ID: 1170212207

View in Genome Browser
Species Human (GRCh38)
Location 20:13856664-13856686
Sequence CTGTCTTTCAAAAAGGAAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 535
Summary {0: 1, 1: 0, 2: 3, 3: 55, 4: 476}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170212207 Original CRISPR CTGTCTTTCAAAAAGGAAGT TGG (reversed) Intronic
900510947 1:3060829-3060851 CTGTGTTTGGAAAAGGAAGCTGG - Intergenic
903063779 1:20687156-20687178 CTGTAATTCAATAAGAAAGTTGG - Intronic
903396546 1:23006004-23006026 CTGTCTCAAAAAAAGGGAGTTGG + Intergenic
903717385 1:25377896-25377918 CTCTGTTTCAAAAAGAAAGAAGG + Intronic
904096024 1:27978069-27978091 CTGTCTTTGAAGATGGAAGATGG + Intronic
904249746 1:29214661-29214683 CTTGCTTTAAAAAAAGAAGTTGG - Intronic
905172685 1:36118468-36118490 CTGTCTTACAAATAGGAAGCTGG + Intronic
905619867 1:39435350-39435372 CTGACTTTCAAAAATTAAATTGG + Intronic
905826825 1:41032063-41032085 CTGTCTATGAACCAGGAAGTGGG + Intronic
905992435 1:42350295-42350317 CTGGCTTTGAAGATGGAAGTGGG - Intergenic
906028961 1:42701414-42701436 CATTATTTCAAAAAGGAAGTGGG + Intronic
906818889 1:48908112-48908134 CTGTCTTCCCAAAAGGAACAGGG - Intronic
907848423 1:58230509-58230531 CTGTCGTTCAATAAGGACTTGGG - Intronic
907958786 1:59258206-59258228 CTGTTTATCAAAAAGCAAATAGG + Intergenic
908784395 1:67720866-67720888 CTGTCTTTAAAAATAGAAATGGG + Intronic
908810362 1:67975961-67975983 CTGCCTTTCAAAATGGAACCAGG - Intergenic
908901107 1:68957573-68957595 CTGTCTATGAACAAGGAAGTAGG + Intergenic
909147455 1:71954704-71954726 CTGACTTCCAAAAAGGAAATTGG + Intronic
909654838 1:78020149-78020171 CTGTCTCAAAAAAAGGAAGCTGG + Intronic
909658304 1:78055137-78055159 CTGTCTATGAACCAGGAAGTGGG - Intronic
911351233 1:96758359-96758381 CTGTCTTTGAAAATGGAGGAGGG + Intronic
911366898 1:96949510-96949532 CTGTCTATGAATCAGGAAGTGGG - Intergenic
913088649 1:115461013-115461035 ATGTCTTTTAAAATGGAAGGAGG - Intergenic
913341297 1:117760277-117760299 CTCTCTTAAAAAAAGCAAGTGGG - Intergenic
914887051 1:151594003-151594025 CTGTCTTTTAATAAGGGTGTGGG + Intergenic
915323313 1:155067923-155067945 CTGTCTCTTAAAAAAGAAGTGGG - Intronic
915328717 1:155095178-155095200 ATATCTTTCAAATAGGAAGATGG - Intergenic
915340952 1:155176303-155176325 GTGGGTTTCCAAAAGGAAGTGGG + Intronic
916150036 1:161778674-161778696 TTTGCTTTTAAAAAGGAAGTTGG + Intronic
916764166 1:167844328-167844350 CTGTTTTCCAAAAAGGGAGATGG + Intronic
918193966 1:182204257-182204279 GTGTCTTTCAAAATGGAACCTGG + Intergenic
918713561 1:187761867-187761889 CTGTGTTTCAAAAAAAAAGAAGG + Intergenic
918977885 1:191513862-191513884 CTGTCTATAAGACAGGAAGTGGG + Intergenic
920124886 1:203686294-203686316 CTGTCTCACAAACAGGAACTCGG + Intronic
920189960 1:204187419-204187441 ATGTCTTTTAAAATGGAAGATGG + Intergenic
920603675 1:207357439-207357461 CAGTATTTCAAAAGGAAAGTTGG - Intronic
920732217 1:208497685-208497707 CTTTATTTCAAAATGGAAATGGG - Intergenic
921605065 1:217142026-217142048 CTGTCTTTCTCAAAGGAAGTAGG + Intergenic
922138154 1:222853127-222853149 CTGTGTTTTAATAATGAAGTTGG + Intergenic
922936573 1:229427292-229427314 CTGTCTTAAAAAAAGGATGGGGG + Intergenic
923737462 1:236624277-236624299 CTGTCTCCGAAAAAGGAAATAGG + Intergenic
923846476 1:237738578-237738600 CTGACTTTTAAAAGGGCAGTAGG + Intronic
924261510 1:242236147-242236169 CTGTCTATGAACAAGGAAGTGGG + Intronic
924607345 1:245546349-245546371 CTGTTTTTAAAAAAGGTACTCGG + Intronic
924657945 1:245990438-245990460 CTGTGTGACCAAAAGGAAGTAGG - Intronic
1062802010 10:387767-387789 CTGGATTTCAAGAAGGACGTCGG - Exonic
1062863680 10:831109-831131 CTCTCTTCCAAAAAGGATGAGGG + Intronic
1063774514 10:9246133-9246155 CTGTCTTTCAAGAAGAAGGCAGG + Intergenic
1064471648 10:15641567-15641589 CTGTCTCTCAAATAGGAATATGG - Intronic
1065177025 10:23087623-23087645 CTGACTTTTAAAAAGACAGTGGG + Intergenic
1065387974 10:25152486-25152508 CTGTCTATGAACAAAGAAGTGGG - Intergenic
1066280239 10:33910159-33910181 CTTTCTATCAAAAAGAAACTTGG - Intergenic
1067131291 10:43567826-43567848 TTTTGTGTCAAAAAGGAAGTAGG + Intronic
1067165735 10:43865129-43865151 TTGTTTTTCAATAAGGAAGATGG - Intergenic
1067537320 10:47122894-47122916 CTGTCTATGAAAAAGGAGGCAGG + Intergenic
1068026268 10:51649196-51649218 CTGGTTTTGAAAAAGAAAGTAGG - Intronic
1068506676 10:57908850-57908872 CTGTCATGTAAATAGGAAGTGGG - Intergenic
1069382116 10:67851914-67851936 CTGTCTCAAAAAAAGGAAGAAGG + Intergenic
1070886087 10:79901168-79901190 CTCTCTTTCAATAAGGGAGAAGG - Intergenic
1071024404 10:81095070-81095092 CTGTCTTTCAAAAATGAGAGAGG - Intergenic
1071054642 10:81494921-81494943 CTGTCTTCCCCAAAAGAAGTCGG - Intergenic
1071240159 10:83696518-83696540 CTTTCTTCCAAAATGGGAGTTGG - Intergenic
1071790951 10:88953370-88953392 ATGTCTTACAAAGAGGAATTTGG + Intronic
