ID: 1170207588

View in Genome Browser
Species Human (GRCh38)
Location 20:13815336-13815358
Sequence ATGAAGCAGCTGGATAACCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 329
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 303}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170207588 Original CRISPR ATGAAGCAGCTGGATAACCT TGG (reversed) Intronic
901076713 1:6559732-6559754 CTGAAGCAGGTGGATCACCTGGG + Intronic
901091894 1:6647314-6647336 CTGAGGCAGGTGGATCACCTGGG - Intronic
901454635 1:9356031-9356053 ATGCAGCAGCTGGACATCATAGG - Exonic
902023699 1:13367048-13367070 ATCAAGAAGCAGGAAAACCTGGG - Intergenic
902909065 1:19581710-19581732 CTGAGGCAGGTGGATCACCTGGG + Intergenic
903571019 1:24305036-24305058 ATTTAGCAGCAGTATAACCTTGG - Intergenic
904608774 1:31713930-31713952 AGGAGGCAGATGGATCACCTGGG + Intergenic
904828883 1:33294304-33294326 ATTAACCAGCTGGGTGACCTTGG - Intronic
905878158 1:41446660-41446682 ACCAAGCAGCTGGGTGACCTTGG - Intergenic
907525551 1:55052001-55052023 ATGAAGGAGCAGGATGACTTGGG + Intronic
907975915 1:59431308-59431330 AGGGAGCAGCTGGATCACATTGG - Intronic
909111784 1:71488252-71488274 ATAAAGAAGCTGGATAATTTAGG - Intronic
909696832 1:78476888-78476910 ATGAAGCAGCTGGATAGATTAGG + Intronic
910712899 1:90200109-90200131 ATGTGGCAGCTGTATGACCTTGG - Intergenic
912145900 1:106794276-106794298 CTGGAGCTGCTGGCTAACCTTGG - Intergenic
912882544 1:113431043-113431065 TTGAAACCACTGGATAACCTGGG + Intronic
912908761 1:113735130-113735152 CTGAAGCAGGAGGATCACCTGGG + Intronic
914806445 1:150995512-150995534 AAGAAGGAGCTGGATGACCCAGG - Exonic
915881349 1:159675370-159675392 GTGAAGGAGATGGATACCCTGGG - Intergenic
916571748 1:166034119-166034141 TTTTAGCAGCTGAATAACCTTGG + Intergenic
917852112 1:179073554-179073576 CTGAGGCAGGTGGATCACCTGGG - Exonic
918080271 1:181202424-181202446 ATTTACCAGCTGGATAAGCTTGG - Intergenic
919641891 1:200053465-200053487 ATTCAGTAGCTGGATAATCTTGG - Intronic
919880217 1:201896039-201896061 CTGGAGCAGCTGGAGAATCTGGG + Intergenic
920395954 1:205646226-205646248 CTGAGGCAGGTGGATCACCTGGG - Intergenic
922467659 1:225855236-225855258 CTTAACCAGCTGGATAAACTTGG + Intronic
922678201 1:227566218-227566240 GTGAAGCAGCTGGATGTCCTGGG + Intronic
923839253 1:237650301-237650323 ATCCAACAGCTGGATACCCTAGG - Intronic
924230016 1:241955259-241955281 ATTATTCAGTTGGATAACCTAGG + Intergenic
1062950547 10:1498137-1498159 CTGAGGCAGGTGGATCACCTGGG + Intronic
1063027833 10:2200286-2200308 CTGAGGCAGGTGGATCACCTGGG + Intergenic
1063364901 10:5484382-5484404 ATGAATCAGCTGTATCACGTTGG - Intergenic
1063492039 10:6472945-6472967 CTGAAGCGGGTGGATCACCTTGG - Intronic
1064346580 10:14537975-14537997 CTTAAGCAGCTTGGTAACCTTGG - Intronic
1065741547 10:28801582-28801604 ATGAAGGAGTTGGACAAGCTGGG + Intergenic
1066809568 10:39310575-39310597 ATGGAGCAGTTTGTTAACCTTGG - Intergenic
1066954063 10:42149156-42149178 ATGCAGCAGCCGGAGGACCTGGG - Intergenic
