ID: 1170207650

View in Genome Browser
Species Human (GRCh38)
Location 20:13816368-13816390
Sequence GGTATACTGTTAGATGAGAC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 108}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170207648_1170207650 -5 Left 1170207648 20:13816350-13816372 CCTTAGAGAATGAGGACAGGTAT 0: 1
1: 0
2: 0
3: 12
4: 144
Right 1170207650 20:13816368-13816390 GGTATACTGTTAGATGAGACGGG 0: 1
1: 0
2: 0
3: 7
4: 108
1170207647_1170207650 -4 Left 1170207647 20:13816349-13816371 CCCTTAGAGAATGAGGACAGGTA 0: 1
1: 0
2: 0
3: 9
4: 127
Right 1170207650 20:13816368-13816390 GGTATACTGTTAGATGAGACGGG 0: 1
1: 0
2: 0
3: 7
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170207650 Original CRISPR GGTATACTGTTAGATGAGAC GGG Intronic
901347103 1:8554796-8554818 GGAATATTGTTAGCTGGGACCGG - Intronic
901347108 1:8554831-8554853 GGAATATTGTTAGCTGGGACTGG - Intronic
906103413 1:43277448-43277470 GGTCTCCTGTGAGATGTGACTGG - Intergenic
907217407 1:52876679-52876701 AGAAGAGTGTTAGATGAGACGGG - Intronic
909733435 1:78925618-78925640 GGTATATTGTCAGAGGAGAGTGG + Intronic
911344153 1:96675684-96675706 GGTATAATGTTATTTGAGAGTGG - Intergenic
911793068 1:102042952-102042974 GGCATACTGTTAGATAAAAAAGG - Intergenic
915988298 1:160488553-160488575 GTTATGCTGCTAGATGAGAGGGG + Intronic
918803190 1:189000048-189000070 GGTATATTTTTAGTAGAGACGGG + Intergenic
1063867134 10:10377474-10377496 GGTATTCTGTTATATCAGCCTGG + Intergenic
1068017842 10:51540888-51540910 GTTATACTTTTAGAAGAGACGGG + Intronic
1069319801 10:67154776-67154798 CATATAGTGTTAGATGAGACTGG - Intronic
1072164463 10:92799461-92799483 GCTATACTGTGAGGTGAGAAGGG - Intergenic
1072334007 10:94381253-94381275 GGTATATTTTTAGTAGAGACGGG - Intergenic
1079818324 11:25091435-25091457 AGTATAATGTTAAATGAGAGTGG - Intergenic
1084249440 11:67885439-67885461 AGTTTACTGTTAGATCAGCCTGG - Intergenic
1086585585 11:88447924-88447946 GGTAGGCTCTTAGAAGAGACTGG + Intergenic
1093852120 12:24053299-24053321 TTTATACTGTTAGTAGAGACGGG + Intergenic
1096395935 12:51266942-51266964 TGTATACTTTTAGTGGAGACAGG - Intronic
1096425712 12:51501000-51501022 GGTATATTTTTAGTAGAGACCGG + Intronic
1099214172 12:79834060-79834082 GGTACATTGTTAGATGCTACAGG + Intronic
1100016683 12:90019726-90019748 GCTATAGTGTTAGACAAGACTGG - Intergenic
1101332550 12:103768863-103768885 GGTTTACTGTTAGCTGTTACTGG + Intergenic
1103498942 12:121385561-121385583 TGTAAACTGTTAGAGGAGAGAGG + Intronic
1106289687 13:28349018-28349040 GGTATACAGTTAGAAGAGAAAGG + Intronic
1106767976 13:32934660-32934682 AGTGTAATGCTAGATGAGACTGG + Intergenic
1117035370 14:51722528-51722550 GTTATACTGGTAGAGGAGTCTGG + Intronic
1118624795 14:67648677-67648699 GGGATACAGTTAGATGAGAATGG + Exonic
1127134964 15:55910552-55910574 GGTATACAGTGAGATGGGAAGGG - Intronic
1128293282 15:66496047-66496069 GTTATACTTTTAGTAGAGACGGG - Intronic
1135039069 16:19103995-19104017 GCAATACTGAGAGATGAGACTGG - Intergenic