1071865602 10:89727256-89727278 CTGTCTTTAAAAAAAAAAGGGGG - Intronic
1072484853 10:95845346-95845368 CTGTCTTTCAGAAAACAAGGTGG + Exonic
1072984410 10:100127497-100127519 ATCTCTTTAAAAAAGGAGGTAGG - Intergenic
1073707955 10:106007837-106007859 CTATCCTTCAAAAACGAAGAGGG - Intergenic
1074416321 10:113270011-113270033 TTTTTTTTAAAAAAGGAAGTTGG + Intergenic
1075143627 10:119864116-119864138 TTGTCTTTGAAAACGGAAGGGGG + Intronic
1075429086 10:122365516-122365538 CTGGCTTTCAGAAGGGAGGTTGG - Intergenic
1078221697 11:9356675-9356697 CTGTTTTTAAAAAAGGAGGGAGG + Intergenic
1078349864 11:10583724-10583746 CAGTCTTTGCAAAAGGAAATAGG + Intronic
1078393784 11:10959688-10959710 CTATCCTTCAGAAATGAAGTAGG + Intergenic
1078520605 11:12060080-12060102 CTTTCTTTCCAATAAGAAGTTGG + Intergenic
1079800121 11:24858882-24858904 CTGGATTTCAAAATGGAGGTGGG - Intronic
1080148582 11:29020703-29020725 GTGTTTTTTCAAAAGGAAGTGGG - Intergenic
1081005743 11:37735898-37735920 CTGTCTTTAAGGAAGAAAGTAGG - Intergenic
1081307390 11:41530233-41530255 GAGTGTTTCAAGAAGGAAGTAGG + Intergenic
1081636299 11:44724568-44724590 CTTCCTTTCAAAGAGAAAGTGGG + Intergenic
1082045648 11:47724230-47724252 CTGTCTCAAAAAAAGGAGGTGGG - Intronic
1082874628 11:57975419-57975441 CTTTTTCTAAAAAAGGAAGTGGG - Intergenic
1082991012 11:59207194-59207216 CAGACTTTCAAAATGGAATTAGG + Exonic
1083516378 11:63262669-63262691 CTGTCTTTTAAAAAAAATGTTGG + Intronic
1083549553 11:63576281-63576303 CAGTCTGTCAAAAAAAAAGTGGG - Intronic
1083847854 11:65346438-65346460 CTTTCTTTTAAAAAGGGAGCAGG + Intronic
1084376624 11:68782602-68782624 GGGTCTTCCAAGAAGGAAGTGGG - Intronic
1085181053 11:74536669-74536691 CTGTCTTTCAGAAATGAAGGTGG - Intronic
1085364952 11:75932084-75932106 ATGTCATTCAAAAAGAAGGTTGG - Intronic
1085456595 11:76668970-76668992 CTCTCTCTCAAAAAGGAGGACGG + Intronic
1085525549 11:77161549-77161571 CTGACTTTCCAGCAGGAAGTGGG - Intronic
1086372273 11:86166834-86166856 TTCTTTTTCAAAAAGGAAGAAGG + Intergenic
1086596912 11:88583532-88583554 CTGTCTTTCAAGAAGTAACCAGG - Intronic
1086971788 11:93089398-93089420 CTATTTTTCAAGAAGGAAATCGG - Intergenic
1087192772 11:95273198-95273220 CTGTCTTTCAAACAGTATGTTGG - Intergenic
1087374917 11:97327702-97327724 CTGGCTTTCAATAAGGAAGAAGG - Intergenic
1087621561 11:100548861-100548883 CTGTCTGTAAACAAGGAAGGGGG - Intergenic
1089573291 11:119423644-119423666 CAGTCTTTCTGAAAGGAAGCTGG + Exonic
1090018636 11:123107663-123107685 CTGTCTTTCAAAATGCAACACGG - Intronic
1090310139 11:125729332-125729354 CTGCCTGTCTAAAAGAAAGTTGG + Intergenic
1091083168 11:132692251-132692273 CTGTTGTTCACAAAGAAAGTGGG + Intronic
1091194185 11:133717909-133717931 CTGTCTGTGAACCAGGAAGTGGG - Intergenic
1091424803 12:378271-378293 CTGTCTTTAAAAAAAAAAGGGGG - Intronic
1091592821 12:1855375-1855397 CTTTCTTCCAAAGAGGAAGAAGG + Intronic
1092372504 12:7928827-7928849 CTGTCTTTAAAAAAAAAACTTGG - Intronic
1092742593 12:11644490-11644512 ATTTCTTCCAAGAAGGAAGTTGG - Intergenic
1093278444 12:17158964-17158986 CTGGCATTCAAAAAGGAAGTTGG + Intergenic
1094156543 12:27343264-27343286 CTTTTTTTAAAAAAGGAAGCAGG - Intronic
1094479531 12:30870636-30870658 CTGTCTTGCAGGAAGCAAGTTGG - Intergenic
1095505064 12:42887975-42887997 CTGTCATTCAAAATGGATGCTGG + Intergenic
1096090031 12:48892948-48892970 CTGTCTTTAAAAAAAGAAAGTGG - Intergenic
1096199333 12:49670511-49670533 CTATAGCTCAAAAAGGAAGTAGG + Intronic
1096923498 12:55115789-55115811 CTTTTTTTCAGACAGGAAGTGGG - Intergenic
1097061645 12:56289229-56289251 CTTTCTTTCACAAAAAAAGTGGG + Intronic
1097275690 12:57811993-57812015 CTGTCTTTAAAAAAAAAGGTGGG - Intronic
1097804703 12:63952507-63952529 CTGTCTCTTAAAAAGAAAGAAGG + Intronic
1097966627 12:65588691-65588713 CTGTTTCTCAAAAAAAAAGTGGG - Intergenic
1098345906 12:69503237-69503259 CTGGCTTTCAAAATGGAGGGGGG - Intronic
1098409626 12:70167139-70167161 CTGTTTTTTAAACAGGAAGCAGG + Intergenic
1099015268 12:77336714-77336736 CTGACTTTGAAAATGGAAGAAGG + Intergenic
1099167635 12:79325974-79325996 CTGTATTTTAAAGAGGTAGTAGG - Intronic
1099343127 12:81464088-81464110 CTGTCTTTAAAAAAGGACAGGGG + Intronic
1099727747 12:86455269-86455291 CTGTCTTTCCAAAAGGCAATGGG + Intronic
1099946216 12:89247701-89247723 CTGTTTTTCCAACAGGAAGAAGG - Intergenic
1100272920 12:93043540-93043562 CTGTCTCAAAAAAAGGAAGGAGG - Intergenic
1100814078 12:98368744-98368766 CTGTCTTTCCAAAGCCAAGTGGG - Intergenic
1101164700 12:102016529-102016551 TTTTTTTTCAAAAAGTAAGTAGG - Intronic
1101508036 12:105365451-105365473 CTGTCTGTCACACAGGGAGTGGG + Intronic
1102674803 12:114650133-114650155 CTGCCATTCAACAAGAAAGTGGG + Intergenic
1103030716 12:117609980-117610002 CTTTTGTGCAAAAAGGAAGTTGG - Intronic
1103270446 12:119668933-119668955 CCGTCTTTTAAAAAATAAGTAGG - Intronic