1068928635 10:62565745-62565767 ATGCTGCAGTTGAATAACCTGGG - Intronic
1069744454 10:70706295-70706317 ATGAAGCTGCTGCGTGACCTAGG + Intronic
1069778161 10:70938731-70938753 AGGAAGCAGGTGGAAAAGCTGGG - Intergenic
1070967862 10:80540548-80540570 ATGTAGCAGCTGGATGACCTTGG - Intronic
1072161432 10:92770906-92770928 CTGAGGCAGGTGGATCACCTGGG + Intergenic
1072373140 10:94786198-94786220 ATGAAGCAGCTACATTACCTGGG - Intronic
1072442560 10:95469942-95469964 TTGTAGCAGCAGGATCACCTGGG - Intronic
1073645129 10:105293838-105293860 ATGAAGAAGCTGGATATGGTAGG - Intergenic
1074362352 10:112833493-112833515 CTGAATTAGCTGGATAACCTTGG + Intergenic
1075251971 10:120887122-120887144 ATGAGTAAGCTGGATAACTTTGG - Intronic
1075608904 10:123835989-123836011 CAGAAGCAGCTGGAGGACCTTGG - Intronic
1076676561 10:132150003-132150025 ATGAAGAAGCTGGACATCCTGGG + Exonic
1077575145 11:3377655-3377677 AGGGAGCAGCTGGATGCCCTGGG - Intronic
1078744565 11:14099083-14099105 ATGAAGAAATTGGATAACTTGGG - Intronic
1080069668 11:28066320-28066342 AGAAAACAGCTGGATAACCCTGG - Intronic
1083575791 11:63790322-63790344 CTGAGGCAGGTGGATCACCTGGG - Intergenic
1084659495 11:70538578-70538600 AGGAAGGAGCAGGATAACGTGGG + Intronic
1085834767 11:79941099-79941121 ATGAAACAGCTAGATAATCCAGG + Intergenic
1086270013 11:85051694-85051716 ATTTAGCAGCTGTATAACCTTGG + Intronic
1086477181 11:87189392-87189414 CTGAGGCAGGTGGATCACCTTGG - Intronic
1086931993 11:92703985-92704007 ATGAAGTAGTTGTATGACCTTGG - Intronic
1088128632 11:106460396-106460418 CTGAGGCAGGTGGATCACCTGGG + Intergenic
1088131119 11:106492215-106492237 AAGAAGAAGGTAGATAACCTAGG - Intergenic
1089801877 11:121038195-121038217 CTGAGGCAGGTGGATCACCTGGG - Intronic
1091840774 12:3619142-3619164 AGGAAGCAACTGGAAAACATGGG - Intronic
1093177678 12:15931429-15931451 ATCAAGAAGCTGGATAACTTTGG - Intronic
1093787411 12:23208556-23208578 ATGAAACAGCTTGATGATCTAGG - Intergenic
1094571441 12:31644667-31644689 CTGAAGGAGGTGGATCACCTGGG - Intergenic
1095334251 12:41007409-41007431 ATGAAGCAGCTATATCACCTGGG + Intronic
1095744768 12:45645270-45645292 ATTAAGCATCTGAATTACCTGGG - Intergenic
1096541586 12:52310646-52310668 ATGAAGCAGAAGAATCACCTAGG - Intergenic
1096612467 12:52811832-52811854 AGGAAGCAGCTAGATACCTTGGG - Exonic
1101465061 12:104940243-104940265 CTGAGGCAGGTGGATCACCTGGG - Intronic
1102858456 12:116315027-116315049 CTGAGGCAGGTGGATCACCTGGG + Intergenic
1105212601 13:18266135-18266157 CTGAGGCAGATGGATCACCTAGG - Intergenic
1105393665 13:20007368-20007390 CTGAGGCAGGTGGATCACCTGGG - Intronic
1106586515 13:31061353-31061375 ATGAAGCAGATAGATTTCCTGGG - Intergenic
1107027080 13:35812899-35812921 ATGAAGCAGCTGTCCAGCCTTGG + Intronic
1107567056 13:41615460-41615482 ATGACTCAGCTGGATCAGCTAGG - Intronic
1108033077 13:46257164-46257186 ATGAGGCAGCTTGAAAACCTGGG + Intronic
1108305770 13:49130997-49131019 CTGAGGCAGGTGGATTACCTAGG - Intronic
1108745118 13:53385601-53385623 AAGGAGGAGCTGGATAAGCTGGG + Intergenic
