ID: 1170211573

View in Genome Browser
Species Human (GRCh38)
Location 20:13850686-13850708
Sequence TCTGGGGAAGAATCCACTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 236
Summary {0: 1, 1: 1, 2: 4, 3: 15, 4: 215}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170211573 Original CRISPR TCTGGGGAAGAATCCACTGC AGG (reversed) Intronic
901473878 1:9475781-9475803 TCTGGCTTAAAATCCACTGCGGG + Intergenic
905801033 1:40842874-40842896 TCTAGGCAAGAATCCATTCCTGG - Intergenic
905902769 1:41592665-41592687 GCTGGGGAAGGATCCTGTGCTGG + Intronic
906670327 1:47649531-47649553 TCTGGGAAAGAATCCCCTGGGGG + Intergenic
910446313 1:87302011-87302033 TTTCTGGAAGAATCCACAGCCGG - Intergenic
910830561 1:91456980-91457002 TCTGGGGAAGAAAACAAAGCAGG + Intergenic
911678805 1:100691061-100691083 TCTTGGTTAGAATCCACTGCTGG + Intergenic
912281114 1:108315414-108315436 TTAGGGGAATAATCCACTGGAGG + Intergenic
912316006 1:108667900-108667922 TCTGGTGCAGGATCCACTGGGGG + Intergenic
912652143 1:111449106-111449128 TTGGGGGAAGATTCCACTCCCGG + Exonic
914869427 1:151460185-151460207 TCTGGGGAAGAATAAACAGGTGG - Intergenic
915601786 1:156927211-156927233 TCTGGAGGGGAACCCACTGCCGG + Exonic
915800968 1:158793286-158793308 TCTTGGTTTGAATCCACTGCAGG + Intergenic
915821582 1:159030311-159030333 TCTTGGGTTGGATCCACTGCTGG + Intronic
916599951 1:166283059-166283081 TCTGTGTAAGAAGCCACTGCAGG + Intergenic
918426676 1:184417813-184417835 TCTGGTGGAGAAACCACTGTGGG + Intronic
918991365 1:191700940-191700962 TTTGGGGAAGAATAGGCTGCAGG - Intergenic
919724323 1:200872442-200872464 CCTAGGAAAGACTCCACTGCCGG - Intergenic
920564182 1:206960527-206960549 TCTGGGGAAGGAAGCGCTGCAGG - Exonic
922038374 1:221871972-221871994 GCTGGTGAAGCATCAACTGCTGG + Intergenic
1063183350 10:3627072-3627094 TGTGAGGAAGAATCTACTCCAGG - Intergenic
1063514650 10:6683583-6683605 TCTGGCGAAGACTCCATTCCTGG - Intergenic
1064297773 10:14093916-14093938 TCTGGGAAAGAAACCATAGCTGG + Intronic
1065749219 10:28870387-28870409 TCTTGGCAAGAATCCAGTGAAGG - Intronic
1067816144 10:49478189-49478211 ACTAGAGAAGAATCCACTGAGGG + Intronic
1067981950 10:51097037-51097059 TTTGGGGAAGACCCCACTGTAGG - Intronic
1068562791 10:58534722-58534744 TCTTGGTTTGAATCCACTGCTGG - Intronic
1069669433 10:70189324-70189346 TCTGGGGAAGAACTCTGTGCTGG - Intergenic
1072547514 10:96451006-96451028 TCTGGGAAAGAATGCCCTCCAGG + Intronic
1073748196 10:106493926-106493948 TCTGGGCATGTATCCACTTCAGG - Intergenic
1074122389 10:110502302-110502324 GCTGGGGAAGAAGCCACTTCAGG + Intronic
1074302741 10:112247802-112247824 TCTGGGTAAGATCTCACTGCAGG - Intergenic
1074877269 10:117623113-117623135 TCTGGGGCAGAGTCCGCTGGAGG + Intergenic
1075616314 10:123892722-123892744 TCTGGCGAAAAGTCCACTTCCGG + Intronic
1077054407 11:583859-583881 TCTGAGGAAGCAACCACAGCAGG - Intronic