1103503780 12:121426448-121426470 CTGTCTTTAAAAAAAAAAGGGGG - Intronic
1103954603 12:124569034-124569056 ATGTCTGGCAAAAGGGAAGTGGG + Intergenic
1104059582 12:125256238-125256260 CAGTCTCTAAAAAAGGGAGTGGG + Intronic
1104460903 12:128955006-128955028 ATCTCTTTCAAAAGGGTAGTGGG - Intronic
1105064774 12:133186889-133186911 TTGTGTTACAAAAAAGAAGTGGG - Intronic
1106477074 13:30108140-30108162 TTTTTTTTAAAAAAGGAAGTGGG + Intergenic
1107074217 13:36304014-36304036 CTGTCTTTCAGAAGGCAAATAGG - Exonic
1107183151 13:37485572-37485594 ATCTCTGTCAAAAAAGAAGTAGG + Intergenic
1107207720 13:37814797-37814819 ATTTCTTTTAAAAAGTAAGTTGG - Intronic
1107260816 13:38488924-38488946 CTTTGTTTCTAAAAGGATGTAGG - Intergenic
1107345420 13:39455041-39455063 CTGTCTTTCAATCAGAAAATGGG + Intronic
1107735850 13:43397948-43397970 CTGTCTTTGAACCAGAAAGTGGG - Intronic
1109980767 13:69903276-69903298 ATTTCTTTCAAAAGGCAAGTGGG - Intronic
1110013763 13:70372759-70372781 CTGTGTTTTAAAAAGAAAATTGG - Intergenic
1110242964 13:73289040-73289062 TTATCTTTCAATAAGAAAGTTGG + Intergenic
1110407217 13:75164272-75164294 CTGTATATCAAAAAGTAAATAGG + Intergenic
1110428161 13:75392638-75392660 CTGTCTCTTAAAAAAGAAGAAGG - Intronic
1110567444 13:76970498-76970520 CTGTCTCAAAAAAAGGAGGTGGG + Intergenic
1110709145 13:78630700-78630722 CTGTCTATGAAGCAGGAAGTGGG + Intronic
1111151964 13:84264610-84264632 GTTTCTTTCAAAATTGAAGTTGG - Intergenic
1112191356 13:97181024-97181046 CTGGCTTTCAAGATGGAAGAAGG - Intergenic
1112587632 13:100733609-100733631 CTATCTTTTAAAATTGAAGTCGG - Intergenic
1114726514 14:24943274-24943296 TTGCCTTTCAGAAAGGAAGAAGG - Intronic
1115925533 14:38429095-38429117 CTATCTTTAAAAAAATAAGTGGG - Intergenic
1115989042 14:39132522-39132544 CTCTGTCTCAAAAAAGAAGTAGG + Intronic
1119924894 14:78484329-78484351 CTGCCTCTCAAAAGGGTAGTAGG - Intronic
1119951042 14:78745397-78745419 GTGTCAATCAAAAAGGGAGTTGG - Intronic
1120229889 14:81830279-81830301 CTGGCTTTCAAAGTGGAAGCTGG + Intergenic
1121853811 14:97248097-97248119 CTGTTCTTCCAAAAGGAAATAGG - Intergenic
1121988779 14:98534018-98534040 CTGACTTTCAAAATGGAAGAAGG - Intergenic
1123815727 15:23976814-23976836 CTGTCTTATAAAAAAAAAGTTGG - Intergenic
1123853583 15:24384287-24384309 CTGATTTTCAAAAAGGATGAAGG + Intergenic
1123990827 15:25682110-25682132 ATGTCTCTCAAGTAGGAAGTAGG + Intronic
1124016023 15:25876720-25876742 CTGTCTTTCTAAAATGGAGATGG - Intergenic
1124898052 15:33795840-33795862 CTCTCTTTCTAAAAGGCAATCGG + Intronic
1124948985 15:34298677-34298699 CTGTCATTCACAGAGAAAGTGGG + Intronic
1126371684 15:47953770-47953792 CTGGCTTTGAAAATGGAAGGAGG - Intergenic
1127303550 15:57681043-57681065 CGATCTTTTAAAAAAGAAGTGGG - Intronic
1127917605 15:63468084-63468106 CTTTCTTTTAAGAAGGAAATAGG - Intergenic
1129148878 15:73674387-73674409 CGGTATTTAACAAAGGAAGTTGG - Intergenic
1129311460 15:74712856-74712878 CTGTCTACCAAAAAGAAAGGGGG + Intergenic
1130138332 15:81200073-81200095 TTGTTTTAGAAAAAGGAAGTTGG - Intronic
1130687448 15:86051297-86051319 CTGTCTTTGAACCAGAAAGTGGG - Intergenic
1130763492 15:86845953-86845975 CTTTCTTTCAAGAGGGAAGAAGG - Intronic
1130867520 15:87945238-87945260 CTGTCTCACAAAAAGGAATTAGG - Intronic
1131791925 15:95974266-95974288 CTGTCTTGCAAGGAGGAGGTAGG + Intergenic
1131815683 15:96218773-96218795 CTGACTTTTATAAAGGAAGGAGG + Intergenic
1132160674 15:99538565-99538587 CTTTCTTCTAAAAAGGAAATGGG - Intergenic
1132320535 15:100921472-100921494 TTTTGTTTCAAAAAGGAACTAGG + Intronic
1133647785 16:7780634-7780656 ATGTCCTTAAAAAAGGAAGAAGG - Intergenic
1134139717 16:11707451-11707473 CTGTCTTTAAAAAAAAAAATTGG - Intronic
1134483648 16:14639552-14639574 CTGTCTACCAAAATGGAGGTGGG - Intronic
1135914714 16:26595525-26595547 CTGTCTCAAAAAAAGAAAGTGGG - Intergenic
1136038437 16:27559087-27559109 CTCTCTTTCCAAATGGGAGTAGG + Intronic
1136097848 16:27971168-27971190 ATTTCTTTAAAAAAGCAAGTTGG + Intronic
1136364687 16:29804467-29804489 CTGTCTTTCAAAAAGTACATGGG - Intronic
1136493254 16:30624752-30624774 CTGTCTTAAAAAAAAGAAATGGG - Intergenic
1137793908 16:51198715-51198737 CTATGTTCCAAAAAGGAACTCGG - Intergenic
1137795457 16:51213839-51213861 CTCACTTTTAAAAAGGCAGTGGG + Intergenic
1137846984 16:51699578-51699600 ATGGTTTTCAAAAAGGAAATGGG - Intergenic
1138060415 16:53884266-53884288 CTATCTTTAAAAAGGAAAGTGGG - Intronic
1138292106 16:55856522-55856544 CTGACTTTCACAGGGGAAGTTGG + Intronic
1138807997 16:60114420-60114442 CTGTCTTTACAAAATGAAATTGG + Intergenic
1139578063 16:67854936-67854958 CTGTCTTTAAAAAAAAAAGTTGG + Intronic
1140301568 16:73762994-73763016 ATTTTTTTTAAAAAGGAAGTGGG + Intergenic
1141061195 16:80872707-80872729 CTGTATTTTAAAAAGGAAAAGGG + Intergenic
1142519551 17:495195-495217 CTGTTTTTCAAAAAGCATTTTGG - Intergenic