1109038495 13:57298473-57298495 ATAAAGCAGCTGGTTCAACTTGG - Intergenic
1110006181 13:70273170-70273192 ATGAGGTAGCTGCATGACCTTGG - Intergenic
1110412561 13:75220289-75220311 ATGAGGCTGCTGGATAACCGAGG + Intergenic
1110563521 13:76935139-76935161 ATGTAACAGCTAGATAACTTTGG + Intergenic
1110591546 13:77268544-77268566 CTGAGGCAGGTGGATCACCTGGG + Intronic
1112531645 13:100209863-100209885 ATGAAGCAGGCAGATCACCTGGG - Intronic
1114451133 14:22826388-22826410 CTGAGGCAGGTGGATAACCTAGG - Intronic
1115866351 14:37751480-37751502 AGGAGGCAGCTGGAAAAGCTGGG - Intronic
1116868901 14:50053295-50053317 ATGATGAAGCTTGATAACTTTGG + Intergenic
1117768384 14:59107317-59107339 AGGAAGCAGCGGGAAAACCTTGG + Intergenic
1117877935 14:60275333-60275355 ATGAACCAGCTTTGTAACCTTGG + Intronic
1117957246 14:61132063-61132085 ATGCAGCAGCCTGGTAACCTTGG - Intergenic
1120972695 14:90221514-90221536 CTGAGGCAGCTGGATCACCTGGG + Intergenic
1122818670 14:104328739-104328761 CTGGAGCAGCTGGAAAAGCTGGG - Intergenic
1122976922 14:105174557-105174579 AGGAAGCAGCTGGGTAAGGTCGG - Intronic
1123179756 14:106458984-106459006 CTGAAGCAGGCGGATCACCTGGG - Intergenic
1123435355 15:20250259-20250281 ATGAATGAGCTGTATTACCTTGG - Intergenic
1125530168 15:40407945-40407967 TGGAAGCAGCTGGGGAACCTGGG + Exonic
1125556878 15:40593188-40593210 ATTTAGAAGCTGTATAACCTCGG + Intergenic
1127605848 15:60587703-60587725 ATGAAATAACTGGAAAACCTAGG + Intronic
1128794777 15:70458341-70458363 CTGAAGCAGGTGGATCACTTGGG + Intergenic
1131516757 15:93083560-93083582 ATGAAGCAGTTAGCCAACCTCGG + Intronic
1134600007 16:15525985-15526007 ATGAAGCTACTGGCTAACCAGGG - Intronic
1134675150 16:16085206-16085228 GTGAAGCAGCAGGAAAACCTGGG - Intronic
1135274305 16:21098206-21098228 ATGAGGCAGGTGGATCACTTGGG + Intronic
1135624628 16:23983015-23983037 ATGAAGCATCTGGAGATTCTGGG + Intronic
1136849259 16:33600731-33600753 ATGAATGAGCTGTATTACCTTGG + Intergenic
1140212398 16:72980805-72980827 ATGAAGCAGCATGATATCGTTGG + Intronic
1140697648 16:77550868-77550890 CAAAAGCACCTGGATAACCTAGG + Intergenic
1141637851 16:85324274-85324296 CTGAGGCAGGTGGATCACCTGGG + Intergenic
1141755352 16:85987431-85987453 AGGAAGCAGGTGGAGACCCTCGG - Intergenic
1203110966 16_KI270728v1_random:1449381-1449403 ATGAATGAGCTGTATTACCTTGG + Intergenic
1142788855 17:2247236-2247258 ATGAAGCAACTGGAGAATCTGGG + Intronic
1144662238 17:17078634-17078656 AGGAAGCAACTGGAAAACCAGGG - Intronic
1147363757 17:39946936-39946958 GTGAGGCAGCTGGACAGCCTCGG + Intergenic
1147710426 17:42459338-42459360 ATGAAGCAGGTGAATACCGTGGG + Intronic
1149542754 17:57480194-57480216 CTGAGGCAGGTGGATAACTTGGG - Intronic
1149615020 17:57989653-57989675 ATGAAGGGGCTGGAAAACGTTGG + Exonic
1149869767 17:60170918-60170940 AAGAAGCAGCTGGATGAACCTGG + Intergenic
1150798741 17:68261917-68261939 CTGAAGCAGGTAGATCACCTAGG + Intronic
1153050426 18:898174-898196 ATGTAGCAGCTGTGTAACTTTGG + Intergenic