1077262328 11:1629435-1629457 TCCCGGGAAGATTCCTCTGCGGG - Intergenic
1077294515 11:1819424-1819446 GCTGGGGAAGACTCCACTCTCGG + Intergenic
1077586531 11:3458103-3458125 TCTGGGAAAGCATGCTCTGCAGG - Intergenic
1084242530 11:67832134-67832156 TCTGGGAAAGCATGCTCTGCAGG - Intergenic
1085932348 11:81098638-81098660 TCTGGGGAGGAATCTATTCCTGG + Intergenic
1087366363 11:97224854-97224876 TCTAGGGAACAATCCTCTCCTGG - Intergenic
1087830287 11:102812588-102812610 TCTGGGGAAGATTCCACCCTGGG - Intergenic
1090879800 11:130823608-130823630 TCTGGGGAAGAAAGCACTTGAGG + Intergenic
1091229631 11:133979726-133979748 TCTGGGAAAAAATTCACTGTGGG + Intergenic
1091249730 11:134132908-134132930 TCAGGAGAAGAAGCCTCTGCAGG - Intronic
1091710464 12:2736572-2736594 TATAAGGAAGACTCCACTGCAGG - Intergenic
1092412756 12:8266838-8266860 TCTGGGGAAGCATGCTCTGCAGG - Intergenic
1092732662 12:11548598-11548620 TATGGGGCAGTATCCACTGTAGG + Intergenic
1093933583 12:24978320-24978342 ACTGGGCAATAATCCACTGATGG + Intergenic
1095226844 12:39687373-39687395 TCTGGGGAAGAATTGGCTTCTGG + Intronic
1095358666 12:41308291-41308313 TATAGGAAAGAGTCCACTGCTGG - Intronic
1103897430 12:124282511-124282533 CCTGGGGAAGAATACAATGAGGG - Intronic
1104021072 12:124992986-124993008 TCTTGGCAAGAATCCATCGCAGG + Intergenic
1104762291 12:131304712-131304734 TCTGGGGGTGAATCCACTGCAGG - Intergenic
1104817485 12:131656084-131656106 TCTGGGGATGAATCCACTGCAGG + Intergenic
1104922221 12:132296385-132296407 TCCGGGGAAGAGCCCACAGCTGG - Intronic
1106180194 13:27363181-27363203 TCTAGGGAAGACCACACTGCAGG - Intergenic
1107104604 13:36629917-36629939 TCTGGGGAATAAAACACTGAGGG + Intergenic
1110270279 13:73581583-73581605 TGTAGGGAAGAATCCTCTGTAGG - Intergenic
1111332320 13:86775798-86775820 TCTTGGTTTGAATCCACTGCTGG - Intergenic
1112571919 13:100601120-100601142 ACTGGGGGAGAATCCAAAGCAGG - Intergenic
1113982705 13:114289591-114289613 TGTGCAGAAGAATCCACTGGAGG - Intronic
1119815430 14:77562368-77562390 TTTGCTGAAGAATTCACTGCTGG - Intronic
1119868175 14:77991437-77991459 TCTGGGAAAGATTCCCCTCCTGG + Intergenic
1120857693 14:89226887-89226909 TCTGGGGAAGAATCTGTTCCAGG - Intronic
1121689532 14:95866402-95866424 ACAGGGGATGTATCCACTGCAGG - Intergenic
1122269155 14:100560611-100560633 ACCGGGGAAGCAGCCACTGCTGG - Intronic
1122297833 14:100715112-100715134 TCTGGGTAAGAGTCCTTTGCTGG + Intergenic
1123579388 15:21703012-21703034 TCTGGGGTAAAATCCACCCCTGG + Intergenic
1123616015 15:22145523-22145545 TCTGGGGTAAAATCCACCCCTGG + Intergenic
1126572515 15:50167339-50167361 TCTGAGGGAGAATCCATTCCAGG + Intronic
1127860602 15:62990388-62990410 CCTGGGAAAGAATACCCTGCTGG - Intergenic
1127907307 15:63385353-63385375 GCTTGGGGAGAAACCACTGCAGG + Intergenic
1130221846 15:82026102-82026124 TCTAGGGAAGAATCTGTTGCAGG + Intergenic
1130257804 15:82333829-82333851 TCGGGGGCAGAGGCCACTGCAGG + Intergenic
