ID: 1170226979

View in Genome Browser
Species Human (GRCh38)
Location 20:14001784-14001806
Sequence CAGTAGCACGAGAGGGTTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 162}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170226979 Original CRISPR CAGTAGCACGAGAGGGTTGG GGG Intronic
900118602 1:1039187-1039209 GAGTAGCAGAAGAGGGGTGGGGG + Intronic
900655496 1:3754830-3754852 CAGTAGCAAGGGTGGGGTGGGGG + Intronic
902686377 1:18080252-18080274 CAGGAGCACGAGGGGGTGGGAGG + Intergenic
902756063 1:18550051-18550073 CAGGAGCAAGAGAGGGGAGGAGG - Intergenic
905365864 1:37451229-37451251 CAGCAGCAGGAGAGGGTGTGGGG + Intergenic
909025019 1:70471297-70471319 CAGAAGGAAGAGAGGGTAGGTGG - Intergenic
914443297 1:147725930-147725952 CAGTAGCTTGTGAGGGTTGTTGG + Intergenic
915018198 1:152756510-152756532 AAGAAGCACGAGAGGGGTGAGGG + Intronic
916663907 1:166948180-166948202 CAGAAGATCCAGAGGGTTGGGGG - Intronic
916944999 1:169717613-169717635 CAGGAGCAAGAGAGGGATGTGGG + Intronic
917661126 1:177178115-177178137 CAGTAGCACGAGGGGTGAGGAGG - Intronic
918284915 1:183042800-183042822 CAGTGCCAGGAGAGGGCTGGGGG - Intronic
918767128 1:188500522-188500544 TAGGAGCAAGAGAGAGTTGGGGG - Intergenic
920898050 1:210077225-210077247 CAGGAGCAAGAGAGAGTCGGTGG + Intronic
921339058 1:214116272-214116294 CAGCAGAAAGAAAGGGTTGGAGG - Intergenic
921981908 1:221267966-221267988 CAGGAGCAAGAGAGGGTTGAGGG + Intergenic
1065267442 10:23992439-23992461 GAGTAACAGGAGAGGGATGGAGG + Intronic
1065872932 10:29971480-29971502 CAGGAGCACGAGAGAGAGGGGGG + Intergenic
1068955737 10:62817705-62817727 AAGTAAAACGAGTGGGTTGGGGG - Intronic
1070619898 10:78001296-78001318 CAGGAGCATGTGTGGGTTGGAGG + Intronic
1071602072 10:86963171-86963193 CAGAAGGACCAGAGGGTGGGTGG - Exonic
1073448218 10:103593416-103593438 CAAAAGCAGGAGAGGGTCGGGGG + Intergenic
1077399716 11:2348237-2348259 CAGGAGCAAGAGAGAGGTGGGGG - Intergenic
1077891562 11:6421698-6421720 CAGAAGCAAGAGAGTGTGGGGGG - Intergenic
1084952320 11:72673638-72673660 CTGGAGCAAGAGAGGGTTAGAGG - Intronic
1084980110 11:72824504-72824526 CAGGAGCAGGGTAGGGTTGGTGG - Intronic
1089500381 11:118928538-118928560 CACTAGCCCGAGAAGGTGGGAGG + Intronic
1089757076 11:120695116-120695138 CAGCAGGAGGAGAGGGCTGGGGG - Intronic
1091197290 11:133742683-133742705 CACTAAGACGAGGGGGTTGGTGG - Intergenic
1093655864 12:21693853-21693875 CAGTAACACGATGGAGTTGGAGG + Intronic
1098454511 12:70656997-70657019 TAGTAGGATGAGAGGGGTGGGGG + Intronic
1100457352 12:94765252-94765274 TAGGAGAACGAGATGGTTGGGGG - Intergenic
