ID: 1170220851

View in Genome Browser
Species Human (GRCh38)
Location 20:13940100-13940122
Sequence CTGTATTTCTTACAGACAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 427
Summary {0: 1, 1: 0, 2: 1, 3: 33, 4: 392}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170220851 Original CRISPR CTGTATTTCTTACAGACAAA TGG (reversed) Intronic
902132880 1:14279059-14279081 CTGTATTTATCATAGACATAAGG + Intergenic
903465276 1:23547934-23547956 CTGAATTTCTCAAAGACAGAAGG - Intergenic
903739255 1:25549197-25549219 CTGTAATTCTATCTGACAAATGG - Intronic
903989083 1:27252623-27252645 TTGTATTTTTTGCAGAGAAAGGG - Intronic
904712438 1:32440659-32440681 TTGTATTTCTTATAGAGACAGGG + Intergenic
905696829 1:39980771-39980793 CAGGATTTCTACCAGACAAAGGG - Intergenic
907629038 1:56061625-56061647 GAGTCTTTCATACAGACAAAAGG + Intergenic
907774155 1:57496864-57496886 CAGTATTTCTTACACAACAAGGG + Intronic
908559934 1:65296209-65296231 CTGTAAGTCTTTCAGAAAAATGG + Intronic
909571745 1:77120390-77120412 CTGTATTACTTGTAGACATAGGG + Intronic
910052088 1:82986795-82986817 CTGTCTTTTTTACAGACACCAGG + Intergenic
910264946 1:85328635-85328657 CAGAATTTCTTCCAGACAACTGG + Intronic
910818314 1:91316879-91316901 CTGTATTTCTAAGACAGAAATGG - Intronic
910958993 1:92740775-92740797 CTGTATTTCTTATAGTCATATGG + Intronic
912928343 1:113932732-113932754 CTGGAACTCTTACAGATAAAAGG - Intronic
913977798 1:143478071-143478093 CTGTATTTATTACATCCAAAGGG - Intergenic
914072202 1:144303700-144303722 CTGTATTTATTACATCCAAAGGG - Intergenic
914106953 1:144662656-144662678 CTGTATTTATTACATCCAAAGGG + Intergenic
915351622 1:155230334-155230356 CTGTATTTTTAACAGAGACAGGG - Intergenic
915377203 1:155406993-155407015 CAGTATTACTTACAAAAAAAAGG + Intronic
915518434 1:156427518-156427540 CTCTTTTTCATACACACAAAAGG + Intronic
916273985 1:162973985-162974007 GTGAATTTCTTACATTCAAAAGG + Intergenic
917766598 1:178226617-178226639 TAGTAATTCTTACAGACAAATGG - Intronic
918455418 1:184706801-184706823 TTTTATTTCTGACAGACAAGAGG - Exonic
918991307 1:191700220-191700242 CTTAATTTTTTAGAGACAAAAGG + Intergenic
919157500 1:193785830-193785852 CTGCTTATCTTACAGACTAAGGG - Intergenic
919620491 1:199859912-199859934 CAGTCTTTCATACAGACAGATGG - Intergenic
921549422 1:216515515-216515537 CTGTTGTTCTTAAGGACAAATGG - Intronic
921627056 1:217388468-217388490 CTGTATTTTTAGTAGACAAAGGG + Intergenic
922639588 1:227214943-227214965 CTGCAATTCTCAAAGACAAAAGG + Intronic
923091177 1:230742487-230742509 CTGTATTTCTAATAGAGACAGGG + Intergenic
924675813 1:246176693-246176715 CTGTATTTTTTGCAGAGACAGGG + Intronic
1063827358 10:9912367-9912389 CTGTATTTCTTACAGCACAATGG + Intergenic
1065761961 10:28990880-28990902 TTGTATTTTTTATAGAGAAAGGG + Intergenic
1065795986 10:29308784-29308806 CTGTATTTTTTGCAGAGAGAAGG - Intronic
1065836296 10:29661217-29661239 CTGGTTTGCTTAAAGACAAAGGG + Intronic
1065919998 10:30384909-30384931 CTGTCCATCTTGCAGACAAACGG - Intergenic
1066076579 10:31883885-31883907 TTGTATTTTTTATAGAGAAAGGG + Intronic
1066407568 10:35133469-35133491 CTGTATTTTTTGCAGAGATAGGG + Intronic
1067157964 10:43798735-43798757 CTGCATATATTAAAGACAAAAGG - Intergenic
1068016458 10:51522899-51522921 CTGTATTTATTAAAAACCAAGGG + Intronic
1068144548 10:53050847-53050869 GTGTATTTCTTCCAGAAATATGG + Intergenic
1068579776 10:58726038-58726060 CTGTATTTCTTATATCCACAAGG + Intronic
1069189374 10:65467593-65467615 TTGTACTTCTTAGAGACAATGGG - Intergenic
1069342927 10:67433515-67433537 CTGCATTTTTTACAGATAGAAGG - Intronic
1070125177 10:73615746-73615768 TTGTATTTTTTATAGAAAAAGGG - Intronic
1070251663 10:74778759-74778781 CTGTCTGTCTTGCAGACAGAGGG + Intergenic
1071131416 10:82397940-82397962 CTGTTTTTCTCACCCACAAAGGG + Intronic
1071670013 10:87599635-87599657 CTGTATTTTTTGCAGACATAGGG + Intergenic