1144442489 17:15295946-15295968 ATGTCTTTCAAAATAGAGGTTGG - Intergenic
1144721463 17:17473392-17473414 ATGTATTTGAAAAAGGAACTGGG - Intergenic
1145216670 17:21057643-21057665 CTGTGTCTCAGAAAGAAAGTGGG + Intergenic
1146566074 17:33914262-33914284 CTGTCTTTCATTACGAAAGTTGG + Intronic
1146704231 17:34988784-34988806 GGCTCTTTCAACAAGGAAGTGGG + Intronic
1147151007 17:38513809-38513831 CTCTCCTTCAAAAATAAAGTAGG + Intergenic
1148141570 17:45332977-45332999 CTGCCTTACAAAAGGGTAGTGGG - Intergenic
1148710252 17:49675280-49675302 CCATCTTTCAAAAAGGAAGAGGG + Intronic
1150189405 17:63222114-63222136 CTGTCTACGAAACAGGAAGTTGG - Intronic
1151025618 17:70672829-70672851 CTGTCTGTCAAATAGAAAGCAGG + Intergenic
1151158118 17:72141658-72141680 CTGACACTCAAGAAGGAAGTAGG + Intergenic
1151400098 17:73850384-73850406 CTGACTTTCAGGATGGAAGTGGG - Intergenic
1152613309 17:81326336-81326358 CTGTCTTTTAAAAAGAAAAAAGG + Intronic
1153619656 18:6965344-6965366 CTGTCTGTCAAAAGGGTAATGGG + Exonic
1155900211 18:31380253-31380275 GTATCTTTCAAAAAGGAAAAGGG - Intronic
1158167380 18:54555641-54555663 CAGTCATTCCAAAAGGAAGGAGG + Intergenic
1158267198 18:55672854-55672876 CTATCTTTCATAAAGGAAAGGGG + Intergenic
1158409650 18:57194145-57194167 TTATTTTTTAAAAAGGAAGTAGG - Intergenic
1158430846 18:57385953-57385975 ATGTCTTACTTAAAGGAAGTGGG - Intergenic
1158474391 18:57767083-57767105 AGGTCTATCAAAAAGGACGTTGG + Intronic
1158862587 18:61607058-61607080 CTGGCATTCCCAAAGGAAGTGGG + Intergenic
1160223575 18:76994712-76994734 ATGTCTATGAAAAAGGCAGTTGG + Intronic
1161032729 19:2065893-2065915 CTCTGTCTCAAAAAGTAAGTAGG + Intergenic
1162559629 19:11408872-11408894 TTGTCTTTAAGAAAGGAAGAAGG + Intronic
1163293369 19:16395306-16395328 CAGTCTTTCAATGAGAAAGTGGG + Intronic
1165450676 19:35880350-35880372 CTGTCTTAAAAAAAGGGAGGTGG - Intergenic
1166109019 19:40611574-40611596 GTATCTTTCAAAAAGGGAGGAGG - Intronic
1166308741 19:41950407-41950429 CTGTCTTTAAAAAAGAAAATGGG - Intergenic
1167065470 19:47182556-47182578 CAGTCATTCAGAAAGGAAGAAGG + Intronic
1167392655 19:49206395-49206417 ATGTCTGTCAAAAAGGTTGTTGG + Intronic
925634822 2:5933056-5933078 TTGCTTTTCAAAAAGGAATTAGG - Intergenic
925774698 2:7323340-7323362 CAGTGTTTGAAAAAGGAAGAAGG - Intergenic
926041750 2:9679257-9679279 CTGTCTATGAACCAGGAAGTGGG + Intergenic
926827044 2:16915724-16915746 ATGTTTTTTAAAAAGGAAGGAGG - Intergenic
927305359 2:21565424-21565446 CTGTCTTTGGAAAAGGAAGCAGG - Intergenic
927536180 2:23861180-23861202 CAGTATTGCAAAAAGGAGGTAGG + Intronic
928647814 2:33373516-33373538 CTACCTTTCTCAAAGGAAGTTGG - Intronic
929582713 2:43093218-43093240 CTTCCTTTCAGAAAGGTAGTAGG + Intergenic
929677163 2:43947722-43947744 TAGACTTTCAAAAAGTAAGTAGG - Exonic
929679627 2:43978770-43978792 CTATCCTTCAAAAAGTGAGTAGG - Intronic
929835572 2:45394070-45394092 CTTTCTTCCAAAATGGAAGCAGG + Intronic
930157728 2:48122996-48123018 CTGTCTATGAACTAGGAAGTGGG + Intergenic
930929541 2:56863836-56863858 ATATCTTTCAAAAATGAGGTTGG - Intergenic
931010976 2:57912988-57913010 CTGTCTATGAACCAGGAAGTGGG + Intronic
931593362 2:63911161-63911183 CTGTATATCAAAAAGGAAACTGG + Intronic
932045365 2:68343575-68343597 CTGTCTTTCAAAACTGTAATTGG - Intergenic
932997690 2:76876662-76876684 CTGTCATTTATAAAGAAAGTAGG - Intronic
933866593 2:86523712-86523734 CTTTCTTTAAAAAGAGAAGTGGG + Intronic
933996137 2:87671444-87671466 CTGTCTATGAACCAGGAAGTGGG - Intergenic
936297718 2:111279468-111279490 CTGTCTATGAACCAGGAAGTGGG + Intergenic
936727532 2:115338679-115338701 ATGCTTTTCAAAAATGAAGTTGG + Intronic
936783200 2:116059417-116059439 CTGTCTTTCTTAAATGAGGTTGG + Intergenic
937481952 2:122270920-122270942 CTTGCTTTCAAAGAGGAAATTGG + Intergenic
938668940 2:133568542-133568564 CTGACTGTCAAAAAGAAAGGAGG + Intergenic
938866266 2:135424055-135424077 CTCTGTTTAAAAAAGCAAGTCGG + Intronic
940290180 2:152070649-152070671 TTGGCTAGCAAAAAGGAAGTTGG + Intronic
940372772 2:152921367-152921389 CTGTCTGTAAACCAGGAAGTAGG - Intergenic
941101818 2:161305132-161305154 CTATCCTTCAAAAATGAAGGCGG - Intergenic
941543908 2:166821277-166821299 GTGTGTTTGAAAAAGGAAGTGGG + Intergenic
941744058 2:169067578-169067600 CTTTGTTTTAAAAAGGAACTAGG + Intronic
942003636 2:171675846-171675868 CTGTCATACACAAAGGAAGCTGG + Intergenic
942856042 2:180549837-180549859 CTGGCTTTGAAGAAGGAAGATGG - Intergenic
942960054 2:181819574-181819596 CTTTTTTTCCAAAAGGAATTAGG - Intergenic
943471423 2:188299055-188299077 CTGTCTTTAAAATAGCCAGTTGG - Intronic
944038009 2:195320365-195320387 CAGTCCTTTGAAAAGGAAGTTGG - Intergenic
944738673 2:202590764-202590786 CTGTCTTTTAAAAAATAAATAGG - Intergenic
945209325 2:207366036-207366058 CTGGCATTTTAAAAGGAAGTTGG + Intergenic