1153446445 18:5178253-5178275 ATGAAGAAGTGGGACAACCTGGG + Intronic
1153477573 18:5513606-5513628 ATGAATTAGCTGGGTAACTTTGG + Intronic
1153642204 18:7166773-7166795 ACTTAGCAGCTGGTTAACCTTGG + Intergenic
1156374977 18:36505276-36505298 ATGAAGCTGTTGGAGAAACTGGG + Intronic
1158397167 18:57088395-57088417 CTGAAGCAGGGGGATCACCTGGG + Intergenic
1158807489 18:60992228-60992250 CTGAGGCAGGTGGATCACCTGGG - Intergenic
1159422175 18:68235273-68235295 AGGAAGCAGCCTGAAAACCTGGG - Intergenic
1161352148 19:3799604-3799626 CTGAGGCAGGTGGATCACCTGGG + Intronic
1162700643 19:12512424-12512446 GGGGAGCAGCTGGATACCCTCGG - Intronic
1163877764 19:19889142-19889164 ATGAAGAAGCTGAACAAACTAGG - Intronic
1164231430 19:23291396-23291418 CTGAGGCAGGTGGATCACCTGGG + Intergenic
1164689675 19:30201260-30201282 AGGAAGCAGCTGGACAACACTGG + Intergenic
1166429442 19:42711876-42711898 ATGAAGTGGCTGGATGACCCTGG - Intronic
1166450855 19:42899617-42899639 ATGAAGTGGCTGGATGACCCTGG - Intronic
1166462763 19:43003962-43003984 ATGAAGTGGCTGGATGACCCTGG - Intronic
1166468904 19:43060420-43060442 ATGAAGTGGCTGGATGACCCTGG - Intronic
1166480050 19:43163941-43163963 ATGAAGTGGCTGGATGACCCTGG - Intronic
1166489868 19:43249472-43249494 ATGAAGTGGCTGGATGACCCTGG - Intronic
1167311510 19:48740176-48740198 AGGAAGCAGCTGGCGAAGCTGGG - Exonic
1168536789 19:57177528-57177550 CTGAGGCAGGTGGATCACCTGGG - Intergenic
1168719629 19:58547859-58547881 ATGAAGGAGCTGAATAAGCGGGG + Exonic
925472414 2:4176295-4176317 ATGAAGCAGCTACATTATCTGGG + Intergenic
925684260 2:6455332-6455354 CTGAGGCAGGTGGATCACCTGGG + Intergenic
929546248 2:42856798-42856820 ATGAATAAGCTGTATAACCAGGG - Intergenic
930026061 2:47029820-47029842 ATGAAGGAGCAGGACCACCTTGG - Intronic
930159244 2:48137344-48137366 AAGAATCAACTGGAAAACCTAGG + Intergenic
930754431 2:54960503-54960525 AAGAACCAGCTGGGTGACCTTGG + Intronic
932211753 2:69937304-69937326 AAGAGGCAGCTGGAGAAGCTGGG + Exonic
932843056 2:75102212-75102234 ATGTGGCTGCTGGATAACCTAGG - Intronic
935066356 2:99651960-99651982 AGGTAGGAGCTGGATGACCTCGG + Intronic
935657358 2:105435586-105435608 CTGAGGCAGGTGGATCACCTGGG + Intronic
937352219 2:121173272-121173294 AGGATGCAGCTGAACAACCTGGG - Intergenic
939251760 2:139689683-139689705 ATGAAGCAGCAAGAGAAGCTAGG + Intergenic
939336518 2:140835770-140835792 CTGAGGCAGGTGGATCACCTGGG - Intronic
941001770 2:160209518-160209540 CTGAAACAGCTGGAGAACCCTGG - Intronic
941077118 2:161018285-161018307 ACAAAGCAGCTGGTTACCCTTGG - Intergenic
942110982 2:172682515-172682537 TGGAAGCAGCTGGCTAACCAGGG + Intergenic
943709668 2:191076876-191076898 CTGAGGCAGATGGATCACCTGGG - Intronic
945458845 2:210080871-210080893 CTGAAGCAGGTGGATCACTTGGG + Intronic
946888178 2:224245871-224245893 ATGAAGCAGGTGTATAGACTTGG - Intergenic
949070601 2:242022001-242022023 GTCATGCAGCTGGATACCCTGGG + Intergenic
1169054384 20:2608559-2608581 CTGAGGCAGGTGGATCACCTGGG - Intronic
