ID: 1170207246

View in Genome Browser
Species Human (GRCh38)
Location 20:13811594-13811616
Sequence GCAGGGTGAAGGTGTTTAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 128}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170207241_1170207246 -3 Left 1170207241 20:13811574-13811596 CCTTCTGGTGTGGGGCCTCAGCA 0: 1
1: 0
2: 1
3: 20
4: 180
Right 1170207246 20:13811594-13811616 GCAGGGTGAAGGTGTTTAATAGG 0: 1
1: 0
2: 0
3: 10
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170207246 Original CRISPR GCAGGGTGAAGGTGTTTAAT AGG Intronic
900470403 1:2851301-2851323 GCAGGGAGTGAGTGTTTAATGGG + Intergenic
900756193 1:4436630-4436652 TCAGGGTGAAGGTGCTTATGTGG - Intergenic
903553010 1:24171128-24171150 AGAGGGTGAAGTTGTTTAGTAGG - Intronic
905221032 1:36447692-36447714 GGAGGATTAAGGTGTTTAAGAGG + Intronic
906148150 1:43572099-43572121 GCAGGGTGGAGGTTTTCAAGTGG - Intronic
908717438 1:67085399-67085421 GCAGGTTTAAGGGCTTTAATCGG - Intergenic
909392841 1:75136051-75136073 GAAAGGTGAAGAGGTTTAATAGG - Intronic
911165204 1:94718895-94718917 GAGAGGTGAAGGTGTTTGATGGG - Intergenic
911666832 1:100562854-100562876 GCTGTGTTAAGGGGTTTAATGGG + Intergenic
912140988 1:106726907-106726929 GGAAGGTGGAGGTGGTTAATGGG + Intergenic
917170544 1:172168407-172168429 GCAGGGTGAATGCTTTAAATAGG + Intronic
917395452 1:174588571-174588593 GCAAAGTGGAGATGTTTAATGGG - Intronic
920278640 1:204827211-204827233 TGAGGGTGAAGGTGTTTCCTTGG - Intergenic
922059734 1:222076872-222076894 GAAGGGTAAAGGTGAATAATTGG - Intergenic
922061909 1:222101009-222101031 GCAGGGTGGAAGTGTATAGTGGG - Intergenic
923418299 1:233787173-233787195 GTAGGATGAAGGTGTTGAAGGGG - Intergenic
924627825 1:245710381-245710403 GCACTGAGAAGGTCTTTAATTGG - Intergenic
1064771326 10:18726711-18726733 AGAGGGTGAAGATGGTTAATGGG - Intergenic
1067901103 10:50242366-50242388 GCAGGAGGAAAGTGTTTAATAGG + Intronic
1067935263 10:50605893-50605915 GAAGGGTGAAGGGGTTGAAGTGG - Intronic
1068061284 10:52070992-52071014 ATAGGGTCAAGGTGATTAATAGG + Intronic
1074407682 10:113193221-113193243 TTAGGGTGAAGGTGATTAAAAGG + Intergenic
1075835802 10:125451745-125451767 GCATGGTGAATGTGTTGATTTGG - Intergenic
1076019990 10:127064886-127064908 GCAGGGAGTTGGTGTTTGATGGG - Intronic
1077458451 11:2695186-2695208 ACAGGGTGACAGTGTTTCATAGG - Intronic
1078328077 11:10396676-10396698 GGAGGGTGAAGGTGGGCAATCGG + Intronic
1086252356 11:84831667-84831689 GCAGAGTGTAGATGTTTATTAGG - Intronic
1088222017 11:107579510-107579532 GTAGGGAGCAGGTGGTTAATGGG + Intergenic
1089795907 11:120980620-120980642 CCAGGGGGAAGGTGCTTAAATGG - Intronic