1139966434 16:70748035-70748057 TGTATCCTGTGAGGTGAGACTGG - Intronic
1142734204 17:1884615-1884637 GGTATACAGTGAAATGAGACAGG - Intronic
1145076303 17:19857806-19857828 AGCATAGTGTTAGATGATACTGG - Intronic
1147010300 17:37440921-37440943 TTTATACTTTTAGTTGAGACAGG - Intronic
1150171273 17:62998020-62998042 GGAATACTGTAAAATGAAACAGG + Intergenic
1151746765 17:76015673-76015695 GGTATCCTGGTAGAAGAGTCGGG - Intronic
1155175886 18:23300599-23300621 GGTTTACTGTTAGGAGAGCCAGG + Intronic
1156123374 18:33872773-33872795 GCTATAATGTTAGATGGCACAGG + Intronic
1157778385 18:50416568-50416590 GGTATACTGTTATTTGAAATTGG - Intergenic
926674081 2:15605029-15605051 GGTAGAATGTTAGATGAGTGAGG + Intronic
929357011 2:41037791-41037813 GGAATAGTGTTAGATCAGAGAGG - Intergenic
932846023 2:75136603-75136625 GGGATGCTGTAAGATGAGGCAGG - Intronic
933623252 2:84569246-84569268 GATATATTGTTAGATGAAAAAGG + Intronic
936820927 2:116519945-116519967 GGTATAGTGTTAGTTGAAAGTGG + Intergenic
938975048 2:136468982-136469004 GGTATACCGTTTGCTAAGACAGG - Intergenic
941309075 2:163907853-163907875 TTTATATTTTTAGATGAGACGGG - Intergenic
946606883 2:221415140-221415162 GATAAACTGTTTGATGAGATAGG + Intergenic
947675189 2:231972323-231972345 GCCATACTTTTATATGAGACTGG + Intronic
1170207650 20:13816368-13816390 GGTATACTGTTAGATGAGACGGG + Intronic
1177110799 21:17025818-17025840 GTTATAGTGGTACATGAGACTGG - Intergenic
1181128485 22:20715644-20715666 TGTGTACTTTTAGTTGAGACGGG + Intronic
1181267654 22:21640194-21640216 TGTGTACTTTTAGTTGAGACGGG - Intergenic
1181622485 22:24100570-24100592 GGTCTACTGTGAGAGGAGAGGGG + Intronic
1181988071 22:26815522-26815544 GGTTTAATTTTAGATGAGATAGG + Intergenic
952508375 3:34028868-34028890 GGAATACTGGCAGATGAGGCTGG + Intergenic
953193032 3:40706933-40706955 GGTATAGTGTTATTTGAGAATGG - Intergenic
962623326 3:137200170-137200192 GGTATTCTCTAAGATGATACAGG + Intergenic
966041448 3:175494557-175494579 GCTATACTCTGAGATGATACTGG - Intronic
969580921 4:8064579-8064601 GGTATTCTGTTACATGTCACAGG + Intronic
971915719 4:32867741-32867763 TGTATACTTTTAGTAGAGACAGG + Intergenic
974042589 4:56870303-56870325 GGTATACTGTTAAATGAAAATGG + Intergenic
976291833 4:83426735-83426757 TGTATTCTTTTAGAAGAGACGGG + Intronic
976855787 4:89604076-89604098 TTTATACTTTTAGTTGAGACAGG + Intergenic
977868407 4:102059240-102059262 GGTATACAGTTAGGTAGGACTGG + Intronic
979784686 4:124701132-124701154 TTTATACTGTTAGTAGAGACAGG + Intronic
982266088 4:153539562-153539584 GGTATTCTGAGAGATGGGACTGG + Intronic
983482359 4:168290510-168290532 GGTATATTTTTAGTAGAGACGGG + Intronic
984882728 4:184424726-184424748 GGTATTCTGTTAGAAGCAACAGG + Intronic
987245479 5:16043924-16043946 TGGATACTGTTAGCTGAGGCTGG + Intergenic
988278676 5:29115253-29115275 GGCATACTGAAAGATGACACAGG - Intergenic
991094628 5:62726638-62726660 AATATAGTGTTAGATGAGAAAGG + Intergenic
991255886 5:64614135-64614157 GCTATATTGTTAGATGAAAAAGG + Intergenic
994526715 5:100915267-100915289 GATACAATGTTATATGAGACAGG - Intergenic