1101128644 12:101666024-101666046 CAGTATCAGGAGAGGAGTGGAGG - Intronic
1102810428 12:115819576-115819598 CAGGAGCATGAGAGAGTGGGAGG + Intergenic
1103890729 12:124237247-124237269 CAGTAGCCCCACAGGGCTGGTGG - Intronic
1105503645 13:20992234-20992256 CAGCAGCACGCAAGGGTAGGTGG + Intronic
1110059809 13:71027112-71027134 CAGTAGCAGGTGTGGGTTGTAGG + Intergenic
1110073701 13:71211646-71211668 CAGGAGGAAGAGAGAGTTGGGGG + Intergenic
1111308860 13:86454376-86454398 CAGTACAGCGGGAGGGTTGGTGG + Intergenic
1112107097 13:96252820-96252842 CAGGAGCAAGGGAGAGTTGGGGG - Intronic
1112252102 13:97791942-97791964 CAGGAGCAAGAGAGGGTAAGAGG + Intergenic
1112441241 13:99426436-99426458 CAGTGGCAGGAGAGGGGTGCAGG - Intergenic
1112688485 13:101861341-101861363 CAGAAGCAGGACAGGGTGGGTGG - Intronic
1114216646 14:20662211-20662233 CAGTGACCCGGGAGGGTTGGGGG - Intergenic
1117209422 14:53480558-53480580 CAGGAGCAAGAGAGGATTGGGGG + Intergenic
1117888268 14:60388557-60388579 CAGGAGCAAGAGAGGGCAGGAGG - Intergenic
1117941675 14:60973396-60973418 CAGGAGCAAGAGAGTGTGGGGGG + Exonic
1118011184 14:61612145-61612167 CAGAAGCAGGAGATGTTTGGTGG - Intronic
1122557597 14:102590103-102590125 CAGAGGCAGGAGAGGGTTTGGGG + Intergenic
1128091264 15:64920384-64920406 CAGTTGCTCCAGAGAGTTGGTGG + Intronic
1128214710 15:65926298-65926320 CTGTGGCATGAGAAGGTTGGTGG + Intronic
1132373104 15:101311425-101311447 CAGGAGCAAGAGAGGGAAGGAGG - Intronic
1132413592 15:101604442-101604464 CAGTAGCCGGAGAGGACTGGGGG - Intergenic
1133390854 16:5408789-5408811 CAGGAGCAAGACAGAGTTGGGGG + Intergenic
1134231723 16:12435073-12435095 CAGGCCCAGGAGAGGGTTGGAGG + Intronic
1135576574 16:23590605-23590627 CAGGAGCATGAGAGGGTAGTAGG - Intronic
1135815341 16:25627463-25627485 CAGGAGCAAGAGAGGGAGGGAGG + Intergenic
1137570078 16:49559472-49559494 CTGCAGCAGGAGAGAGTTGGAGG - Intronic
1139084084 16:63562757-63562779 CAGGAGCAAGAGAGAGTGGGAGG - Intergenic
1143377253 17:6474096-6474118 CAGGAGAAGGAGAGGGTGGGAGG + Intronic
1144012402 17:11162089-11162111 CAGGAGCAAGTGAGAGTTGGAGG - Intergenic
1144737450 17:17563103-17563125 CAGCAGCAGGGGAGAGTTGGAGG + Intronic
1145772498 17:27503774-27503796 TAGGAGCACGAGAGGGTAGGAGG - Intronic
1147475837 17:40710751-40710773 CAGGAGCAAGAGAGAGATGGGGG + Intergenic
1148847718 17:50538950-50538972 CAGGAGCACGAGAAGGTAGTGGG + Exonic
1151725108 17:75878876-75878898 CAGAAGGACCAGAGGGATGGAGG - Intergenic
1151961959 17:77410232-77410254 CAGTAGCAGCAGTGGGATGGGGG - Intronic
1152670081 17:81598279-81598301 CAGCAGCACCAGAGGGAGGGTGG - Intronic
1155071774 18:22323149-22323171 CAGGAGGAGGAGAGGGCTGGGGG + Intergenic