1094488914 12:30946526-30946548 GCAGGCTGATGGAGTTTGATTGG - Intronic
1099362363 12:81720558-81720580 GAAGGGTGCAGTTCTTTAATTGG - Intronic
1100346774 12:93739264-93739286 GCAGGGTGCAGATTTTTAAAAGG - Intronic
1106252668 13:27994559-27994581 GAAGTGGGAAGGGGTTTAATGGG + Intergenic
1106911030 13:34463859-34463881 GCAGGGTGATGGTATGTGATGGG - Intergenic
1109335228 13:60985674-60985696 GCAGGGTGAATCTGTTTATGTGG + Intergenic
1115766635 14:36629648-36629670 GCTTGGTGAAGGAGTCTAATTGG - Intergenic
1117092345 14:52263908-52263930 GGAGGGTGAAGGGGGATAATTGG - Intergenic
1120682160 14:87493028-87493050 ACAGGGTAAGTGTGTTTAATGGG - Intergenic
1121131038 14:91447603-91447625 GGAGGGTGGAGATGGTTAATGGG + Intergenic
1130238682 15:82164483-82164505 GCAGGGGGAAGGGGTTGACTAGG - Intronic
1134229797 16:12419906-12419928 GAAGGGAGATGGTGTTTAACTGG + Intronic
1138114785 16:54351718-54351740 GCAGGGAGAAGCTTTTTAAATGG + Intergenic
1138146750 16:54619457-54619479 GCAGGTTGAAAGAGTTTCATGGG + Intergenic
1138261139 16:55623537-55623559 GCACAGTGAAGGTGTGGAATGGG - Intergenic
1138761566 16:59550185-59550207 GCAGGGTGAGGGTCAGTAATTGG + Intergenic
1143363515 17:6390182-6390204 TCTGGGTGAAGGAGTTTAAGTGG - Intergenic
1143778079 17:9212592-9212614 CCAGGGTGAAAGAGTTTAAGGGG - Intronic
1148509454 17:48156308-48156330 GCAGGGAAAAGGTGTTTGAAAGG - Intronic
1152900632 17:82939169-82939191 GGAGGGAGGAGGTGGTTAATGGG + Intronic
1153438271 18:5089421-5089443 GCTGGATTAAGGTTTTTAATAGG - Intergenic
1155833041 18:30542290-30542312 GCAGGCTGAATTTGGTTAATGGG - Intergenic
1158004366 18:52655079-52655101 TAAAGGTGAAGGTGATTAATGGG - Intronic
1159889915 18:73943610-73943632 GCAGGGTGAAGGCTTTTCATGGG - Intergenic
1162057308 19:8072213-8072235 GCAGGGTGGAGGGGTTTCAGAGG + Intronic
1162624275 19:11871693-11871715 GCAGGGTGAGGGTGATGAACAGG + Intronic
1162634129 19:11953275-11953297 GCAGGGTGAGGGTGATGAACAGG + Intronic
1162637501 19:11981470-11981492 GCAGGGTGAGGGTGATGAACAGG + Intergenic
1166619714 19:44285273-44285295 GCTGAGTGAAGGAGTTTAAGAGG - Intronic
1166881152 19:45930873-45930895 TCAGGATGAAGGTGAGTAATGGG - Intergenic
925719678 2:6814723-6814745 GTAGGGTGTTGGTGCTTAATGGG + Intergenic
935567330 2:104622799-104622821 GAAGGGGGGAGCTGTTTAATGGG + Intergenic
935726526 2:106028664-106028686 GCAGGGTGAGGGTGCATGATGGG + Intergenic
935887341 2:107636531-107636553 GGAGGGTGAAGGGGTGTAAGTGG - Intergenic
937335192 2:121058296-121058318 GCAGGGAGAAGGTGTCTGCTCGG + Intergenic
940256403 2:151735078-151735100 GGAGGGAGAAGGTGCTAAATAGG - Intergenic