945258451 2:207822262-207822284 CTGTTTTCCAAATAAGAAGTGGG - Intergenic
945340831 2:208651683-208651705 CTGTCTTTTAAAATGGAATAGGG + Intronic
946656664 2:221955859-221955881 CTGTCTTTCAGAATGGAATTAGG - Intergenic
947154005 2:227142814-227142836 TTGTTTTTCAAAAAAGAAGATGG - Intronic
947499782 2:230663606-230663628 CTGTCTTCCAAAAAGTTAGAAGG + Intergenic
947614829 2:231549143-231549165 CTGTATTCCAGAAAGGAAGTAGG - Intergenic
947919936 2:233861297-233861319 CTGTCTCTTAAAAAGTAAATTGG + Intergenic
948242856 2:236452834-236452856 ATTTTTTTAAAAAAGGAAGTTGG - Intronic
1169032354 20:2419614-2419636 CTGTTTTTCAAAAAGCAAACAGG - Intronic
1169152396 20:3299906-3299928 CTGTGTCTCAAAAAAGAAATAGG - Intronic
1170212207 20:13856664-13856686 CTGTCTTTCAAAAAGGAAGTTGG - Intronic
1171565890 20:26186565-26186587 CTGTGCTTCAAAAAGAATGTAGG + Intergenic
1172104833 20:32510730-32510752 CTGTCTTTCAAAGAAGGACTAGG - Intronic
1172168395 20:32913274-32913296 CTGTCTATGAATCAGGAAGTAGG - Intronic
1172205016 20:33157112-33157134 CTTTCTTTCAATAAGAATGTTGG + Intergenic
1173520414 20:43695793-43695815 CTGTCTTTGAAAAAGCAAACAGG + Intronic
1175985058 20:62760480-62760502 CTGGCTTTCAAAGAGGAGATGGG - Exonic
1176216269 20:63949418-63949440 CTGTCAGTCAAGAAGGAAGACGG + Intronic
1177036130 21:16045307-16045329 CTGTTTTGCCAAAAGGAGGTTGG - Intergenic
1177491182 21:21828347-21828369 CTGAATTCCAAAAAGGAGGTGGG + Intergenic
1177502952 21:21982642-21982664 CTGAGTTTCAAACAGGGAGTTGG + Intergenic
1177768084 21:25481646-25481668 CTATCTTTCAAAAATGAAGGAGG + Intergenic
1178994400 21:37385472-37385494 CTGGCTTTGCAAAAGTAAGTGGG - Intronic
1179224223 21:39439195-39439217 CTGGCTTTCAAGATGGAAGAAGG + Intronic
1181913398 22:26258582-26258604 CTGTGTTTAAATGAGGAAGTTGG + Intronic
1184311362 22:43646144-43646166 CTGTCGTTCAAAGGGTAAGTGGG + Intronic
1184453896 22:44598376-44598398 CTGTTTTACAGCAAGGAAGTTGG - Intergenic
1185201263 22:49506987-49507009 CTGTCTCATAAAAAGGAAGAAGG + Intronic
949154869 3:815752-815774 CTGTGTTTCAAAATGAAAGATGG - Intergenic
949564912 3:5235615-5235637 CTGTCTTTTACAAAGGGAATAGG + Intergenic
950736963 3:15017121-15017143 TTGTTTTTTAAAAAGGAGGTTGG + Intronic
951506628 3:23453394-23453416 CTGTTTTTTAAAAAGAAAGTTGG + Intronic
951966249 3:28388960-28388982 CTGACTTCCAAAAAGAAACTGGG - Intronic
953075177 3:39563153-39563175 TTGGCTTACAAAAAGGTAGTGGG - Intergenic
953581169 3:44157933-44157955 CTGACTTTGAAAATGGAAGGTGG + Intergenic
954525943 3:51271382-51271404 CTGTCTATGAACCAGGAAGTGGG - Intronic
955505198 3:59625748-59625770 CTATCTATGAACAAGGAAGTGGG - Intergenic
955808184 3:62758472-62758494 CAGTCTGACAAAGAGGAAGTGGG + Intronic
956162735 3:66372119-66372141 CTGTGTTTCAAATAGCAATTGGG + Intronic
956775353 3:72560827-72560849 CTGTTTTTCAGAAAGCTAGTAGG - Intergenic
958420353 3:93923589-93923611 CTGTATTTTAAAAGGGCAGTGGG - Intronic
958718474 3:97816545-97816567 AGGTCTTTCAAAATGAAAGTGGG + Intergenic
959029522 3:101281818-101281840 CTGTCTTTGAAGATGGAAGTGGG + Intronic
959266572 3:104147718-104147740 TTGTCTTGCAAAAGGGAAATTGG + Intergenic
960206835 3:114912177-114912199 CTGTCCTTCAAAAATGAAGGAGG + Intronic
960288540 3:115856703-115856725 CTGTCTCTGAATCAGGAAGTGGG + Intronic
960748520 3:120918110-120918132 CTGGCTTTGAAAATGGAAGGGGG - Intronic
962225133 3:133599689-133599711 CTGCCTTTCAAAAAGTCATTTGG + Intronic
963396144 3:144737263-144737285 CTGTGTTTCAGAAAAGAAGCAGG + Intergenic
963459868 3:145597930-145597952 CTATCTTTCAAAAATGAAGAGGG - Intergenic
963982142 3:151550638-151550660 CTGATTTTTAAAAAAGAAGTTGG + Intergenic
964172466 3:153787255-153787277 CAGCCTTTCAAAAAAGAATTAGG + Intergenic
966078599 3:175970514-175970536 GTGTCTTTAAAAAATGAAGGCGG + Intergenic
966314253 3:178627454-178627476 TTTTCTTTCAAAAAAGAACTGGG - Intronic
967133631 3:186495042-186495064 CTGTTTTTCAATAAGGAAAGAGG - Intergenic
967431373 3:189389887-189389909 CTGTCTACCTAGAAGGAAGTAGG + Intergenic
967841990 3:194013073-194013095 TCGTCTTTCACAAAGGAAATGGG - Intergenic
970462796 4:16292409-16292431 CTGTTTATCAATGAGGAAGTGGG + Intergenic
970467889 4:16345969-16345991 CTGTCTTTGAAGATGGAAGAAGG - Intergenic
970501611 4:16682923-16682945 CTGTATGTCAAAATGAAAGTGGG - Intronic
972029367 4:34433541-34433563 CTGTGCTTCAAAAAGAATGTAGG + Intergenic
972501681 4:39683743-39683765 CTGTCTTTAAAAAAGAAAAATGG - Intergenic
972575403 4:40346502-40346524 CTCTCTTGCACCAAGGAAGTAGG + Intronic
972575658 4:40348995-40349017 CTGGTTGTCAAAAGGGAAGTAGG - Exonic
972793775 4:42397447-42397469 GCGTCTTTTAAAAAGGAAGAGGG - Intergenic
973597806 4:52510617-52510639 CTGTTTTTTAAATAGGAAGGGGG + Intergenic
974188965 4:58477938-58477960 CTGTCTTTTAAGAAGCAAGCTGG + Intergenic
974258475 4:59493083-59493105 ATTTCTTTCAAAAAGGAATTAGG - Intergenic