1169376235 20:5068714-5068736 ATAAAACCGCTGGATAATCTTGG - Intronic
1170207588 20:13815336-13815358 ATGAAGCAGCTGGATAACCTTGG - Intronic
1170370704 20:15644920-15644942 CTGAGGCAGGTGGATCACCTAGG - Intronic
1170938374 20:20828727-20828749 TTGAGCCAGCTGGATAACATTGG - Intergenic
1171193147 20:23175454-23175476 ATGAAGCAGCTGCATTGTCTGGG + Intergenic
1172070128 20:32250683-32250705 CTGAGGCAGGTGGATCACCTGGG - Intergenic
1173367429 20:42399601-42399623 GTTAAGCATCTGGATTACCTGGG - Intronic
1173403455 20:42744925-42744947 GTGAAGCAGCTGCCTAACCACGG - Intronic
1173629557 20:44501183-44501205 ATGAAGAAGATGGACAGCCTCGG - Exonic
1174442498 20:50567192-50567214 CTGAAGCAGGTGGATCACTTGGG + Intronic
1174463207 20:50697798-50697820 CTGAGGCAGGTGGATCACCTGGG - Intergenic
1177075840 21:16572567-16572589 TTAAAGCAGCTGAATAACTTTGG - Intergenic
1177657689 21:24040732-24040754 ATGAAGCAAATGTATACCCTAGG - Intergenic
1178296211 21:31412546-31412568 CTGAGGCAGGTGGATCACCTGGG + Intronic
1179963357 21:44784713-44784735 ATGAGCCAGCTGGAGAACCTGGG + Intronic
1180282459 22:10715367-10715389 ATGAAGGCCCTGGGTAACCTTGG + Intergenic
1180815415 22:18786458-18786480 CTGAGGCAGATGGATCACCTAGG - Intergenic
1181201605 22:21220795-21220817 CTGAGGCAGATGGATCACCTAGG - Intronic
1181700148 22:24616179-24616201 CTGAGGCAGATGGATCACCTAGG + Intronic
1182080374 22:27524508-27524530 ATGGAGCAGCTGGGGAACCAGGG + Intergenic
1184184990 22:42858335-42858357 AGGAAGCAGCTGGCTGAACTGGG - Intronic
1184466645 22:44672349-44672371 TTGAGGCAGGTGGATCACCTGGG + Intronic
1185104584 22:48860112-48860134 TGGAAGCAGATGGATAAACTGGG + Intergenic
1203225309 22_KI270731v1_random:74635-74657 CTGAGGCAGATGGATCACCTAGG + Intergenic
1203265519 22_KI270734v1_random:12148-12170 CTGAGGCAGATGGATCACCTAGG - Intergenic
949200244 3:1368971-1368993 ATGAAGCTGGAGGATAGCCTTGG - Intronic
949821388 3:8120058-8120080 CTGCAGCTGCTGGATCACCTTGG - Intergenic
949951554 3:9233248-9233270 GTGAATCAGCTGAATGACCTTGG - Intronic
956007836 3:64799399-64799421 GTGAAACAGCTGGATAAACCTGG + Intergenic
956058069 3:65321813-65321835 CTGAGGCAGGTGGATAACTTAGG - Intergenic
956927947 3:74009690-74009712 TTGAAGTAGCTGCATAAGCTAGG + Intergenic
957562967 3:81847456-81847478 AAGAAGCAGCTGGTTAAAATGGG + Intergenic
957860245 3:85939210-85939232 GTGAAACAGCTGCATAACTTGGG + Intronic
958174509 3:89979061-89979083 ATGAAGCAGCAGCATGACTTGGG + Intergenic
958662800 3:97093133-97093155 AGGAAGTAGCTGTATAACCAAGG - Intronic
959640970 3:108634300-108634322 ATGCAGCAGCAGGAATACCTGGG + Intronic
959676377 3:109040594-109040616 CTGAGGCAGGTGGATTACCTGGG + Intronic
960820773 3:121728704-121728726 CTGAATCAGCTGAATTACCTGGG - Intronic
960826297 3:121788608-121788630 GTGAAGAAGCTGCATAATCTGGG - Intronic
962027131 3:131560167-131560189 ATAAAGCAGCTGGCTAACACAGG - Intronic
962050002 3:131803152-131803174 ATTAGCCAGGTGGATAACCTTGG + Intronic
962842467 3:139248338-139248360 ATGAACCAGCTGAAAATCCTGGG - Intronic