1072552183 10:96487424-96487446 CTGTATTCCTTTAGGACAAATGG + Intronic
1073917232 10:108419766-108419788 AGGTATTTCTTACTGATAAAAGG - Intergenic
1073949421 10:108789189-108789211 CTGTTTTTATTAGAGACTAAAGG - Intergenic
1075106047 10:119540786-119540808 CTCTATTTATAACAGGCAAAAGG + Intronic
1075879463 10:125837957-125837979 CTGTCCTTCTTAAAGACACATGG + Intronic
1080263030 11:30370960-30370982 CTGGCTTTCCTACAGACAACAGG - Intergenic
1080798517 11:35588131-35588153 CTGTATTTTTCACAGAGACAGGG - Intergenic
1081183430 11:40013010-40013032 CTGTATTTCCTGGAGACACAGGG - Intergenic
1084060084 11:66666281-66666303 CTCTACTTATTACAGACAAAGGG + Intronic
1085629705 11:78104431-78104453 CTGCTTTTCCCACAGACAAAAGG + Exonic
1085710578 11:78825527-78825549 CTGTCTTTCTTCCAGACGAGCGG - Intronic
1085981527 11:81732365-81732387 CTGTAGTTCTTGCAGACACATGG + Intergenic
1086462295 11:87017901-87017923 TCATATTTCTCACAGACAAAAGG - Intergenic
1086901794 11:92375666-92375688 CTGTATTTATTACTGAGACATGG + Intronic
1086923177 11:92611286-92611308 CTTTTTTTCTTACAGAGACAGGG + Intronic
1087364753 11:97203993-97204015 CTATATATCTTACAGGCAAGAGG - Intergenic
1088015363 11:105051952-105051974 TTCTATTTCTTACTAACAAATGG + Intronic
1088169882 11:106983856-106983878 ATGTGTTTCTTACAGTTAAAGGG - Intronic
1093035308 12:14327078-14327100 ACGTATTACTTACACACAAAAGG - Intergenic
1093062937 12:14626165-14626187 CTGTATTTCTAGTAGAGAAAGGG - Intronic
1093487899 12:19672048-19672070 CTGTTTTTATTACTGACAATTGG - Intronic
1094043704 12:26144585-26144607 CTGTGTTTGATACAGAAAAATGG - Intronic
1094459607 12:30680425-30680447 CTGTATTTCTGCCTGACACATGG - Intronic
1095261979 12:40107365-40107387 CTTTTTTCCTTTCAGACAAAAGG + Intergenic
1095575272 12:43730391-43730413 CATTATTTCCTTCAGACAAACGG + Exonic
1097197617 12:57252284-57252306 CTTTATTTCTTACAGATACAAGG - Intronic
1097359781 12:58646166-58646188 CTGTAGTCCTAACAGAGAAAGGG + Intronic
1097855817 12:64460906-64460928 TTGTATTTTTTACAGAGACAGGG - Intronic
1097901141 12:64874986-64875008 CAACATTTCTTTCAGACAAAGGG + Exonic
1100032091 12:90205476-90205498 TTGTATTCTTTACATACAAAGGG - Intergenic
1100560579 12:95745553-95745575 CTGTATTTCTTATGTTCAAAAGG - Intronic
1101505505 12:105342458-105342480 ATGTATTTCTTACAGTCTAGAGG - Intronic
1101901744 12:108795912-108795934 ATGTATTTCTTTCTGAGAAAAGG + Intronic
1102437167 12:112933712-112933734 TTGTATTTCTCATAGACACAGGG - Intergenic
1103686742 12:122738176-122738198 CTGTATTTTTTATAGAGACAGGG - Intergenic
1108340310 13:49493052-49493074 CTTTTTTTTTTACAGAAAAAAGG + Exonic
1108905752 13:55469804-55469826 CTGTATTGCTTAGAGAAAAATGG + Intergenic
1109045914 13:57410148-57410170 CTGTGATTCTTACAGACTCATGG - Intergenic
1109073356 13:57799515-57799537 CTGTTTTTCTTACTGGGAAACGG + Intergenic
1109186725 13:59278083-59278105 CTCTATTTCTTACTGAGAAATGG - Intergenic
1109708715 13:66135386-66135408 ATGAAGTTCTTACAGTCAAAAGG + Intergenic
1110297767 13:73888174-73888196 CTGTATTTTTTGCAGAGACAGGG + Intronic
1110399408 13:75072330-75072352 GTGAATTTCTTACAGTCACATGG + Intergenic
1110734011 13:78913139-78913161 TTGTATTTCTTGCAGAGACAGGG - Intergenic
1110786364 13:79532261-79532283 CTGTGTTTCTTACAAACTGAAGG - Intronic
1111319284 13:86603981-86604003 GTGTATTTCTTACAGATCAGAGG - Intergenic
1111871302 13:93835860-93835882 ATTGATTTATTACAGACAAATGG + Intronic
1112205229 13:97317573-97317595 CTGGATTTCAGACAGCCAAAAGG - Intronic
1112709720 13:102113646-102113668 CAGTATTTGTTACAGCCTAATGG + Intronic
1115010951 14:28544011-28544033 TTGTATTTTTTACAGAGATAAGG - Intergenic
1115231034 14:31161088-31161110 CTGTCTTTATTATATACAAAGGG - Intronic
1115453064 14:33571125-33571147 CTCAATGTCTAACAGACAAAAGG - Intronic
1115601320 14:34958352-34958374 CTATAAATCTTACAGACAACAGG + Intergenic
1115672649 14:35631718-35631740 ATGCAATTCTTACAGAAAAATGG - Intronic