974331285 4:60482255-60482277 CAGTCTATCAACCAGGAAGTGGG + Intergenic
974408195 4:61503995-61504017 CTGTCTTACAAAAAGGGGGTTGG - Intronic
974941927 4:68479791-68479813 CTGTTTTTAAAAAAGGAATCAGG - Intronic
975394162 4:73855576-73855598 CTGTCTTTCACACAGGAAAGTGG + Intergenic
975455338 4:74583908-74583930 ATGTTTTTCTAAATGGAAGTAGG - Intergenic
975971931 4:80050017-80050039 CTGTCTTTCGCAATGGAACTAGG - Intronic
976426010 4:84904130-84904152 CTGTCTGTGAACCAGGAAGTGGG + Intronic
977430765 4:96928202-96928224 CTGTCTCTCAAAAAGAGAGTAGG - Intergenic
977441980 4:97079417-97079439 CTGGCTTTGAAAATGGAAGAAGG - Intergenic
977808073 4:101326129-101326151 CTGTCTCCAAAAAAGGAAGGAGG + Intronic
977856151 4:101896802-101896824 ATGTGCTTCAAAAAGGAAGTGGG + Intronic
977861496 4:101966241-101966263 CTATTTTGCAAAAAGGAAGAAGG - Intronic
978352413 4:107833895-107833917 CTGGCTTTGAAAATGGAAGGAGG + Intronic
979043211 4:115826979-115827001 CTGGCTTTGAAAATGGAAGAAGG - Intergenic
979735994 4:124085180-124085202 TTCTCTTTCAAAAAGTAATTAGG + Intergenic
980234552 4:130089062-130089084 CTATCTTCCAAAAAGGCATTTGG - Intergenic
982063277 4:151625710-151625732 TTTTCTTTTAAAAAGGAGGTGGG - Intronic
982495261 4:156083431-156083453 CTGTCTTGCAAAAAGGGAAGTGG + Intergenic
983383706 4:167029720-167029742 CTGTTCTTCAATAAGGATGTAGG + Intronic
983771729 4:171558266-171558288 CTGTCTCTCAAGAAGAGAGTAGG + Intergenic
984214797 4:176897203-176897225 CTGTGTTTCAAAACGTAATTTGG - Intergenic
984543487 4:181070484-181070506 CTGTCTGTCAACTGGGAAGTGGG - Intergenic
984790840 4:183613108-183613130 ATGTCTTTCAAAGAGGAGTTAGG - Intergenic
985020866 4:185688689-185688711 CTGTGTTTACAAAATGAAGTAGG - Intronic
985340643 4:188949225-188949247 CTCTGTTTTAAAAAGGAAGTAGG + Intergenic
986316054 5:6587015-6587037 CTTGCTTTCAAAAGGGAAGGAGG + Intergenic
986987192 5:13513359-13513381 CTGGCTTTGAAAATGGAAGCAGG + Intergenic
987102928 5:14608348-14608370 CTGTCTATAAAACAGGAAGAGGG - Intronic
987466725 5:18280585-18280607 CTTACTTTCTAAAAGGAAATGGG + Intergenic
987943424 5:24572309-24572331 GTCTGTTTTAAAAAGGAAGTGGG - Intronic
988569851 5:32353517-32353539 CTGTCTTTAAAAAAAAAAGGAGG - Intergenic
988791327 5:34610533-34610555 CTGCTTGTCAAAAAGGAAATTGG - Intergenic
992607491 5:78473984-78474006 CTGTCTATGAACCAGGAAGTTGG - Intronic
992769973 5:80037860-80037882 CTGCATTTCAAAAGGGAAATTGG - Intronic
993477154 5:88379960-88379982 CTGTCTTTAAAAATAAAAGTAGG - Intergenic
993514961 5:88820399-88820421 CTGTCTTTCATAATGGAAGTAGG - Intronic
993779458 5:92047996-92048018 CTGACTTTGTAAAAGGAATTAGG + Intergenic
993907225 5:93636524-93636546 CTGTCTATGAAAAAGAAAGCAGG + Intronic
994013231 5:94933185-94933207 CTGACTTTAAAAAAAAAAGTAGG - Intronic
995073875 5:107958462-107958484 CTTTCTTTTCAGAAGGAAGTAGG - Intronic
995509811 5:112897033-112897055 ATGTCTTTCAATTGGGAAGTAGG + Intronic
995630114 5:114123801-114123823 ATGTATTTGAAAAAGGAAGTAGG - Intergenic
995987445 5:118195888-118195910 ATGCCTTACAAACAGGAAGTAGG + Intergenic
996058606 5:119008117-119008139 CTGTCTATGAACCAGGAAGTGGG - Intergenic
996290364 5:121845256-121845278 CTGTCTTCCAAAAAAAAAGCGGG + Intergenic
997335183 5:133103064-133103086 CTGTCTCACAAAAAAGAAGGAGG - Intronic
997374287 5:133385692-133385714 CTGTAATTAAAAAAGGAAGGAGG - Intronic
997828409 5:137128178-137128200 CTGTCTATGAAACAGGAAGTAGG + Intronic
998051981 5:139043459-139043481 CTGTCTTTACAAAAACAAGTTGG + Intronic
999103028 5:149043118-149043140 CTGTATTAGAAAAAGGCAGTTGG - Intronic
999181835 5:149675268-149675290 GTGTCTTTCAAAAAAGTATTTGG - Intergenic
1000795698 5:165661772-165661794 GTGTCCTTAAAAAAGGAAGAGGG - Intergenic
1001013260 5:168117739-168117761 ATGCCTATTAAAAAGGAAGTGGG - Intronic
1001113487 5:168918853-168918875 TTGACTTTGAAGAAGGAAGTTGG - Intronic
1001735928 5:174001340-174001362 CTGTATTTAAGAAAGGAAATAGG - Intronic
1002549725 5:179978518-179978540 ATGTCTTACAAAAATTAAGTCGG + Intronic
1003780594 6:9420877-9420899 CTGTCTTCCTAAATGGCAGTGGG + Intergenic
1003893368 6:10583675-10583697 CTTTCTTCAGAAAAGGAAGTTGG + Intronic
1004575841 6:16893449-16893471 CTCTCTTTCAAAAATGAACGTGG - Intergenic
1004662013 6:17718976-17718998 CTGTCTTTAAAAAAATAAATAGG - Intergenic
1004770777 6:18778662-18778684 CATTCTTTCCAAAAGGAAGATGG - Intergenic
1005590823 6:27324890-27324912 CTGTCTTTCAAAGTGGCATTGGG + Intergenic
1008638010 6:53431947-53431969 CTGTCTATGAACAAGGAAGCAGG - Intergenic
1009381141 6:63031593-63031615 ATTTCTTTAAAATAGGAAGTTGG + Intergenic
1010388154 6:75306009-75306031 CTGTCTTCACAAATGGAAGTTGG + Intronic
1010414695 6:75600325-75600347 CTGGCTTTGAAAATGGAAGAAGG - Intergenic
1010672999 6:78709063-78709085 CTGTCTATGAATGAGGAAGTGGG - Intergenic
1010903115 6:81452285-81452307 CTGACTTTCATAGAGGAAGAGGG + Intergenic