962873906 3:139520952-139520974 CTGAGGCAGGTGGATCACCTGGG + Intronic
963807093 3:149733999-149734021 CTGAAGCAGCTTCATAATCTGGG + Intronic
963854382 3:150238817-150238839 ATGAATCACCTGGATAACATCGG - Intergenic
963934439 3:151037778-151037800 AGGAAGCTGCTGGATAACGTGGG + Intergenic
964753709 3:160075993-160076015 ATTAAGCTGTTGGATGACCTTGG + Intergenic
964841224 3:160995552-160995574 TTGAGGCAGGTGGATCACCTGGG - Intronic
965001357 3:162958261-162958283 CTGAGGCAGGTGGATCACCTGGG + Intergenic
967006844 3:185392180-185392202 CTTAAGCAGCTGTATAATCTGGG - Intronic
967071358 3:185965185-185965207 CTTAAGCAGCTGTATAATCTGGG + Intergenic
967276164 3:187777295-187777317 ATGTAGCAGCTGTACAAACTTGG - Intergenic
967369794 3:188731364-188731386 ATGAAGCTCCTGGATTATCTGGG + Intronic
967451367 3:189627108-189627130 GTAAAGCAGTTGGCTAACCTGGG - Intergenic
968188780 3:196652551-196652573 AGGAAGCAGCAGGATATCATGGG - Intronic
971249428 4:24961178-24961200 AAGAAGAAGGTGGATAGCCTAGG + Intronic
972076127 4:35089772-35089794 ATGAAGCAGGTGGCTAACACAGG - Intergenic
972884039 4:43463415-43463437 ATGAGGCAGGTGTATCACCTCGG - Intergenic
973728692 4:53802453-53802475 CTGAAGCAGGCGGATCACCTAGG - Intronic
973765828 4:54161585-54161607 ACGAAGCAGCTGGATGACATTGG - Intronic
973882659 4:55289509-55289531 CTGAGGCAGGTGGATCACCTAGG - Intergenic
974776613 4:66491091-66491113 ATGAGTTAGCTGGGTAACCTTGG + Intergenic
976574240 4:86650516-86650538 CTGAGGCAGGTGGATAGCCTGGG - Intronic
980510789 4:133784975-133784997 CTGAGGCAGGTGGATCACCTGGG + Intergenic
981840046 4:149101325-149101347 ATGAATCAGCTTGTTGACCTGGG + Intergenic
983706201 4:170662642-170662664 ATGAAGCAGCTGCATTGTCTGGG - Intergenic
984450113 4:179888877-179888899 ATGCAGCAGCTATATAATCTTGG + Intergenic
985328366 4:188797975-188797997 CTGAGGCAGGTGGATCACCTGGG + Intergenic
986670244 5:10137041-10137063 AGGAACCACCTGGATAATCTAGG + Intergenic
986672356 5:10153649-10153671 ATGAAGTACCCAGATAACCTGGG + Intergenic
987172277 5:15271146-15271168 AAGAAGCATTTGTATAACCTAGG - Intergenic
988050337 5:26021177-26021199 ATGAGACAGTTGGGTAACCTGGG - Intergenic
988447676 5:31306008-31306030 GTGATGCAGCTGAATAACCTGGG + Intronic
988449919 5:31331288-31331310 ATGAAGAAGCTGAAAAGCCTTGG + Intergenic
991220639 5:64211492-64211514 CTGAAGCAGGTCAATAACCTAGG - Intronic
991557796 5:67914979-67915001 ATCAAGCAGCTGGGGGACCTTGG - Intergenic
991652665 5:68872055-68872077 ATGAGGCATCAGGATGACCTTGG - Intergenic
992062610 5:73070051-73070073 CTGCAGCATCTGCATAACCTGGG + Intronic
992350388 5:75922272-75922294 ATTAAGCAGCTTGATAGACTGGG - Intergenic
992494496 5:77279688-77279710 ACTAACCAGCTGGATAACCTTGG - Intronic
994210410 5:97082256-97082278 AGTAACCAGCTGGACAACCTAGG - Intergenic
995501898 5:112816244-112816266 ATGAGGCAGATGGATCACATGGG - Intronic
996057431 5:118997117-118997139 CTGAGGCAGATGGATCACCTGGG - Intergenic
998223312 5:140305944-140305966 CTGAGGCAGGTGGATCACCTGGG - Intergenic