1115679663 14:35722437-35722459 TTGTATTTCTTATAGAGACATGG - Intronic
1115813999 14:37142968-37142990 CTGCATTCCCTACAGGCAAAGGG + Intronic
1116166526 14:41340892-41340914 GTGTATTTTTTACATACAACAGG - Intergenic
1116236747 14:42288148-42288170 TTGTATTTTTAACAGACACAGGG - Intergenic
1118245445 14:64105885-64105907 TTGTATTTTTTACAGAGACAGGG - Intronic
1118596950 14:67443046-67443068 CTGTATTTTTTGCAGAGACAGGG - Intergenic
1119414804 14:74462676-74462698 TTGTATTTTTTACAGAGACAGGG + Intergenic
1121067290 14:90980285-90980307 CTGTGTTCCTTACATACACATGG + Intronic
1122403927 14:101486787-101486809 ATGAGTTTCTTACAGACAACAGG + Intergenic
1122553645 14:102564396-102564418 CTTTATTTCTTATAGAGATAGGG + Intergenic
1123410329 15:20053524-20053546 CTTTTTTTCTCACAGACAAGTGG - Intergenic
1123519662 15:21060231-21060253 CTTTTTTTCTCACAGACAAGTGG - Intergenic
1124990418 15:34667927-34667949 CTGTATTTCTCACATGCAGAAGG + Intergenic
1125245136 15:37627790-37627812 TTGTAGTTCTTACAAAGAAAAGG - Intergenic
1126361622 15:47852387-47852409 GTATCTTTCTTACAGACACAAGG + Intergenic
1126826039 15:52548722-52548744 ATGTATCTCTTACAGATAAGGGG + Exonic
1127012565 15:54645609-54645631 CTGTGGTTCTTGCAGACATATGG - Intergenic
1127035098 15:54907199-54907221 CTCTATTTCTGCCAGACAATGGG - Intergenic
1127885626 15:63197544-63197566 TTGTATTTTTTACAGAGAGAAGG + Intronic
1128147363 15:65339385-65339407 TTGTATTTCTTATAGAGACAGGG + Intronic
1128723448 15:69970339-69970361 CAGCATTTCTTGCAGACACAGGG - Intergenic
1129586115 15:76867834-76867856 CAGTCTTTCTTGCAGACAGATGG + Intronic
1130639134 15:85654644-85654666 GTGTATTTCTTTTAGACACAGGG - Intronic
1130807256 15:87337045-87337067 CTATATTAATTTCAGACAAAAGG + Intergenic
1132436011 15:101803237-101803259 CTGTAATTTTTATACACAAAAGG + Intergenic
1133111512 16:3550673-3550695 CCTGATTTCTTACAGACAACAGG - Intronic
1134007299 16:10826779-10826801 TTGTATTTCTTATAGAAACAGGG - Intergenic
1134448010 16:14345416-14345438 CTGTATTTTTTGTAGACACAGGG + Intergenic
1134999488 16:18764974-18764996 CTGTACTTCTGACAAAAAAAGGG + Intergenic
1135637799 16:24093853-24093875 CTGTATTTCTTATAGGCAATAGG + Intronic
1135647329 16:24174546-24174568 CTGTTCTTCTTACAGAGTAAGGG + Exonic
1136543732 16:30943673-30943695 CTGTAATTCTTATAGAAACAGGG + Intronic
1137967319 16:52948865-52948887 CAGTATTTACTACAGCCAAAAGG + Intergenic
1138045878 16:53724270-53724292 CTGTATTCCTTACAGATGACGGG + Intronic
1138364462 16:56462651-56462673 CTTTATATCTTACAGACACCAGG - Intronic
1138382569 16:56613244-56613266 TTGTATTTTTAACAGAGAAAGGG + Intergenic
1141240174 16:82258467-82258489 CAATATTTGTTACAGCCAAAAGG - Intergenic
1141857043 16:86690294-86690316 CTGTGTTTCTTACAAACTGAGGG - Intergenic
1142911129 17:3092290-3092312 TTGTATTTCTTAGAGACTGAGGG + Exonic
1143469389 17:7162437-7162459 TTGTATTTCTTGCAGAGACAGGG + Intergenic
1143897955 17:10151715-10151737 TTTTATTTTTTACAGAGAAAGGG + Intronic
1144324205 17:14162009-14162031 CCGTATTTCTTACAGCACAATGG + Intronic
1144419461 17:15083061-15083083 CTGTATTACTTGCAATCAAAGGG - Intergenic
1145951437 17:28821547-28821569 CTGCTTTTCTTATAGACCAAGGG + Intronic
1146094350 17:29913940-29913962 CTATATTTCTTACATAGAAGTGG + Intronic
1146133294 17:30296723-30296745 TTGTATTTTTTATAGACATAGGG - Intergenic
1146811075 17:35903830-35903852 TTGTATTTTTTATAGACACAGGG + Intergenic
1148003679 17:44407513-44407535 CTGTATTTCTTCCAGAAAAATGG + Intronic
1148881991 17:50735668-50735690 CTGTATTTTTTATAGACATGGGG + Intronic
1150360371 17:64527455-64527477 TTTTATTTCTTAAACACAAAGGG - Intronic
1151111169 17:71679797-71679819 CTGTATTTCTTCCAGATGACCGG - Intergenic
1151795780 17:76344437-76344459 CTGTATTTTTAACAGAGACAGGG + Intronic
1153842769 18:9022011-9022033 TTGTATTTCTTGTAGAGAAAGGG + Intergenic