996008018 5:118446936-118446958 AGCATAATGATAGATGAGACTGG + Intergenic
996892548 5:128439021-128439043 GGTATATTGTTACATGACAAAGG - Intronic
998089608 5:139356710-139356732 TGTATACTTTTAGTAGAGACGGG - Intronic
998090681 5:139366026-139366048 TGTATACTTTTAGTAGAGACGGG - Intronic
1003563756 6:7205022-7205044 GGTATATTGGAAGATGAGTCTGG + Intronic
1004628875 6:17402491-17402513 GGTTTACTATTTGATTAGACTGG - Intronic
1006076092 6:31533524-31533546 AGGATAGTTTTAGATGAGACTGG + Intronic
1008712703 6:54247821-54247843 GGTGTACTGCTAGAGGAGAGTGG + Intronic
1011516702 6:88163119-88163141 TGTATATTCTTAGATTAGACTGG + Intronic
1011779984 6:90777538-90777560 GGTAGAAGGTAAGATGAGACAGG - Intergenic
1015310976 6:131767057-131767079 AGTATACTTTTATATGAGATTGG + Intergenic
1017318632 6:153062366-153062388 GGTGTACTGTTAGAGAAGAAGGG + Intronic
1018960394 6:168443312-168443334 AGTAAATAGTTAGATGAGACAGG - Intronic
1021272164 7:18603521-18603543 GGTATACTGTTATTTGAAAGTGG - Intronic
1022690472 7:32646956-32646978 GATATACTGATAGAAGAAACTGG + Intergenic
1024091364 7:45944128-45944150 GGTGTACAGTTACATGAGATTGG + Intergenic
1024459884 7:49649021-49649043 TGTATACAGATAGATGAGAGGGG - Intergenic
1032266901 7:130375857-130375879 GGTTTTCTGTTACATGTGACTGG - Intergenic
1032727778 7:134607028-134607050 TCTATACTTTTAGATGAGAATGG + Intergenic
1034693304 7:153031523-153031545 GGTATTCTTTTAGTAGAGACAGG + Intergenic
1034704246 7:153126624-153126646 GGTATTCTCTTACATGAAACTGG + Intergenic
1035901219 8:3460191-3460213 AGTAAACTCTGAGATGAGACGGG + Intronic
1035943816 8:3935881-3935903 AGTATACTTAAAGATGAGACAGG + Intronic
1039979497 8:42395784-42395806 GGTATATTTTTAGTAGAGACGGG - Intronic
1041748232 8:61232207-61232229 TGTATACTTTTAGTAGAGACGGG + Intronic
1042344967 8:67717958-67717980 GGTATACTGTTAGTGGAAGCAGG + Intronic
1045354293 8:101371667-101371689 GGAAAACTGAAAGATGAGACTGG - Intergenic
1047026981 8:120835029-120835051 GGTATGCTGTTAGAGGATGCAGG + Intergenic
1047233624 8:123019158-123019180 AGTAAAATGTTAGATGAGACAGG + Intronic
1051770799 9:20577119-20577141 TGTATAATTTTAGAAGAGACAGG - Intronic
1059481888 9:114597451-114597473 AGTATACTGATAGGTGAGCCTGG + Intronic
1185973503 X:4691865-4691887 GATATTTTGTTTGATGAGACTGG - Intergenic
1187335923 X:18381773-18381795 GGTATAGTGTTAGTTGAAAGTGG - Intergenic
1187786825 X:22900266-22900288 GGTATAGTGTTTCATTAGACAGG - Intergenic
1189108713 X:38264453-38264475 GGTGTTCTGTTGGAAGAGACAGG + Intronic
1190175831 X:48148622-48148644 GGTATACAGTTCTATGAGAAGGG - Intergenic
1191703607 X:64069760-64069782 GGTATAGTGTTATATGAAAGAGG - Intergenic
1192738482 X:73871285-73871307 TGTATTCTTTTAGAAGAGACAGG + Intergenic
1193655766 X:84195325-84195347 AGTATTCTGTTAAATAAGACTGG + Intergenic
1196009641 X:110873041-110873063 GGTACACTGATGGATGAAACTGG + Intergenic
1197870693 X:131059786-131059808 GGTATACTGTTAGAGCAGTAAGG - Intronic
1197948536 X:131868689-131868711 GGTATAGTGTTATTTGAAACTGG - Intergenic