ID: 1170224558

View in Genome Browser
Species Human (GRCh38)
Location 20:13977478-13977500
Sequence ATTGATGGGGGGATAGATCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170224551_1170224558 30 Left 1170224551 20:13977425-13977447 CCGCTGGATTGGTAATCAATGAG No data
Right 1170224558 20:13977478-13977500 ATTGATGGGGGGATAGATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170224558 Original CRISPR ATTGATGGGGGGATAGATCT TGG Intronic