946552111 2:220813532-220813554 GGGGGGTGAATGTGTTTCATGGG - Intergenic
946615644 2:221506563-221506585 GCAGGGTGAAGATGGACAATTGG + Intronic
946757025 2:222957612-222957634 GGGAGGTGAAGGTGGTTAATAGG + Intergenic
948792835 2:240388185-240388207 GCAGGGTGAAGGGCTTCAAGGGG - Intergenic
1169633219 20:7657251-7657273 GCAGGGAGAATGTTTTTACTGGG - Intergenic
1170207246 20:13811594-13811616 GCAGGGTGAAGGTGTTTAATAGG + Intronic
1171014759 20:21530198-21530220 GCAGGGCCAAGGTTTTTACTTGG + Intergenic
1173326871 20:42041930-42041952 GCAGGGTGAATTTATTTAATAGG - Intergenic
1174376492 20:50129752-50129774 CCAGGGTGAATGTGTTTAGGGGG - Intronic
1175134729 20:56814704-56814726 GCGGGGTGTTAGTGTTTAATGGG - Intergenic
1175794668 20:61764217-61764239 GCAGGGTGCAGGTGTGGACTTGG + Intronic
1178370068 21:32020222-32020244 GGAAGGTGAAGTTGTTTAATTGG - Intronic
1179449345 21:41457834-41457856 GAATGGGGAATGTGTTTAATGGG - Intronic
1179981571 21:44898579-44898601 GCAGGATGAACGTGTTTCACTGG + Intronic
1180984132 22:19894258-19894280 GCAGGGAGTGAGTGTTTAATGGG + Intronic
1182071122 22:27464408-27464430 GCAGGGAGAAGGTATTTATCTGG - Intergenic
1184400079 22:44268652-44268674 GCAGGGAGAGGGTGTTTTAGAGG + Intronic
949141932 3:644561-644583 GCATGATGCAGATGTTTAATGGG + Intergenic
949720578 3:6985332-6985354 GGTGGGTGAAGATGGTTAATGGG - Intronic
955328574 3:58028301-58028323 ACAGGCTGCAGGGGTTTAATAGG + Intronic
957895724 3:86419209-86419231 GCTGAGTGATGGTGTTTAAAAGG - Intergenic
958752303 3:98206130-98206152 GTAGGATCAATGTGTTTAATTGG + Intergenic
959501701 3:107114224-107114246 GCATGGTGGAGGTTTTTGATGGG - Intergenic
964267477 3:154915101-154915123 GGAGAGTGAAGATGGTTAATGGG + Intergenic
964835229 3:160930671-160930693 GCGGAGTGAAGGAGTTTAAGAGG + Intronic
966578015 3:181525181-181525203 GCAGGATGAAGCATTTTAATAGG - Intergenic
967861743 3:194157249-194157271 GCAGGGTGGAACTGTTTGATGGG - Intergenic
968033369 3:195523246-195523268 GCAGAGTGAAGGTCTTTATTAGG - Intronic
975370911 4:73586412-73586434 GTAGGCAGAAGGTGTTTAAATGG + Intronic
977992836 4:103465491-103465513 GCAATGTGAAGGTGTTCAGTGGG + Intergenic
982269598 4:153572845-153572867 GCTGAGGGAAGGTGTTTAATGGG - Intronic
984918561 4:184744334-184744356 GCAAAATGATGGTGTTTAATTGG + Intergenic
986088027 5:4472252-4472274 GCAGTGTGAAAATGTTTAAAAGG - Intergenic
986387542 5:7249156-7249178 GCAAGGTGAAGGTGGTATATGGG + Intergenic
986395902 5:7330173-7330195 GCATGGTGAACATGTTTGATGGG + Intergenic
990258621 5:53997655-53997677 GCAGGATGAAGGAGGTGAATGGG + Intronic
992084583 5:73266625-73266647 GCAAGCTGAGGGTGTTTAAATGG - Intergenic