1131446474 15:92502132-92502154 TCTGGCTCAGAACCCACTGCTGG - Intergenic
1132085856 15:98907794-98907816 TCTGGGGCAGAAGCCACGTCTGG + Intronic
1202988258 15_KI270727v1_random:437257-437279 TCTGGGGTAAAATCCACCCCTGG + Intergenic
1133223426 16:4328775-4328797 CCTGGGGAAGTGTCCCCTGCAGG + Intronic
1134623862 16:15710187-15710209 TCTGGGGCAGAACCCACAGGAGG + Intronic
1138094352 16:54200378-54200400 TCTGGGGAGGATTGCATTGCAGG - Intergenic
1139176528 16:64695980-64696002 AATGGGGAAGAATCCAGGGCAGG + Intergenic
1139920039 16:70454191-70454213 TCTGGAGAAAAATCCACTGATGG - Intergenic
1140745559 16:77977314-77977336 AAAGGGGAAGAATCCAATGCAGG - Intronic
1143875116 17:9985565-9985587 TCTGGGGAAGAACTCTTTGCAGG - Intronic
1149314399 17:55424959-55424981 TCTGTGGAAGAGACCACTGTAGG - Intergenic
1150235727 17:63591474-63591496 TCAGGGGAAGACTGTACTGCAGG - Exonic
1150606381 17:66694907-66694929 TCAGGGAAAGAATCAACTGACGG - Intronic
1152175636 17:78785347-78785369 TCTGGGTTAGAATCCACAGCTGG - Intergenic
1152866429 17:82726518-82726540 TCTGGGGCTGAATGCGCTGCCGG - Exonic
1155330046 18:24705822-24705844 TCTCCCCAAGAATCCACTGCAGG + Intergenic
1155435238 18:25805781-25805803 ACTGGGGAAGAATCCACTTCTGG - Intergenic
1157207221 18:45710834-45710856 ACTGGGTAAGAATCCAGGGCTGG - Intergenic
1157497033 18:48163399-48163421 TGTGGGGGAGAAGCCACTCCTGG + Intronic
1159898828 18:74022996-74023018 TCTGGAGAAGAATCTATTCCAGG - Intergenic
1160309969 18:77779884-77779906 TTTGGTGGAGAATCCACTGCTGG - Intergenic
1160397103 18:78580546-78580568 TCTGGGGAAGAGCCAAGTGCTGG + Intergenic
1160602206 18:80022322-80022344 TCTGGGGAACCATCCTTTGCAGG + Intronic
1161382957 19:3976176-3976198 TCTGGGGCAAAAGCCACTGCGGG + Exonic
1162005519 19:7776116-7776138 GTGGGGGAAGGATCCACTGCAGG - Intergenic
1162099015 19:8328543-8328565 TATGGAGAAGAATCCACAACAGG + Intronic
1164402328 19:27910784-27910806 GCTGGGGAATAAAACACTGCTGG + Intergenic
1165488146 19:36107840-36107862 CCTGGTTAAGAAGCCACTGCTGG + Intergenic
1165853723 19:38867299-38867321 TGTGGGGAAGAATACTCCGCAGG - Intergenic
1165879827 19:39034300-39034322 TGTGGGGAAGAATCCATGTCTGG - Intergenic
1166332236 19:42085426-42085448 TCTGGGGAAGCATCCAGGGATGG + Intergenic
1167578893 19:50330769-50330791 TCTGGGGAAGAATGGAGTGAGGG + Intronic
925052237 2:825122-825144 TCGGGGGAGGAGTCCACAGCAGG + Intergenic
925078339 2:1038899-1038921 ACTTGGGAAGAATAAACTGCAGG - Intronic
927168233 2:20346675-20346697 TCTGGGGAAAAATACACTAATGG - Intronic
931406933 2:61988387-61988409 TGAAGGGAAGGATCCACTGCTGG - Intronic
932323631 2:70839644-70839666 TCTGGGGCAGCCTCCTCTGCCGG - Intergenic
935895441 2:107732751-107732773 TCTGGGCCAGAATCCAGTCCAGG - Intergenic
938576746 2:132611162-132611184 TCTGGGGGAGAACACAGTGCAGG + Intronic
940926835 2:159373084-159373106 ATTGGGGAAGAATCCAGTACCGG + Exonic