1155658154 18:28215329-28215351 CTGTATCTCTCACAGCCATATGG - Intergenic
1156049395 18:32913726-32913748 CTGGATTTGTTATATACAAAGGG - Intergenic
1156184739 18:34648782-34648804 ATCTATTTCTTGAAGACAAAGGG - Intronic
1156551219 18:38019428-38019450 TTCTGTTTCTTACAGACAAATGG + Intergenic
1156728869 18:40165131-40165153 ATGTATTTCCTAGAGACAACTGG - Intergenic
1156775739 18:40786335-40786357 CTGTATTTCTATCTGAAAAATGG - Intergenic
1157348556 18:46863469-46863491 CTGTATTTCTTGTAGAGACAGGG + Intronic
1157371158 18:47113380-47113402 CTGTATTATTTACTGCCAAATGG - Intronic
1158621885 18:59040102-59040124 CTGTATTTTTTGCAGAGACAGGG - Intergenic
1160824303 19:1072425-1072447 TTTTATTTCTTACAGAGACAGGG + Intronic
1163239286 19:16050063-16050085 TTGTATTTTTTACAGAGACAGGG + Intergenic
1164322572 19:24163149-24163171 CTGTATTTTCTATAGTCAAAGGG + Intergenic
1164768136 19:30787372-30787394 TTGTATTTCTAATAGACAATGGG - Intergenic
1165251706 19:34542864-34542886 CTGCATTTCTGACATTCAAAGGG + Intergenic
1165274978 19:34741675-34741697 CTGCATTTCTGACATTCAAAGGG - Exonic
1165570955 19:36774707-36774729 CTGTATTTCCAACAGAAAAGTGG + Intronic
1166729969 19:45053429-45053451 CTCTATTTTTTAAAGAAAAACGG - Intronic
1167948765 19:53010056-53010078 CTGTCTTTCTTCCAGAGACAGGG - Intergenic
925149915 2:1607908-1607930 CTGTATTTCTGCCAGACTGAGGG - Intergenic
926014073 2:9433572-9433594 CTGAACTTCTTAGAGAAAAAGGG - Intronic
926588016 2:14710247-14710269 CAGTATTTTTTATGGACAAATGG - Intergenic
926763244 2:16298415-16298437 CTGTATTACTTACAGACTGGTGG + Intergenic
927452462 2:23220781-23220803 CATTTTGTCTTACAGACAAAGGG - Intergenic
929179522 2:39020599-39020621 CAGTAGTTCTTAAAAACAAATGG + Intronic
930579122 2:53188439-53188461 CTTTATTTCTGACACATAAAAGG + Intergenic
930709445 2:54536663-54536685 CTGTATTCCTTACAACCAGAAGG - Intronic
930746768 2:54892515-54892537 GTGTGTTTCTTACGGACGAATGG + Exonic
930976578 2:57469833-57469855 CTGTCTTTCTTACAGTTAAGTGG + Intergenic
931377581 2:61721248-61721270 CTATATTACTTAAATACAAAAGG - Intergenic
931829916 2:66040152-66040174 TTGTATTTTTTACAGAGACAGGG - Intergenic
933583324 2:84151976-84151998 CTTACTTTCTTACAGACAGATGG - Intergenic
933812036 2:86038807-86038829 CTGTTTTTCTTCCATACAGAAGG + Exonic
934182505 2:89639066-89639088 CTGTATTTATTACATCCAAAGGG - Intergenic
934292801 2:91713269-91713291 CTGTATTTATTACATCCAAAGGG - Intergenic
934733702 2:96676138-96676160 CTGAATTACTTTCAGGCAAATGG - Intergenic
936760975 2:115782546-115782568 CTGTTTCTCTTACATACATAAGG - Intronic
938566762 2:132525661-132525683 CTGTATGTCTGACGGCCAAAGGG - Intronic
938743792 2:134258203-134258225 TTGCATTTGTTACAAACAAATGG - Intronic
938801483 2:134767333-134767355 CAGTTTTTCTTAAATACAAATGG - Intergenic
940115793 2:150206781-150206803 CTGTATTTTTAGTAGACAAAGGG - Intergenic
940422049 2:153490550-153490572 TTGTATTTTTAATAGACAAAGGG + Intergenic
940480372 2:154221907-154221929 CTGTAATTCTCAAAGAGAAATGG + Intronic
940860947 2:158770195-158770217 ATATATTTCTTTCAAACAAATGG + Intergenic
940947885 2:159638092-159638114 CTTACTTTCTTCCAGACAAACGG - Intergenic
941046973 2:160687222-160687244 CTCTAATTCTTACAAATAAATGG - Intergenic
941392729 2:164934962-164934984 CTGTATGTATTACAGACTCAGGG - Intronic
941442944 2:165561027-165561049 CTATCTGTCTTACATACAAAAGG + Intronic
941676990 2:168354652-168354674 ATCTGTTTCCTACAGACAAAAGG - Intergenic
943589387 2:189779169-189779191 TTGTTTTTCTTACAGAGACAGGG - Intronic
943737827 2:191376752-191376774 CTGTATTTGGGACAGAGAAATGG - Intronic
946263238 2:218514634-218514656 CTATATTTCTTAATTACAAAAGG - Intronic
947057761 2:226126486-226126508 TTTTATTTCTTACAGAGACAGGG + Intergenic
947978957 2:234392530-234392552 CTGTATTTTTTACAGAGATGAGG - Intergenic
1169537157 20:6557480-6557502 ATATTTTTCTTCCAGACAAATGG - Intergenic
1169757882 20:9063094-9063116 TTGTATCTCTTTTAGACAAAGGG - Intergenic