992569492 5:78040782-78040804 GCATAGTGAAAATGTTTAATAGG - Intronic
997617459 5:135259675-135259697 GGAGGGTGAAGATGGTTAATGGG - Intronic
998921824 5:147077540-147077562 GGAAAGTGAAGGGGTTTAATTGG - Intronic
999226857 5:150032788-150032810 CCAGGGTGAAGGGGTTGACTAGG + Intronic
1001095682 5:168773775-168773797 GCAGGGTGGAGGGGGTTAAGCGG + Intronic
1001371541 5:171209133-171209155 GAAAGGTGAAGGTGTTTCCTTGG + Intronic
1005987027 6:30882013-30882035 GCAGGGTGAAGGAGTGTACAAGG - Intronic
1016584818 6:145672791-145672813 GGAGGGTGAAGGTCTGTACTGGG - Intronic
1017357254 6:153524213-153524235 GCAGGGTGAAGGTGCAGAATTGG + Intergenic
1017552804 6:155527577-155527599 TGAGGGAAAAGGTGTTTAATGGG + Intergenic
1017868273 6:158463964-158463986 ACAGGGAGTAGTTGTTTAATAGG - Intronic
1019482687 7:1273851-1273873 ACAGGGTGAGGGTGTGGAATGGG + Intergenic
1024297109 7:47853415-47853437 GCAGGGTGAAAGTGTTATGTAGG - Intronic
1024660685 7:51490813-51490835 GCAAGGTGGAGATGGTTAATGGG - Intergenic
1026279283 7:68907301-68907323 GCAGGGTCAACGTATTTCATAGG - Intergenic
1029627045 7:101726425-101726447 CCAGGGAGAAGGATTTTAATAGG - Intergenic
1033720130 7:144050494-144050516 GCAGGGTGAAGACGTATAACAGG - Exonic
1033727980 7:144142101-144142123 GCAGGCTGAAGATGTATAACAGG - Intergenic
1035706354 8:1678430-1678452 GCAGGGTGGAGGTGTCCACTTGG - Exonic
1036170053 8:6475259-6475281 GCAGGGTGCAAGTGTTTACTTGG + Intronic
1038208169 8:25489169-25489191 ACTGGGTTAAGGTGTTAAATTGG - Intronic
1041960770 8:63612747-63612769 GAAGGGTGGAGGAGATTAATAGG + Intergenic
1043880386 8:85535779-85535801 GCAGGCTGAAGGGCTTGAATGGG + Intergenic
1046205668 8:110992790-110992812 GAAAGTGGAAGGTGTTTAATGGG + Intergenic
1052099548 9:24428336-24428358 TCAGGGTGAAGTTATTAAATAGG + Intergenic
1053263547 9:36693639-36693661 GCAGGGGGAGGGTGTTGAATAGG + Intergenic
1056716699 9:89037280-89037302 GCAGGGTAGAGTTATTTAATAGG - Intronic
1058593281 9:106587895-106587917 GCAGGGATAATATGTTTAATTGG + Intergenic
1059685067 9:116627061-116627083 ACAGTGAGAAGGTGATTAATTGG + Intronic
1061808600 9:133149627-133149649 CCAGGGTGAACGTGTATATTTGG - Intergenic
1188346296 X:29070381-29070403 GAATGGTGAAGGTGTTAATTAGG - Intronic
1189421073 X:40858589-40858611 GGAAGGTGAAGATGGTTAATGGG - Intergenic
1193278975 X:79625600-79625622 GCAGGAAGAAGAGGTTTAATTGG + Intergenic
1195520011 X:105820130-105820152 GCAGGGAGATGATGGTTAATAGG + Intergenic
1197299326 X:124758885-124758907 GAAGAGGGAAGTTGTTTAATGGG + Intronic
1200773102 Y:7145389-7145411 ACAGGGTGTTAGTGTTTAATGGG + Intergenic
1201901450 Y:19048637-19048659 GCAGGGAGAAGGTGTTGTTTGGG - Intergenic