998941385 5:147286502-147286524 TTGAAACAGCTGCATAAACTGGG - Intronic
998974522 5:147629703-147629725 ATAAAGCAGCTTGATATCTTGGG - Exonic
1000407314 5:160901973-160901995 ATGCATCAGCTGGGTGACCTTGG - Intergenic
1002437385 5:179239925-179239947 ATGCAGCAGCATGATGACCTCGG + Intronic
1003766108 6:9238694-9238716 ATAAAGCAGCAGGTTAACATTGG - Intergenic
1005401214 6:25436525-25436547 ACAAAGCAGCAGGAAAACCTAGG + Intronic
1007807810 6:44463640-44463662 ATGAAGGAGCTGTGTGACCTTGG + Intergenic
1009415779 6:63415082-63415104 CTGAGGCAGGTGGATCACCTAGG + Intergenic
1012030657 6:94057604-94057626 ATAGAACAGCTGGATAGCCTAGG + Intergenic
1012743466 6:103052221-103052243 TTCAAGTTGCTGGATAACCTAGG - Intergenic
1013161735 6:107551785-107551807 CTGAAGCAGGTGGATCACTTGGG + Intronic
1015873186 6:137797571-137797593 CTGAGGCAGGTGGATCACCTGGG - Intergenic
1016267787 6:142252654-142252676 CTGAGGCAGATGGATCACCTGGG + Intergenic
1016476870 6:144437185-144437207 CTGAGGCAGGTGGATCACCTAGG - Intronic
1016812346 6:148273525-148273547 CTGAGGCAGGTGGATCACCTGGG - Intronic
1016851301 6:148621873-148621895 ATGAAGCAACTGGCTACCCAGGG + Intergenic
1017500968 6:155022531-155022553 CTGAGGCAGGTGGATCACCTGGG - Intronic
1018558654 6:165076479-165076501 ATGAATCATTTTGATAACCTGGG - Intergenic
1019771878 7:2888368-2888390 CTGAGGCAGGTGGATCACCTGGG + Intergenic
1020355684 7:7273239-7273261 AAGAAGCAACTGGAAAAGCTAGG + Intergenic
1021403641 7:20238434-20238456 ATGAACCAGCAGCATCACCTAGG - Intergenic
1022291702 7:29010931-29010953 ATGTACCAGCTGTATGACCTTGG - Intronic
1022978476 7:35579730-35579752 ATAAATCAGCTGTATAGCCTTGG + Intergenic
1023841258 7:44099389-44099411 CTGAGGCAGGTGGATCACCTGGG - Intergenic
1024189222 7:46988548-46988570 CTGAGGCAGGTGGATCACCTGGG + Intergenic
1025113298 7:56237233-56237255 CTGAGGCAGGTGGATCACCTGGG + Intergenic
1025867400 7:65397302-65397324 ATGAAGAAGCTAGACAAACTAGG - Intronic
1026055318 7:66978758-66978780 CTGAGGCAGGTGGATCACCTGGG + Intergenic
1027367947 7:77477989-77478011 CTGAGGCAGGTGGATCACCTGGG - Intergenic
1031219746 7:118950364-118950386 ATTAAGAAGCTGGATCTCCTCGG - Intergenic
1032492197 7:132331951-132331973 ATAAGGCATCTGGACAACCTTGG + Intronic
1032626696 7:133598746-133598768 CTGAAGCGGGTGGATTACCTGGG + Intronic
1032847797 7:135766744-135766766 ATGAAGCAGAGGGAAAACGTTGG - Intergenic
1033517412 7:142121408-142121430 CTGAGGCAGGTGGATCACCTGGG - Intronic
1033646145 7:143305974-143305996 ATGAAGCAGGGAGATAAGCTAGG - Exonic
1033646556 7:143309220-143309242 CTGAGGCAGGTGGATCACCTGGG + Intergenic
1033785344 7:144723192-144723214 CTGAGGCAGGTGGATCACCTGGG - Intronic
1034717885 7:153260521-153260543 ATGTAGCAGTTGGATAGTCTTGG + Intergenic
1034729251 7:153369775-153369797 CTGAGGCAGGTGGATTACCTGGG - Intergenic
1035152788 7:156888819-156888841 CTGAGGCAGGTGGATCACCTGGG + Intronic
1035210943 7:157327608-157327630 CTGAGGCAGGTGGATCACCTGGG - Intergenic