1170220851 20:13940100-13940122 CTGTATTTCTTACAGACAAATGG - Intronic
1170248666 20:14254570-14254592 CTGAATTTCTTTTAGATAAAAGG - Intronic
1170459175 20:16560632-16560654 TTGTATTTCTTTTAGACAAGGGG - Intronic
1170811302 20:19677328-19677350 CAGTATTTCTTTCAGGGAAATGG + Intronic
1170895220 20:20406737-20406759 CTGTATTTCTTATAGAGACAGGG - Intronic
1172561898 20:35896498-35896520 CTGCATTTCTAACACACAAGAGG + Intronic
1172683183 20:36732972-36732994 TTGTATTTTTTATAGACACAGGG - Intronic
1173296128 20:41759844-41759866 ATATGTTTGTTACAGACAAAAGG - Intergenic
1176334158 21:5580122-5580144 CGGTATGTCTTACAGAAACATGG + Intergenic
1176393599 21:6240830-6240852 CGGTATGTCTTACAGAAACATGG - Intergenic
1176467820 21:7075344-7075366 CGGTATGTCTTACAGAAACATGG + Intronic
1176491381 21:7457122-7457144 CGGTATGTCTTACAGAAACATGG + Intergenic
1176509261 21:7681261-7681283 CGGTATGTCTTACAGAAACATGG - Intergenic
1176729963 21:10484187-10484209 CTGTATTTATTACATCCAAAGGG + Intergenic
1178168092 21:30005836-30005858 CTGTATTTATTACACAACAAAGG + Intergenic
1178276257 21:31240351-31240373 CTGCATTTATTAAAGACAAATGG + Intronic
1181077414 22:20390483-20390505 CTGGCTTTCCTACAGACACAGGG + Exonic
1182346015 22:29665575-29665597 CAGTATTTCATACATATAAAAGG + Intronic
949815208 3:8050957-8050979 CTGTATTTGAAAAAGACAAATGG - Intergenic
951511785 3:23510432-23510454 TTGTATTTTTTGTAGACAAAGGG - Intronic
952130719 3:30358587-30358609 CTGTTTATCCTACAGACAATGGG - Intergenic
953978051 3:47397336-47397358 CTGTGTTTTTTACAGACTGAAGG - Intronic
955460912 3:59182393-59182415 TTTTATTTCTTGTAGACAAAGGG - Intergenic
956117320 3:65931491-65931513 TTGTATTTTTTATAGACACAGGG - Intronic
956447702 3:69341994-69342016 GTGTGTTTCTTTCAGAGAAATGG - Intronic
956720082 3:72109915-72109937 CTGTATTTTTGGCAGACATAGGG + Intergenic
957294123 3:78314203-78314225 ATGCATGTGTTACAGACAAATGG - Intergenic
957352465 3:79043578-79043600 CTGTATTTCTTGCAAACGACTGG + Intronic
957563605 3:81856786-81856808 TTGGATTTCTTACATAGAAATGG + Intergenic
957575180 3:81998150-81998172 CAGTGTTTCTGACAGACAACTGG + Intergenic
957661789 3:83165312-83165334 ATGTATTTCTAACACAAAAAAGG - Intergenic
958123696 3:89327763-89327785 CTGTATTGCTTTCAGATACATGG + Intronic
959094412 3:101938049-101938071 CTTTATTTCTGACAACCAAAAGG + Intergenic
959301862 3:104612719-104612741 CAGTATTTGTGACAGAGAAATGG + Intergenic
959489194 3:106967187-106967209 TTGTATTTTTTATAGAGAAAGGG + Intergenic
960398411 3:117165942-117165964 CTGTCTTTCTCACAGGCAATAGG + Intergenic
960461181 3:117937788-117937810 CTGTATTTCCTAACGACAATAGG - Intergenic
960474976 3:118112644-118112666 CTATATTTCTTCCAGAAGAATGG + Intergenic
960599404 3:119440829-119440851 CTGTATTTATTACAAACTGAAGG + Intronic
960683033 3:120268707-120268729 CTGTATTTTTTATAGAAACAGGG + Intronic
960932280 3:122865306-122865328 CTGTGTTTCTTACAGTTAGAGGG + Intronic
962005979 3:131350305-131350327 GTGTATTTCATACACACACAAGG + Exonic
962115580 3:132502959-132502981 CAGTATATCTCACAGACAACTGG - Intronic
963309407 3:143692079-143692101 CTGTATTTCTTATAAACTGATGG - Intronic
963429321 3:145177905-145177927 ATATATTTCTTTCATACAAAAGG + Intergenic
963690863 3:148500909-148500931 TTGTTTTTCTTACAAAGAAAGGG - Intergenic
965213900 3:165833728-165833750 CTGCATTTATTAAAGAGAAAAGG - Intronic
965610926 3:170543341-170543363 CTGTGCTTCTTAAAGACAGAGGG - Intronic
966772075 3:183512940-183512962 AGGTATTTCTTACACACAATTGG - Intronic
966772823 3:183519098-183519120 GTGTATTGTTTCCAGACAAAGGG + Intronic
967391135 3:188955911-188955933 CTGTCTTTCTTGCATAAAAAGGG + Intronic
967684507 3:192404392-192404414 CGGAAGTTATTACAGACAAAGGG - Intronic
967895304 3:194390886-194390908 CTTTATTTCATTCACACAAAGGG - Intergenic
968802113 4:2749981-2750003 CTGTATTTTTTGCAGAGACAAGG + Intronic