1156866206 18:41891498-41891520 CAAAAGCAAGAGAGTGTTGGGGG - Intergenic
1161575385 19:5051889-5051911 CAGAGGCAGGAGAGGGTGGGCGG - Intronic
1162178276 19:8847788-8847810 CAGGAGCAAGGGAGAGTTGGGGG - Intergenic
1162807973 19:13148776-13148798 CTGTTGCAGGAGAGGGCTGGGGG - Intronic
1164539520 19:29112471-29112493 CAGTGGCACAAGAGGGTTCTAGG + Intergenic
1164965177 19:32477107-32477129 CAATAGCAGGAGAGGATTGTGGG + Intronic
1168093813 19:54103041-54103063 GGGTGGCACGAGAGGGTTAGAGG + Intronic
1168507999 19:56952493-56952515 CAGCAGGACGTGAGGGTGGGTGG - Intergenic
926841187 2:17082232-17082254 AAGTAGCAAGATAGGGTTGGTGG - Intergenic
927455207 2:23242859-23242881 CAGGAGCAGGAGAAGGTTGGGGG - Intergenic
934946561 2:98546697-98546719 AAGTAGCCAGAGAGGGTTTGTGG + Intronic
937620039 2:123974869-123974891 CAGTAGCCTAAGAGGATTGGTGG + Intergenic
939779729 2:146430914-146430936 CAGGAGCAAGAGAGAGTGGGGGG - Intergenic
941319633 2:164038985-164039007 CAGGAGCAAGAGAGGGAGGGTGG + Intergenic
942430448 2:175905816-175905838 CAGAAGCATGAGGGAGTTGGAGG - Intergenic
947895187 2:233664600-233664622 CAGGATCAAGAGAGAGTTGGTGG + Intronic
947906867 2:233771008-233771030 CAGGAGCGAGAGAGAGTTGGGGG + Intronic
1169275059 20:4228178-4228200 CAGAAGGATGAGGGGGTTGGTGG - Intronic
1169497999 20:6133228-6133250 CAGCAGCACACGTGGGTTGGTGG - Intergenic
1170226979 20:14001784-14001806 CAGTAGCACGAGAGGGTTGGGGG + Intronic
1170953079 20:20954294-20954316 CAGTAGCACTCGTGGGTTGCTGG + Intergenic
1171419866 20:25010851-25010873 CAGCAGCACCAGAGGCTTGCTGG + Intronic
1176097557 20:63351286-63351308 CAGGAGCACAAAAGGGCTGGCGG + Intronic
1182192539 22:28477782-28477804 CAGTTGTACGAGAGGGCAGGTGG - Intronic
1183264010 22:36814681-36814703 CACTAGTACCAGAGGGCTGGGGG + Intronic
1183659704 22:39211990-39212012 CAGAAGCACGAGAGAGTGGGGGG - Intergenic
950705987 3:14782118-14782140 CAGGAGCAAGAGAGAGTGGGTGG - Intergenic
953887486 3:46723729-46723751 CAGGAGCACCAGAGAGTGGGGGG + Intronic
954139480 3:48597439-48597461 CGGAGGCACGAGTGGGTTGGAGG - Intergenic
958711157 3:97718655-97718677 CAGTAGCTTAAGAGTGTTGGGGG - Intronic
960281322 3:115784283-115784305 CAGCAGCGCGAGCGGGTGGGCGG + Intergenic
960724865 3:120659927-120659949 CAGGAGCAAGAGAGAGTGGGGGG + Intronic
964852994 3:161115197-161115219 CAGGAGCAAGAGAGGGGTGGAGG + Intronic
967718391 3:192789311-192789333 CAGGAGCCCAGGAGGGTTGGGGG - Intergenic
970744509 4:19279200-19279222 CAGGAGCGAGAGAGGGTGGGAGG + Intergenic
970801711 4:19979706-19979728 CAGGAGCAAGAGAGAGATGGGGG - Intergenic
