ID: 1170210859

View in Genome Browser
Species Human (GRCh38)
Location 20:13845207-13845229
Sequence TGACCTCTGTTTAACACAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170210859_1170210864 28 Left 1170210859 20:13845207-13845229 CCTCCTGTGTTAAACAGAGGTCA No data
Right 1170210864 20:13845258-13845280 AGATGAAATGAGAAAACAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170210859 Original CRISPR TGACCTCTGTTTAACACAGG AGG (reversed) Intergenic
No off target data available for this crispr