970251581 4:14121916-14121938 CTGGATCTCTTACAATCAAAGGG + Intergenic
970455613 4:16220904-16220926 CTGTATTTTTTATAGAGACAGGG + Intronic
970469153 4:16358721-16358743 TTGTATTTTTTACAGAGACAGGG + Intergenic
971677912 4:29658117-29658139 TTGTATGTTTTTCAGACAAATGG - Intergenic
972372802 4:38441395-38441417 CTGTATATCTAACAGTGAAAGGG + Intergenic
974132403 4:57772859-57772881 CTGTCTTTCTTTTAGTCAAATGG + Intergenic
974579955 4:63784491-63784513 CTTTATTTTTTTCAGATAAAAGG - Intergenic
976415316 4:84767051-84767073 CTGTGTTTCTTACAAATTAAAGG + Intronic
976669296 4:87634532-87634554 ATGTATTTCTTACAAATAAAGGG - Intergenic
977263928 4:94832205-94832227 CAGTATTTAGTACAGAGAAATGG + Intronic
978184279 4:105838582-105838604 CTGTCTTTGTTCCAGACCAATGG - Intronic
978830343 4:113076621-113076643 TTGTATTTTTTACAGAGACAGGG - Intronic
978905670 4:114002605-114002627 CTTTATTTCTTATGGAAAAATGG + Intergenic
979465891 4:121038174-121038196 CTTTATTTCTTACAGAGACAGGG - Intronic
980257816 4:130403971-130403993 TTGTCTTTCTTAAAGTCAAATGG + Intergenic
980446606 4:132918643-132918665 TTACATTTCTTAAAGACAAATGG + Intergenic
980490127 4:133513957-133513979 GTTAAATTCTTACAGACAAAAGG + Intergenic
981989335 4:150897906-150897928 TTATATTTCTTACAAACACATGG - Intronic
983446302 4:167857772-167857794 CAGTATGTATTACAGACAAATGG + Intergenic
984449338 4:179878969-179878991 CTAGATGTCTTCCAGACAAATGG + Intergenic
985233106 4:187843235-187843257 CTATATTTTTAACAGACAGATGG - Intergenic
985776976 5:1849598-1849620 TTGGATTTCTTACAGACAGTTGG - Intergenic
985879235 5:2626028-2626050 CTGTGAGTCTTAGAGACAAAGGG + Intergenic
986532937 5:8758303-8758325 ATGTATTTCTTACCCACCAAAGG - Intergenic
987116178 5:14728574-14728596 CCGTCTTTGTTCCAGACAAAGGG + Intronic
987667890 5:20968553-20968575 GTGTATTCCTTCCACACAAAGGG - Intergenic
988327358 5:29787430-29787452 CTACATCTCTTACAGACATAAGG + Intergenic
988989847 5:36659741-36659763 ATGTATTTATTACAGTCAACAGG - Intronic
989842461 5:46096393-46096415 CTGCATTTCTTACAGAAACTAGG - Intergenic
990036061 5:51321433-51321455 CTGTATGTCTACTAGACAAAGGG + Intergenic
991332577 5:65508140-65508162 TTGTATTTCTTACTTACACAGGG - Intergenic
991905763 5:71509069-71509091 CTATCTTTTATACAGACAAATGG - Intronic
991907624 5:71527690-71527712 CATTATTTCTAACAGCCAAAAGG - Intronic
992204696 5:74420108-74420130 CTGTATTTTTAAAAGACACAAGG - Intergenic
992806133 5:80339632-80339654 TTGTATTTCTTTCAGAGAGAAGG - Intergenic
993015449 5:82530591-82530613 CTATAATACTTGCAGACAAATGG - Intergenic
993523532 5:88935441-88935463 CTAGATTTTTTACAGACAATGGG + Intergenic
993871479 5:93259815-93259837 CAGTCTTTATTACAAACAAAAGG - Intergenic
994164244 5:96592224-96592246 CTGTATTTCTAGCAGAGACAGGG - Intronic
994200496 5:96969178-96969200 CTGTATTTCTTTCTTAAAAAGGG - Intronic
995413351 5:111882453-111882475 CTGTATTTCCTGCATCCAAATGG - Intronic
995423193 5:111990478-111990500 CTGTATTTCCTGCATCCAAATGG + Intronic
996038450 5:118784266-118784288 ATGTGATTCTTAGAGACAAATGG + Intergenic
996371015 5:122752452-122752474 TTGTATTTTTTATAGAGAAAGGG - Intergenic
997186376 5:131885537-131885559 CTGTAGTTCTTGCAGACTTATGG - Intronic
997701253 5:135901486-135901508 CTGTATTTCTCAGAGACTATGGG + Intergenic
997957806 5:138293817-138293839 CTGTATTTTTTATAGAGAGAGGG + Intronic
999053842 5:148552490-148552512 CTGTCCTTCTTAGAGACTAACGG + Intronic
999674030 5:153981248-153981270 CTGTATTTTTTGTAGACACAGGG + Intergenic
999788783 5:154917757-154917779 CTGTAGTTCTCAAAGACACAAGG + Intronic
1000954308 5:167524185-167524207 GTGTATTTCTTTAATACAAAGGG + Intronic
1001244400 5:170095160-170095182 TCCTATTTCTTACAGCCAAAGGG + Intergenic
1002205304 5:177558908-177558930 ATTTATTTCTTACAGATACAGGG - Intergenic
1002391824 5:178919787-178919809 TTGTATTTTTTGCAGAGAAAGGG - Intronic
1002659980 5:180785361-180785383 CTGAATTTCTGACTCACAAATGG - Intergenic