971550739 4:27952942-27952964 CAGGAGCAAGAGAGAGATGGAGG + Intergenic
972289469 4:37678151-37678173 CAGGAGCAAGAGAGAGTTGGGGG + Intronic
972754532 4:42032069-42032091 CAGGAGCAAGAGAGAGATGGGGG + Intronic
973009980 4:45060866-45060888 CAGGAGCAAGAGAGAGTTTGAGG - Intergenic
973091116 4:46137565-46137587 CAGGAGCAAGAGAGGGGTGGGGG - Intergenic
973582865 4:52361496-52361518 GAGAAGCAAGAGAGAGTTGGGGG - Intergenic
973614101 4:52661929-52661951 TAGGAGCAAGAGAGAGTTGGCGG - Intergenic
974101125 4:57418364-57418386 TAGTAGCACGACAGGCTTTGAGG + Intergenic
975830687 4:78365398-78365420 CAGGAGCAAGAGAGTGCTGGTGG + Intronic
975834203 4:78404550-78404572 CAGAAGGAGGAGGGGGTTGGAGG - Intronic
978209104 4:106113812-106113834 GAGTAGCAGGTGAGGGTTGCAGG - Intronic
979452582 4:120890248-120890270 CAGGAGCAAGAGAGAGTAGGGGG + Intronic
981453188 4:144922461-144922483 CAGAAGCACTGGAGGATTGGAGG + Intergenic
981750852 4:148091319-148091341 CTGTAGCAGGCCAGGGTTGGGGG - Intronic
982271914 4:153599195-153599217 CAGGAGCACGAGAGGGGAGAAGG + Intronic
984116938 4:175693979-175694001 CAGGAGCAAGAGAGAGTAGGGGG - Intronic
986305417 5:6510679-6510701 CAGGATCAAGAGAGAGTTGGGGG + Intergenic
986454971 5:7909059-7909081 CAGTAGTATGAGAAGGCTGGGGG + Intergenic
986461015 5:7972358-7972380 CTGGAGCAAGAGAGAGTTGGGGG - Intergenic
986589887 5:9357649-9357671 GAGTGCCAAGAGAGGGTTGGAGG + Intronic
992614060 5:78532963-78532985 CTGCAGCACGACAGGGTTGTTGG - Intronic
994739569 5:103600954-103600976 TAGAGGCAAGAGAGGGTTGGAGG - Intergenic
1000900469 5:166905947-166905969 CTGTAGCAGGAAAGGGTTGAAGG - Intergenic
1007844423 6:44741743-44741765 CAGTAGGACATGAGGGTGGGAGG + Intergenic
1012201424 6:96411136-96411158 CAAGAGCAAGAGAGTGTTGGGGG + Intergenic
1012805421 6:103886723-103886745 AAGAAGCAAGAGAGGGTTAGAGG + Intergenic
1012867983 6:104641023-104641045 CAGGAGCAAGAGAGGGTGGGAGG - Intergenic
1013178120 6:107694515-107694537 CAGGAGCAAGAGAGGGTGGGAGG + Intergenic
1014858199 6:126429478-126429500 CAGGAACAAGAGAGAGTTGGGGG - Intergenic
1018930753 6:168238877-168238899 CAGTAGGTGGAGAGGGTTGTGGG - Intergenic
1018950242 6:168374297-168374319 CAGTGGCAGAAGAGGGATGGCGG - Intergenic
1020923877 7:14299194-14299216 CAGTAGAAGGAGAGTATTGGAGG + Intronic
1021787382 7:24165173-24165195 CAGTAGCAACAGAGGGTGGGAGG + Intergenic
1022753022 7:33252109-33252131 CAGGAGCAAGAGAGGGAGGGGGG + Intronic
1022807326 7:33835568-33835590 CAGTATCAGGAAAGGGGTGGAGG + Intergenic
1022907834 7:34873569-34873591 CAGGAGCAAGAGAGAGGTGGAGG + Intronic
1026760326 7:73121746-73121768 CAGCTGCACCACAGGGTTGGCGG + Intergenic