943969623 2:194386633-194386655 TCTGTGGGAGAATCTAGTGCAGG - Intergenic
944189125 2:196982553-196982575 TTTGGGGAAGAAGCCAGGGCTGG - Intronic
946166854 2:217869663-217869685 TCTGTGGACGCATCTACTGCGGG + Intronic
948029007 2:234801157-234801179 TCTGGGGACAAATCCAATGGTGG + Intergenic
1168921363 20:1538801-1538823 CCTGGGGATGACTCAACTGCTGG - Intronic
1169448342 20:5690715-5690737 TCTGGGGATGGATCCCCTTCAGG - Intergenic
1169780132 20:9300976-9300998 TGTGGGGAAGAACCCATTCCTGG + Intronic
1170211573 20:13850686-13850708 TCTGGGGAAGAATCCACTGCAGG - Intronic
1170889281 20:20365066-20365088 TCGGAGGAAGAACCCACCGCGGG + Intergenic
1175178578 20:57128809-57128831 TCTGGGGAGGAATCCAGAGCTGG + Intergenic
1177194172 21:17885075-17885097 TGTTGGGAAGAATTCCCTGCAGG - Intergenic
1177195553 21:17900725-17900747 TCTGGGGCCGCACCCACTGCCGG - Intergenic
1178039049 21:28619139-28619161 GCGAGGGAAGAATCCACTCCAGG - Intergenic
1180150704 21:45945794-45945816 ACTGGGGCAGAACCCACTTCTGG - Intergenic
1183030389 22:35099603-35099625 TAAGGGGAAGACCCCACTGCAGG + Intergenic
1183983411 22:41555738-41555760 TCTGGGGTAGCAATCACTGCAGG - Intergenic
951595543 3:24314665-24314687 TCTGGAGAAGAAAAGACTGCAGG - Intronic
952196844 3:31084751-31084773 TCTAGGGCAGAATCCATTTCTGG - Intergenic
952258382 3:31714885-31714907 TCTGGGGAAGAACACTCTGGTGG - Intronic
952268427 3:31808862-31808884 TCTGGGCAAGATTCCAGTTCTGG - Intronic
952637520 3:35549865-35549887 CCTGGGGATGAATGCAGTGCAGG + Intergenic
953430528 3:42836084-42836106 TCTGGGGAGGAATGCATTCCTGG - Intronic
956468040 3:69537941-69537963 TCTGGGTAGGACTCCATTGCTGG + Intronic
956636121 3:71367240-71367262 TGTGGGGAAGGAGCCTCTGCAGG - Intronic
957057857 3:75458027-75458049 TCTGGGAAAGCATGCTCTGCAGG - Intergenic
959589301 3:108059967-108059989 TGTGGAGAAGAATGCAGTGCAGG - Intronic
960071566 3:113437010-113437032 TCTGAGGAAGAATCTACTTCTGG + Intronic
961295594 3:125881684-125881706 TCTGGGAAAGCATGCTCTGCAGG + Intergenic
961371777 3:126435819-126435841 CCTGGGGAAGAGCCCCCTGCAGG - Intronic
961866226 3:129955376-129955398 TCTGAGCAAGAATCACCTGCCGG + Intergenic
961890317 3:130125487-130125509 TCTGGGAAAGCATGCTCTGCAGG - Intergenic
962192003 3:133320152-133320174 TCTTGGTTTGAATCCACTGCTGG - Intronic
963102277 3:141619050-141619072 TCTCAGGAAGAGTCCACTGGAGG - Intergenic
963924052 3:150932727-150932749 TTTGGGGAAGAAATCATTGCTGG - Intronic
964938439 3:162123715-162123737 TCTGGGGACGTAACCTCTGCTGG - Intergenic
965165490 3:165190488-165190510 TCTTGGGAACAATGCATTGCAGG - Exonic
968778060 4:2556995-2557017 TCTTGGGATGGATCCCCTGCAGG - Intronic
969001727 4:3988037-3988059 TCTGGGAAAGCATGCTCTGCAGG - Intergenic
969417739 4:7071993-7072015 TCTGGAGGAGAATCCGCTTCTGG - Intergenic
969752300 4:9120626-9120648 TCTGGGAAAGCATGCTCTGCAGG + Intergenic
969812189 4:9656777-9656799 TCTGGGAAAGCATGCTCTGCAGG + Intergenic