1002669333 5:180853277-180853299 CTGTATATCCTAAAGTCAAAAGG + Intronic
1002683190 5:180985803-180985825 CTGTATCTCTTGCAGATAAGGGG - Intergenic
1002936918 6:1681866-1681888 TTGTATTTCTTATAGAGACAAGG + Intronic
1003998200 6:11565202-11565224 CTGAAATTCTTAAAGATAAAAGG + Intronic
1005587072 6:27287198-27287220 TTGTATTTCTAACAGAGACAGGG - Intronic
1005855128 6:29854827-29854849 CTGTATTTTTTGTAGAGAAAGGG - Intergenic
1006019155 6:31107132-31107154 ATGTCTTTTTTACTGACAAATGG + Intergenic
1007088262 6:39166017-39166039 ATGAATTTCTTAAAGGCAAAGGG + Intergenic
1007773341 6:44208640-44208662 CTGTAATTCTTTCAGGGAAAGGG - Intergenic
1008568465 6:52792387-52792409 CTGTATCTCTCACTGAGAAAAGG - Intronic
1008968796 6:57342469-57342491 CTGTCAGCCTTACAGACAAAGGG + Intronic
1009157780 6:60244290-60244312 CTGTCACCCTTACAGACAAAGGG + Intergenic
1009530378 6:64804568-64804590 CTGTATTTCTTGAAACCAAAAGG - Intronic
1011543518 6:88459224-88459246 CTGTATTCCTTAGGGAAAAATGG + Intergenic
1011621894 6:89250947-89250969 CTTTATTTTTTTCAGACACAGGG + Intergenic
1015850998 6:137572526-137572548 CAGTATTTATTACATACGAAGGG - Intergenic
1016571279 6:145515801-145515823 CTGTATTCCCTTCACACAAAGGG - Intronic
1017263011 6:152409286-152409308 TTAAATTTCTTAGAGACAAATGG - Intronic
1018577060 6:165270035-165270057 ATGTATTTCTTTCAGAGAACTGG - Intergenic
1018673251 6:166197069-166197091 ATATATTTCTCACACACAAAAGG - Intergenic
1021244423 7:18244437-18244459 CTGTAATTATAACAGACAAATGG + Intronic
1022269049 7:28787725-28787747 CTGTATTTTTTATAGAGACAGGG + Intronic
1022676000 7:32499546-32499568 CTGTATTTCTAATACAAAAAAGG + Intronic
1023026055 7:36050667-36050689 CTGTATTTCTGACAAACTGAAGG + Intergenic
1023156109 7:37254016-37254038 CAGGATTTCTTATAGAAAAATGG + Intronic
1023488537 7:40712951-40712973 ATGTATTTCTTACATTCACATGG + Intronic
1024473743 7:49789646-49789668 CTGTAATTCTTTAAAACAAAAGG + Intronic
1025257459 7:57394317-57394339 TTCTATTCCTTACAGTCAAAAGG - Intergenic
1025299576 7:57807408-57807430 CTGTATTTCTGGTAGACACAGGG - Intergenic
1026632071 7:72046138-72046160 TTGTATTTCTTATAGAGACAGGG - Intronic
1027225586 7:76241674-76241696 CTGTATTTTTAGCAGACACAAGG + Intronic
1027382478 7:77625424-77625446 TTGTATTTGTTAAAGACACAGGG + Intronic
1028783869 7:94769626-94769648 CTGTTTTTCTTTTATACAAAAGG - Intergenic
1029563877 7:101321937-101321959 CTGTATTTCTTTTAGAGACAGGG + Intergenic
1030236107 7:107264365-107264387 ATATATTTCTTACATACATAAGG - Intronic
1030755560 7:113283856-113283878 CTGTATTGATAACAGACTAATGG - Intergenic
1032233461 7:130098318-130098340 TTGTATTTTTTACAGAGACAGGG - Intronic
1033480540 7:141735911-141735933 TTGTATTTTTTACAGAGACAGGG + Intergenic
1034043013 7:147899165-147899187 TTGTATTTTTTGCAGAGAAAGGG - Intronic
1034599613 7:152237346-152237368 CTGTATTTGTTACATCCAAAGGG - Intronic
1035217715 7:157381368-157381390 CTGTAATTTTTTCAGAAAAATGG - Intronic
1038334312 8:26634185-26634207 CTGCATTTCTTACAGACTCTGGG + Intronic
1038767795 8:30445364-30445386 CTATGTATCTTACAGACACAAGG - Intronic
1039165741 8:34677930-34677952 ATGTATTTACTACAGACAACTGG - Intergenic
1039663395 8:39492594-39492616 ATGTAGTTCTTACATAGAAATGG + Intergenic
1043470002 8:80552759-80552781 TTGTATTTTTTATAGACACAGGG + Intergenic
1043877896 8:85507219-85507241 CTGCATTTCTGACAACCAAATGG - Intergenic
1045592376 8:103612888-103612910 CTTACTTTCTTCCAGACAAATGG + Intronic
1046209057 8:111042588-111042610 CTGTCTTTCTTGGAGACAAAGGG + Intergenic
1047173667 8:122519891-122519913 CTTTATTTCAGACAAACAAAGGG + Intergenic
1047650468 8:126914683-126914705 CTGTGCTTCTTACAAGCAAAAGG + Intergenic
1047816957 8:128475009-128475031 CTGTACTTCGTATATACAAATGG + Intergenic
1047923986 8:129664806-129664828 CCTTATTTCTTGCAGACAAAAGG - Intergenic