1027036668 7:74930567-74930589 CAGCTGCACCACAGGGTTGGCGG + Intergenic
1027086895 7:75270892-75270914 CAGCTGCACCACAGGGTTGGCGG - Intergenic
1027270453 7:76515776-76515798 CATATGCACAAGAGGGTTGGAGG - Intronic
1030979775 7:116172413-116172435 CAGTAACCTGTGAGGGTTGGAGG - Intergenic
1031170374 7:118285814-118285836 CAATAGGAAGAGAGAGTTGGAGG + Intergenic
1031386763 7:121161051-121161073 AAGTAACACGGAAGGGTTGGAGG - Intronic
1032435661 7:131898355-131898377 CAGTTGTACAAGAGGGTAGGCGG + Intergenic
1032536505 7:132668964-132668986 CAGGAGCAAGAGAGAGATGGAGG + Intronic
1035996289 8:4551204-4551226 CAGTATTACAGGAGGGTTGGTGG - Intronic
1036134666 8:6149666-6149688 CAGGAGCAAGAGAGGGGAGGGGG + Intergenic
1036158262 8:6362613-6362635 CAGTAGCAGGAGAGGAGTGGAGG - Intergenic
1036824467 8:11965521-11965543 CAGGAGCCCAAGAGGGTTGAGGG + Intergenic
1038396248 8:27247654-27247676 CAGTTCCAGGAGAGGTTTGGTGG - Intronic
1038787806 8:30636767-30636789 CACTTGAACGAGAGAGTTGGAGG + Intronic
1042387679 8:68196729-68196751 CAGGAGGAAGAGAGAGTTGGGGG - Intronic
1046616387 8:116482157-116482179 CAGCAGCAGGAGAGGGCAGGAGG - Intergenic
1048207159 8:132424411-132424433 CTGTCGAATGAGAGGGTTGGGGG - Intronic
1049195711 8:141314561-141314583 CAGAAGCACGAGAGGGGTGAGGG + Intergenic
1050128031 9:2379831-2379853 CAGAAGCAAGAGAGGGAGGGAGG - Intergenic
1050422338 9:5478642-5478664 CAGAGGCTGGAGAGGGTTGGGGG - Intergenic
1056517729 9:87371228-87371250 AAGTAGCACGGGAAGGTTTGTGG + Intergenic
1057622330 9:96647122-96647144 CAGTAGCATGACATGGTAGGAGG - Intronic
1057799732 9:98183200-98183222 CAGTAGCAACAGAGGGTTGGAGG - Intronic
1061678570 9:132231606-132231628 GAAAAGCAAGAGAGGGTTGGGGG - Intronic
1189011936 X:37054375-37054397 AAGGTGCAAGAGAGGGTTGGGGG - Intergenic
1191110984 X:56803103-56803125 CAGGAGCACGAAAGAGATGGTGG + Intergenic
1192563812 X:72145989-72146011 CATTAGCACAAGAGGATTTGGGG + Intergenic
1192860030 X:75057884-75057906 CAGTGGCACAAGAGGGTCTGTGG + Intronic
1194280073 X:91940162-91940184 CAGGAGCAAGAGAGGCATGGGGG - Intronic
1194668166 X:96698364-96698386 AAGCAGCAGGAGAGGGTAGGTGG - Intronic
1196028822 X:111073117-111073139 CAGTAGCTGGACTGGGTTGGAGG + Intronic
1198717455 X:139573507-139573529 CAGGAGCAGGAGAGTGATGGGGG - Intergenic
1199993400 X:153003127-153003149 CAGGAGCAAGAGAGAGATGGAGG + Intergenic
1200206526 X:154320398-154320420 AAGTAGCACAAGAGGGGAGGAGG + Intronic
1200597548 Y:5163663-5163685 CAGGAGCAAGAGAGGCATGGGGG - Intronic
1201003811 Y:9492254-9492276 CAGTAGCACGTGTGTGTTTGTGG + Intergenic
1201220461 Y:11764800-11764822 CAGAAGCAGGACTGGGTTGGTGG + Intergenic