970442439 4:16093374-16093396 TGAGGGGAAGAATCCAGTCCTGG + Intergenic
970549198 4:17162930-17162952 TCTTGGTTAGGATCCACTGCTGG + Intergenic
970937456 4:21590361-21590383 TCTGGGGAAAAATAGATTGCAGG + Intronic
977028418 4:91851516-91851538 ACTGGGGAATATTCCACTGATGG - Intergenic
979561757 4:122108910-122108932 TCTGGGTTTGGATCCACTGCTGG - Intergenic
982401897 4:154977279-154977301 TCTGGAAAAGAATGCATTGCAGG - Intergenic
982739634 4:159044212-159044234 TCTGGGAAAGAAAACACAGCTGG + Intergenic
982946426 4:161629992-161630014 TCTGAGGAAGACTCCACTATAGG - Intronic
983233830 4:165156413-165156435 CCTGAGGAAAAATCCACTGCGGG + Intronic
985841269 5:2307782-2307804 TCCCGGGAAGAATCCTCTGTTGG - Intergenic
986367126 5:7043597-7043619 TCTGGGGAAGGATCCCCTGCTGG + Intergenic
990451483 5:55934978-55935000 TCTGGGGGAGAAACCACTTGTGG + Intergenic
991114548 5:62938968-62938990 TCTGGGAAAGAATCTGTTGCCGG + Intergenic
991616804 5:68505480-68505502 TCTGGGGAAGGAACTACTGGAGG - Intergenic
992351261 5:75931571-75931593 TTTGGGGGCCAATCCACTGCTGG + Intergenic
992481317 5:77154856-77154878 CCAAAGGAAGAATCCACTGCAGG - Intergenic
992559963 5:77941578-77941600 TCTGGGGAAGAATACCATGGAGG - Intergenic
992681937 5:79162259-79162281 TATGGGCAAGCATCCTCTGCTGG + Intronic
992875456 5:81050100-81050122 TCTGGGGTAGAATCCACAAGTGG - Intronic
994496476 5:100519023-100519045 TCTTGGGTTGAATCTACTGCTGG - Intergenic
994961079 5:106603637-106603659 CCTGGATAATAATCCACTGCAGG - Intergenic
995977191 5:118053574-118053596 GCTGGTGGAGAATACACTGCTGG + Intergenic
996118996 5:119649910-119649932 TCAGGGGAGGAAGCCACTCCTGG + Intergenic
996125878 5:119725311-119725333 TCTGGATCTGAATCCACTGCTGG - Intergenic
996398442 5:123035841-123035863 CCTGGGGCAGCCTCCACTGCGGG - Intronic
996544841 5:124667417-124667439 TCAGGGGATGAATGCAGTGCAGG - Intronic
997309961 5:132871689-132871711 TCTGTGGAAGGAACCACTGTTGG - Intergenic
998174478 5:139893529-139893551 TCTGGGGAAGGAGCTGCTGCAGG - Intronic
1001105895 5:168854314-168854336 TCTGGGTAAGAATACTTTGCAGG - Intronic
1010657083 6:78524323-78524345 TCTGTGGAAGAATGCATTGTGGG - Intergenic
1011511001 6:88100730-88100752 TCTGGGGAAGTATCCTCCGAAGG + Intergenic
1013556789 6:111264453-111264475 TACGGGAAAGAATCTACTGCAGG - Intronic
1013627151 6:111949802-111949824 TCTGGGGAAGAATTCATTTCAGG - Intergenic
1014013215 6:116500567-116500589 TCTAGAGAAGAATCCCCTGGTGG - Exonic
1015601200 6:134912540-134912562 TCTGGGGGAAAATCCAATGAAGG + Intergenic
1017273732 6:152540897-152540919 ACTGTGGAAGAATCCACTTTTGG - Intronic
1017522476 6:155214087-155214109 TCTGGGTCAGAAGCCACGGCTGG + Intronic
1018581034 6:165308511-165308533 TCTGGGGAAGAACCCCTTCCAGG - Intronic
1019269021 7:135528-135550 TGTGGGGAAGGACCCTCTGCAGG + Intergenic
1022340717 7:29464960-29464982 TCTGGGGATGAAAACACGGCTGG - Intronic