1048428531 8:134344917-134344939 CTGTATTGGTAACAGACTAAAGG + Intergenic
1048740590 8:137554770-137554792 CTGTATTTTGTTAAGACAAACGG + Intergenic
1049495663 8:142930918-142930940 CTGTATTTCTTACAACACAATGG - Intergenic
1050243751 9:3665467-3665489 CTGTATTTATTATATAAAAACGG - Intergenic
1050847572 9:10241942-10241964 CTATATTTCTTATTTACAAATGG + Intronic
1050883583 9:10736354-10736376 CTGTATTTTTAATAGACACAGGG - Intergenic
1051016772 9:12486551-12486573 CTGTATTAATTTCAGACAGAGGG + Intergenic
1051334021 9:16050193-16050215 CTGTATTTCTTACAGCACAATGG + Intronic
1051425828 9:16930626-16930648 TTGTATTTTTAACAGACAAGAGG + Intergenic
1052391982 9:27890044-27890066 CGGTATTTCTTAAAGAAAAGAGG - Intergenic
1052548531 9:29913848-29913870 CTATATATCTTACATACACATGG - Intergenic
1053314397 9:37039220-37039242 CTGAAGTTATTACAGAAAAATGG - Intergenic
1054829420 9:69606978-69607000 CTGTATCTCTTAGAAATAAATGG - Intronic
1055165812 9:73191624-73191646 ATGTAGTTCTTACATAGAAATGG - Intergenic
1055496928 9:76864645-76864667 CAATATTTCTGACACACAAAGGG + Intronic
1056107848 9:83364889-83364911 TTGTATTTCATACATACAAGGGG - Intronic
1056151854 9:83798686-83798708 CTGTTTTTTTTGTAGACAAAGGG + Intronic
1058076852 9:100660232-100660254 CTTTATTTCTTACCGTCACATGG + Intergenic
1059058634 9:111011939-111011961 CTGCATTTTTAACAGACAACTGG - Intronic
1059620249 9:115996930-115996952 GTGTCTTTCTTAAAGACACATGG + Intergenic
1059745631 9:117198058-117198080 CTTTATTTCTTCTAAACAAAAGG + Intronic
1060721344 9:125981489-125981511 ATGTATTTCTTAAAAAAAAAAGG - Intergenic
1060763202 9:126273721-126273743 CTGTATTTTTTATAGAGACAGGG - Intergenic
1060808079 9:126590905-126590927 ATGTATTTCTTAGAGTTAAAAGG - Intergenic
1061338010 9:129955406-129955428 CTGTATTTTTTATGGAGAAAGGG + Intronic
1203584316 Un_KI270746v1:49886-49908 CTGTATTTATTACATCCAAAGGG - Intergenic
1186042852 X:5500785-5500807 CTATTTTTATAACAGACAAAAGG + Intergenic
1186058280 X:5674763-5674785 CTGTTTTTCTTAATGATAAATGG + Intergenic
1186495691 X:10011541-10011563 CTGTCTTTCTTACAGTCAAGTGG - Intergenic
1187068743 X:15866747-15866769 CTGTATTTTTTAAATACAGATGG - Intergenic
1187108665 X:16272474-16272496 CTCTATTTCATACAGAAAAATGG + Intergenic
1187134189 X:16530701-16530723 CTTTGGTTCTTACAGAAAAAAGG + Intergenic
1187209837 X:17218316-17218338 TTGTATTTTTTGTAGACAAAGGG + Intergenic
1187736335 X:22307819-22307841 TTACATTTCTTACAGATAAATGG - Intergenic
1187856232 X:23638081-23638103 CTCTATCTCCTACAGAAAAAAGG + Intergenic
1187929113 X:24277673-24277695 CTGTATTTCTGGCAGGGAAAAGG - Intergenic
1187990060 X:24860747-24860769 CTCTATCTGTTAAAGACAAAAGG - Intronic
1188689332 X:33109809-33109831 CTATATTTCATATAGACAACAGG - Intronic
1190014652 X:46816529-46816551 CTGTATTTTTAACAGAGACAGGG - Intergenic
1191969390 X:66796899-66796921 CTGTATTTATATCAGACATAAGG + Intergenic
1192024972 X:67440237-67440259 CTGTTTATTTTAAAGACAAATGG + Intergenic
1192666291 X:73090385-73090407 CTGTATTTTATAAAGACAAAAGG - Intergenic
1193302490 X:79906461-79906483 GTGTATTTCTTATAGGCAAAAGG - Intergenic
1193396690 X:80991554-80991576 CTTAATTTCTTCCAAACAAATGG - Intergenic
1194141021 X:90209801-90209823 CAGTCTGTCTTAAAGACAAAAGG - Intergenic
1194902337 X:99528255-99528277 CTGAATGTCTTACAAACATATGG + Intergenic
1195238780 X:102929934-102929956 CTGTATTTCTTCCAATGAAAAGG - Intergenic
1195486927 X:105419623-105419645 CTATATTTATTACAAACCAAGGG + Intronic
1196742170 X:119034622-119034644 CTGTATTTTTTACAGAGACAGGG - Intergenic
1197149126 X:123201009-123201031 CAGTTTTTCTTTCTGACAAATGG + Intronic
1198492907 X:137161429-137161451 CTCTATTTCTACCAGACAGAAGG + Intergenic
1198950781 X:142069036-142069058 ATGTTTTTCTTACTGACAATAGG + Intergenic
1200486786 Y:3778919-3778941 CAGTCTGTCTTAAAGACAAAAGG - Intergenic
1202023889 Y:20499450-20499472 GTGTATTTCTTATAGGCAACTGG + Intergenic