668 X:29943658-29943680 AAAATAAACATATTCAAAACAGG - Intronic
1188751304 X:33908807-33908829 AAACTCCAAATATCTGAGACAGG + Intergenic
1190119005 X:47645173-47645195 AAACTGACCATCTCCAAAACTGG - Intronic
1190447065 X:50536668-50536690 AAATTCAACATCTGCAAAACTGG - Intergenic
1190951827 X:55153246-55153268 GAACTCAAAATATCTGAGACAGG - Intronic
1192024822 X:67438461-67438483 AAACTCAACATATTCAAAATTGG + Intergenic
1192122296 X:68467893-68467915 AGACCCAACAAATCCAAAACCGG + Intergenic
1192316809 X:70058740-70058762 AAACTAAACATATCAAAACATGG + Intergenic
1193505578 X:82338258-82338280 AAACTCAGCAGAACCAAAACTGG - Intergenic
1194044918 X:88990408-88990430 TAACCCAAAATATCTAAGACAGG - Intergenic
1194200444 X:90948324-90948346 GAACTCAAAATATCTGAGACAGG - Intergenic
1194582051 X:95686039-95686061 AAAATTAACTTATTTAAAACAGG - Intergenic
1194804735 X:98313176-98313198 AAACTTAACAGATCAAAAAATGG + Intergenic
1196815263 X:119660562-119660584 ACATTCAACATATCTAACATTGG - Intronic
1196821593 X:119705587-119705609 AAACTCAACATGTCCCAAACTGG - Intergenic
1196967342 X:121071898-121071920 AAAATCAACATACATAAATCAGG - Intergenic
1197304753 X:124827873-124827895 AAACTCAATATATTTAACACAGG + Intronic
1197550185 X:127883093-127883115 AAACAGAACATATGTAAAATTGG + Intergenic
1197948486 X:131867396-131867418 AAATTCAACAAACCAAAAACTGG - Intergenic
1199387138 X:147236259-147236281 AAATTCAACATATCTATAAAAGG - Intergenic
1200856703 Y:7946536-7946558 ACACTCAACATCTCTCCAACAGG + Intergenic
1200898695 Y:8404650-8404672 ACAGTCAACTTATCTTAAACGGG - Intergenic
1202193360 Y:22268831-22268853 CAACTGAACATCTCTAAATCAGG - Intergenic
1202301565 Y:23420988-23421010 CAAACCAACATATCTAAAACTGG - Intergenic
1202569246 Y:26249610-26249632 CAAACCAACATATCTAAAACTGG + Intergenic