1026067678 7:67089422-67089444 GGTGCGGAAGACTCCACTGCAGG + Intronic
1026709247 7:72722909-72722931 GGTGTGGAAGACTCCACTGCAGG - Intronic
1026817765 7:73525529-73525551 TGTGGGCTAGAATCCATTGCTGG + Intergenic
1027953210 7:84846773-84846795 TCAAGGGAACAATCCTCTGCTGG - Intergenic
1032504821 7:132427023-132427045 TCTGGGGAAGAATCCCCTCCTGG - Intronic
1033623001 7:143078692-143078714 TCTTGGGTTGAATCCATTGCTGG - Intergenic
1034703230 7:153115529-153115551 TCTATGAAAGAAGCCACTGCAGG - Intergenic
1034950478 7:155293323-155293345 TCTGAGGATGAGTCCACTGTTGG + Intergenic
1036375506 8:8196037-8196059 TCTGGGAAAGCATGCTCTGCAGG + Intergenic
1036585360 8:10118624-10118646 ACTGGGGAAGAGTCAAATGCTGG - Intronic
1036854027 8:12227112-12227134 TCTGGGAAAGCATGCTCTGCAGG - Intergenic
1036875399 8:12469610-12469632 TCTGGGAAAGCATGCTCTGCAGG - Intergenic
1039666434 8:39536396-39536418 TTTGGAGAAGAATCCATTGGTGG - Intergenic
1042806663 8:72777895-72777917 TCTGAGGAAAAATCCAGTACTGG + Intronic
1044434459 8:92145920-92145942 AGTGGGCAAGAATCCACTGAGGG + Intergenic
1044454014 8:92370619-92370641 TCAGGGGATGAAACCACTGTAGG + Intergenic
1045188880 8:99864166-99864188 TCTGGGGAAGAATTAAATGGTGG - Intronic
1047156533 8:122325574-122325596 GCTGCGGAAGTATCCACTGTTGG - Intergenic
1047408897 8:124608212-124608234 TGTGGGGAAGAAAACAGTGCAGG - Intronic
1047782719 8:128123154-128123176 TCTGGGGCAGAAGCCTCTGTGGG - Intergenic
1048045367 8:130767739-130767761 TCTGAGGAAGTGTCCACTACTGG - Intergenic
1048286786 8:133147699-133147721 TCTGGGGAAGAATTCCCAGAAGG - Intergenic
1048777826 8:137967053-137967075 TCTGGGGAAGAATCTGCTTCAGG + Intergenic
1049296657 8:141844184-141844206 ACTGGGGAAGGATGCACTTCCGG + Intergenic
1049723957 8:144136887-144136909 TCTGGGGCAGACTCCAATACTGG + Intergenic
1050148903 9:2599522-2599544 TGTGAGGAAGAATCAAGTGCAGG - Intergenic
1051602856 9:18891984-18892006 TCTAGGAGAGAATCCACTTCTGG + Intronic
1052388631 9:27851896-27851918 TCTGGGGAACAATCATCTGAAGG + Intergenic
1052864553 9:33457091-33457113 TCAGGGGAAGAATCCAGGGGAGG + Intergenic
1057303746 9:93900884-93900906 TCTGAGGAAGTCTCCATTGCTGG - Intergenic
1058635953 9:107038848-107038870 TATGGGGAGGCAGCCACTGCTGG - Intergenic
1059530167 9:115028210-115028232 CCTAAGGAAAAATCCACTGCAGG + Intronic
1060665284 9:125428863-125428885 CCAGGGGAAGATTCCGCTGCTGG + Intergenic
1186953390 X:14653448-14653470 TCAGTGGAGGAATTCACTGCAGG + Intronic
1188220025 X:27530191-27530213 TCAGGGGAAGAACCAATTGCTGG + Intergenic
1190265013 X:48823058-48823080 TTTGGGGAAGAGTCCACTCCAGG + Exonic
1190415256 X:50174454-50174476 TTTGGGGAAGAATCCAAAACAGG + Intergenic
1193382756 X:80834748-80834770 TCTTGGTTTGAATCCACTGCAGG - Intergenic
1199991859 X:152991921-152991943 TTTGAGGAAGAACCCACAGCAGG - Exonic
1200408830 Y:2841851-2841873 TCCGGGTAAAAAGCCACTGCCGG - Intronic