1036084910 8:5602758-5602780 ATAAAGCCTCTGGATTACCTAGG - Intergenic
1036935551 8:12998849-12998871 ATTAAGAAGCTGGAAAAACTTGG + Intronic
1036951467 8:13143864-13143886 CTGAAACGGCTGGAAAACCTTGG - Intronic
1037628534 8:20630085-20630107 AGGAAGCAGCTGGATACCTGCGG + Intergenic
1038675130 8:29616283-29616305 GTGAAGCAGCTGGTGGACCTGGG - Intergenic
1038740586 8:30213280-30213302 AGGCAGCATCTGGATAACCTGGG - Intergenic
1040856751 8:51956621-51956643 CTAAAGCAGGTGGATCACCTGGG - Intergenic
1041271758 8:56115887-56115909 CTGAGGCAGGTGGATCACCTGGG - Intergenic
1041918832 8:63161748-63161770 CTGAAGCAGGTGGATCGCCTGGG - Intergenic
1042836274 8:73081426-73081448 TAGAAGTAGCTGGATACCCTGGG + Intronic
1042989963 8:74628225-74628247 ACGAAGCATCTGGAGAACCCAGG + Intronic
1044631401 8:94282336-94282358 ATTAAGCAGCTGGATGGTCTTGG + Intergenic
1045271089 8:100662223-100662245 ATTTAACAGCTGCATAACCTTGG - Intronic
1046069329 8:109231882-109231904 ATGAAGCAGCTAGGTAATCGAGG - Intergenic
1046900486 8:119518612-119518634 ATGAAGAAGATGGATGACTTGGG - Intergenic
1047072269 8:121358260-121358282 CTGAGGCAGGTGGATCACCTAGG + Intergenic
1047132989 8:122042749-122042771 CTGAAACAGCTGGATCTCCTTGG + Intergenic
1047276527 8:123409732-123409754 CTGAGGCAGGTGGATCACCTGGG + Intronic
1048345889 8:133573998-133574020 GTGCAACAGCTGGATGACCTGGG - Intergenic
1049138941 8:140933418-140933440 AAGAAGCAGGTGGAGAATCTAGG + Intronic
1050739192 9:8800922-8800944 ATGTAGGAGCTGGGAAACCTAGG + Intronic
1051046597 9:12882893-12882915 ATGAATTTGCTGGATAACTTTGG - Intergenic
1052458706 9:28734552-28734574 ATTTAGCAGCTGTATGACCTTGG - Intergenic
1053319454 9:37082362-37082384 CTTAACCAGCTGCATAACCTTGG + Intergenic
1053700697 9:40687168-40687190 CTGAGGCAGGTGGATCACCTAGG - Intergenic
1054311990 9:63486566-63486588 CTGAGGCAGGTGGATCACCTAGG - Intergenic
1054410764 9:64810623-64810645 CTGAGGCAGGTGGATCACCTAGG - Intergenic
1055274326 9:74597133-74597155 TGGAAGCAGCTGCATCACCTGGG - Intronic
1055987965 9:82072644-82072666 CTGAGGCAGGTGGATCACCTAGG + Intergenic
1056530696 9:87484755-87484777 CTGAAGCAGAAGGATAACTTGGG + Intergenic
1058563255 9:106251887-106251909 ATGAATCACCTGGATGACCATGG - Intergenic
1060215653 9:121736931-121736953 ATGAAGCAGGGTGATAACTTGGG + Intronic
1060837967 9:126771981-126772003 AAGAACTAGCTGGGTAACCTGGG + Intergenic
1061523594 9:131138449-131138471 CTGAGGCAGGTGGATCACCTGGG - Intronic
1190089753 X:47427483-47427505 CTGAGGCAGGTGGATCACCTGGG + Intergenic
1194201133 X:90953784-90953806 CTGAGGCAGGTGGATCACCTGGG - Intergenic
1194863504 X:99035438-99035460 AGGAAGCAGCTGGAAACACTTGG - Intergenic
1196675848 X:118419344-118419366 AGGAAGCAGCAGGAAAGCCTTGG - Intronic
1197787218 X:130210969-130210991 AAGAATCAGCTGGAAAACTTGGG - Intronic
1197984779 X:132255955-132255977 ATGCATTAGCTGGATGACCTTGG - Intergenic
1198252164 X:134890244-134890266 ATGAAGTAGCTAGATAAAATTGG + Intronic
1200546979 Y:4529243-4529265 CTGAGGCAGGTGGATCACCTGGG - Intergenic