1012530914 6:100235288-100235310 CTCTCTTTACAAAAGGAAGAGGG + Intergenic
1012994798 6:105962314-105962336 TTTTCTTCCAAAAAGGATGTAGG - Intergenic
1013565063 6:111350579-111350601 CTGTCTTATAAAAAGGGAATGGG - Intronic
1014341564 6:120214283-120214305 CAGTCTTTGAAAAAGCATGTGGG - Intergenic
1014426587 6:121314174-121314196 CTGTTTTTGAAGATGGAAGTAGG - Intronic
1014677757 6:124388568-124388590 TTGTATTTATAAAAGGAAGTAGG - Intronic
1014967709 6:127776426-127776448 CTGTCTCTCAAAATGGCAGCTGG - Intronic
1015255269 6:131172352-131172374 CTGTCTTTAAAAAAGGAAAGGGG - Intronic
1016087431 6:139931427-139931449 CTTTCTTTCAAAAAGGATTTGGG + Intergenic
1016165084 6:140931796-140931818 TTGTATTTCAAGAAGGAATTTGG + Intergenic
1016982684 6:149867464-149867486 CTGTCTATGAACCAGGAAGTGGG - Intergenic
1017112219 6:150942957-150942979 ATCTCTTTCAAAAAGCAATTTGG + Intronic
1017245828 6:152223609-152223631 CTCTGTCTCAAAAAGGAAGGAGG + Intronic
1017634189 6:156427418-156427440 CTTTCTTACAAGAAGGAAGGAGG - Intergenic
1018431742 6:163728353-163728375 CTGTATTTTAAAATGGCAGTAGG + Intergenic
1019068401 6:169321830-169321852 GTGTCTTTCAGAAAGGGAGGGGG - Intergenic
1019993017 7:4705350-4705372 CTGTCTTTACAAAAAAAAGTTGG - Intronic
1020214859 7:6182351-6182373 CTGTCTCTTAAAAAAGAAGCAGG - Intronic
1020332946 7:7038771-7038793 CTGGCTTTCAAGATGAAAGTGGG + Intergenic
1020896828 7:13950962-13950984 CTGTTTTTCAAGCAGGAAATTGG - Intronic
1022873662 7:34505816-34505838 TTGTCTTTCATAAATGACGTTGG + Intergenic
1022947174 7:35298531-35298553 CTGTGTTGCAAAAATGAAGTTGG + Intergenic
1023421730 7:39987312-39987334 CTGTCTCAGAAAAAAGAAGTAGG - Intronic
1023658884 7:42453414-42453436 ATGTCTTTACAAAAGGAAGATGG + Intergenic
1024222536 7:47299742-47299764 CTGTTTTTCCAAACAGAAGTAGG + Intronic
1024363988 7:48500479-48500501 TTATTTTTCAAAAAGGAAGATGG - Intronic
1024547740 7:50536501-50536523 CTGGCTTTGAAAATGGAAATGGG + Intronic
1025271583 7:57525339-57525361 CTGTGCTTCAAAAAGAATGTAGG - Intergenic
1026051570 7:66951680-66951702 CTGTCTCTAAAAAAGTAAGTGGG - Intronic
1026215184 7:68342263-68342285 CTCTCTTTCTAAAAGAAATTTGG + Intergenic
1027008884 7:74724484-74724506 ATATGTTGCAAAAAGGAAGTTGG + Intronic
1028275249 7:88848076-88848098 TTGGCTTTCACAAAGGGAGTGGG + Intronic
1028877449 7:95839804-95839826 CTGTCCTTCAGAAATGAAGGGGG - Intronic
1029025896 7:97416823-97416845 CTGGCTTTGAAAATGGAAGAAGG - Intergenic
1030198670 7:106879186-106879208 CTGTCTATTAAAGAGGATGTGGG + Intronic
1030204575 7:106940412-106940434 CTGTGGTGCAGAAAGGAAGTTGG - Intergenic
1030336286 7:108330749-108330771 CTGTCTTCCAAAATGTAATTTGG + Intronic
1030643772 7:112036076-112036098 ATGTCTTTAAAAAAGGAAACAGG + Intronic
1031349537 7:120712818-120712840 AAGTCTTTCAAGAAGGAAATCGG - Intronic
1031384319 7:121128442-121128464 ATGACTTTCATAAAGGAACTTGG + Exonic
1031715012 7:125098101-125098123 CTTTGTTTGAAAAAGGAGGTTGG + Intergenic
1031774187 7:125885710-125885732 CTGTCTCTGAATAAGGAAGTAGG + Intergenic
1031786285 7:126037875-126037897 CTGTCTTTGTAAAAAAAAGTTGG - Intergenic
1031818032 7:126463691-126463713 CAGCATTTCCAAAAGGAAGTTGG + Intronic
1032745325 7:134780549-134780571 ATGTGTTTCAGAAAGGAAGGAGG + Intronic
1033227708 7:139574369-139574391 CTGTCTTAAAAAAAAAAAGTTGG + Intronic
1033486976 7:141800151-141800173 CTGTCTATCCACAAGGAAGTGGG + Intergenic
1034000873 7:147411636-147411658 CTGATTTTCATAAAGAAAGTAGG + Intronic
1034175078 7:149093360-149093382 CTGTCTTAACAAAAGGAAGCAGG + Intergenic
1034841192 7:154399184-154399206 CTTTCTTTAAAAAAGGAAGGTGG - Intronic
1034882379 7:154772413-154772435 AAGTCCTTCAAAAAGGAACTGGG - Intronic
1034941508 7:155233658-155233680 CTGTCTTAAACAAAGGAAATAGG + Intergenic
1035478340 7:159159502-159159524 CTGTCTTTCCAGATGGAACTGGG - Intergenic
1036018973 8:4820506-4820528 CTGTCTTTCTGAGAGGAGGTTGG - Intronic
1038420330 8:27430353-27430375 CCTTCTTGCAGAAAGGAAGTGGG + Exonic
1039405518 8:37309186-37309208 CTGGATTTGACAAAGGAAGTGGG - Intergenic
1039608648 8:38901943-38901965 CTGTCATTTAATAAGGTAGTCGG - Intronic
1039698639 8:39940113-39940135 CTTTCTTACTAAGAGGAAGTTGG - Intronic
1039731912 8:40289009-40289031 CTGTCCTTCCAAGAGGAAGGAGG - Intergenic
1040127854 8:43758903-43758925 CTTTCTTTTATTAAGGAAGTTGG + Intergenic
1040458988 8:47628768-47628790 CTGTCTAACAAAATGGAAATGGG + Intronic
1040740154 8:50564035-50564057 GTGTCTTTGAAAAAGAAAGTTGG - Intronic
1041782973 8:61597785-61597807 CTATCCTTCAAAAATGAAGGAGG + Intronic
1042117723 8:65450434-65450456 ATGTATTTCAGAAAGGAAATAGG + Intergenic
1043397282 8:79851289-79851311 CTGTCTTAAAAAAAAAAAGTGGG + Intergenic
1044752839 8:95432545-95432567 CTGTCTTTCAAACCGGTATTTGG - Intergenic
1045099995 8:98834608-98834630 CTGTCTATGAATCAGGAAGTTGG - Intronic
1045100203 8:98836302-98836324 CTGTCTATGAATCAGGAAGTTGG - Intronic
1045815823 8:106274685-106274707 CTGTCTTGGAAAAAGGCAGTGGG + Intronic
1046234871 8:111409742-111409764 CTCTTTTTTAAAAAGGAACTTGG + Intergenic
1046867711 8:119169621-119169643 CAGACTTATAAAAAGGAAGTAGG - Intronic
1046903498 8:119547109-119547131 CTGTCTTCCAAGAAGGAGGAAGG - Intergenic
1047073063 8:121369458-121369480 ATGTCTTTCAGAAATGAAGTGGG - Intergenic
1047733188 8:127743417-127743439 CTGACTTTCGGGAAGGAAGTTGG - Intergenic
1050017184 9:1246359-1246381 CTGTCTATGAACCAGGAAGTGGG + Intergenic
1050209341 9:3235669-3235691 CTGGCTTTGAAAATGGAAGGAGG - Intronic
1050768665 9:9168453-9168475 TTGTATTTCAAAAAGAAATTAGG - Intronic
1051756733 9:20408881-20408903 ATTTCTTTCAAAAAGAAAGAAGG - Intronic
1052050104 9:23836754-23836776 CTGTCTATAATAGAGGAAGTGGG + Intergenic
1052149075 9:25090187-25090209 TAGTATTTCAAAAAGGAACTTGG + Intergenic
1052252272 9:26412302-26412324 CTGTCTATGAAACAGGAAGCAGG + Intergenic
1052399138 9:27978549-27978571 CTGTCTGTGAACCAGGAAGTGGG + Intronic
1052489209 9:29142198-29142220 CTGTATTTGAAAAAGAAACTTGG - Intergenic
1052793682 9:32902443-32902465 CTGCCTTGCAAAAAGGTAGAGGG + Intergenic
1053119999 9:35539197-35539219 TTGTCTTTCCAAAAGGGAGAGGG + Intronic
1054990187 9:71316588-71316610 CTGTCTTTGAAGATGGAAGGAGG + Intronic
1054995270 9:71380559-71380581 CTGTCTCCCTAAAAAGAAGTAGG - Intronic
1055570315 9:77609858-77609880 CTGCATTTCAAAAAGGAAAGAGG - Intronic
1055936664 9:81610483-81610505 CTACCTCCCAAAAAGGAAGTGGG - Intronic
1056715152 9:89022330-89022352 CAGGCTTTGAAGAAGGAAGTGGG - Intronic
1059073898 9:111168698-111168720 CTGTCTTTCAGAAATGAAGGAGG + Intergenic
1059104511 9:111500233-111500255 CTGTCTGTGAACCAGGAAGTGGG - Intergenic
1059225417 9:112668282-112668304 CTGTGTTTCAAAAAGCAATCAGG + Intronic
1059434543 9:114268069-114268091 CTGTCATTCAAAGAGGGAGTTGG + Intronic
1060344991 9:122808164-122808186 TTGTTTTTTAAAAAGGAAATGGG + Intronic
1061149371 9:128820263-128820285 CTGTCTTCCCAGAAGGAAGCTGG - Exonic
1185670991 X:1810083-1810105 CTGTCTATGAACCAGGAAGTGGG + Intergenic
1185816581 X:3162062-3162084 TTGTCTTTCAAAAGTGAATTAGG + Intergenic
1185856236 X:3538800-3538822 CTGTTTTTCACAATGGAAGTTGG - Intergenic
1185859557 X:3564912-3564934 CTCTGCTTCAAAAAAGAAGTGGG + Intergenic
1185882682 X:3755412-3755434 TTGTCTTTCAAAAAGAAAGAAGG - Intergenic
1185962712 X:4563313-4563335 CTGTCTATGAACCAGGAAGTGGG - Intergenic
1186096006 X:6102476-6102498 CTGTCTATGAATCAGGAAGTGGG + Intronic
1186208426 X:7224595-7224617 CTGTCTATGAAACAGGAAGCAGG + Intronic
1186235264 X:7501256-7501278 ATGCCTTTCATCAAGGAAGTCGG - Intergenic
1186607949 X:11111277-11111299 CCGCCTTCTAAAAAGGAAGTAGG + Intergenic
1187275211 X:17810839-17810861 CATTCTTTCAAAAATGATGTGGG + Intronic
1187782283 X:22840872-22840894 CTATTTTTCAAAAATGATGTTGG - Intergenic
1187910959 X:24110835-24110857 CTGTTTTTAAAAAAGGAATGGGG - Intergenic
1188368574 X:29340714-29340736 CTGTATTTCAGAAAGGAAGAAGG - Intronic
1188551107 X:31365503-31365525 CTGTGTTACAAAAAGGTACTTGG + Intronic
1188569392 X:31563991-31564013 CTGTCCTTAAAAGGGGAAGTTGG + Intronic
1188752826 X:33924489-33924511 CTGACTTTCAAACAGTAAGGAGG - Intergenic
1189267502 X:39728269-39728291 CTGTTTTCCATAAAGGAAGCAGG - Intergenic
1189366858 X:40395497-40395519 CTCTCTATCAACCAGGAAGTGGG - Intergenic
1189397353 X:40634896-40634918 CTGTTTTACAGAAAGGAAATAGG - Intronic
1189729621 X:44005335-44005357 CTGGCTTTGAAAATGGAAGGAGG - Intergenic
1190153631 X:47969135-47969157 ATGTCTTTCTTAAAGGAAGTGGG + Intronic
1190634140 X:52417880-52417902 CCCTGTTTCAAAAAGGAGGTTGG + Intergenic
1191734578 X:64375696-64375718 CTGTCTATGAACCAGGAAGTAGG + Intronic
1192382237 X:70629554-70629576 TTGTCTTTCAAAAAGGAAAAGGG + Intronic
1193318982 X:80098024-80098046 CTGTCTTTCATCATGGAAGAAGG - Intergenic
1193617945 X:83712871-83712893 CAGTCATTTAAAAAGTAAGTAGG - Intergenic
1193952540 X:87818304-87818326 CTGTCTCTCAACCAGGAAGTGGG - Intergenic
1195629485 X:107039605-107039627 CTGTCTCTTAAAAAAGAAGAAGG + Intergenic
1197010783 X:121560642-121560664 CTGGCTTTGAAAAAGGAATGGGG - Intergenic
1197724145 X:129764957-129764979 CTGTCTCTAAAAAAAGAAGAAGG + Intronic
1197912741 X:131502295-131502317 CTGAATTTCAAAAAGCAAGGAGG + Intergenic
1197979474 X:132200083-132200105 CTGTCTTAAAAAAAAGAAGTCGG + Intergenic
1198444525 X:136698662-136698684 CTATCTTTCAAAATGGAAGGTGG + Intronic
1198504471 X:137287936-137287958 TTGTCTGTCAAAAATGGAGTGGG - Intergenic
1198812749 X:140552164-140552186 CTGTCTCAAAAAAATGAAGTTGG - Intergenic
1200782292 Y:7227722-7227744 TTGTCTTTCAAAAAGAAAGAAGG + Intergenic
1200782314 Y:7227902-7227924 TTGTCTTTCAAAAAGAAAGAAGG + Intergenic
1201264837 Y:12195768-12195790 CTGTCTTTCAAAAGTGAATTAGG - Intergenic