ID: 1170231375

View in Genome Browser
Species Human (GRCh38)
Location 20:14050362-14050384
Sequence CCTTATTTTGGCAGTCTTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 149}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170231367_1170231375 -6 Left 1170231367 20:14050345-14050367 CCCAAAAGTAAAGCCTTCCTTAT 0: 1
1: 0
2: 2
3: 27
4: 288
Right 1170231375 20:14050362-14050384 CCTTATTTTGGCAGTCTTGGGGG 0: 1
1: 0
2: 2
3: 10
4: 149
1170231368_1170231375 -7 Left 1170231368 20:14050346-14050368 CCAAAAGTAAAGCCTTCCTTATT 0: 1
1: 0
2: 0
3: 29
4: 313
Right 1170231375 20:14050362-14050384 CCTTATTTTGGCAGTCTTGGGGG 0: 1
1: 0
2: 2
3: 10
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170231375 Original CRISPR CCTTATTTTGGCAGTCTTGG GGG Intronic
904203253 1:28835566-28835588 GCTTGTTTTGCCAGTCGTGGAGG + Intronic
906290478 1:44616672-44616694 CCATATTTTGGCTGTCCAGGAGG + Intronic
910122890 1:83809858-83809880 TTTTATTTTGGTAGTTTTGGGGG - Intergenic
912991852 1:114495200-114495222 CTCTATTTTGGCAGGCATGGGGG - Intronic
913974366 1:143442728-143442750 CTTTATTCTGTCAGTGTTGGTGG + Intergenic
914068756 1:144268342-144268364 CTTTATTCTGTCAGTGTTGGTGG + Intergenic
914110399 1:144698012-144698034 CTTTATTCTGTCAGTGTTGGTGG - Intergenic
918553427 1:185770840-185770862 CCTTATTAAGGCAGTGTTTGTGG + Intronic
920103188 1:203531195-203531217 CCTCACTCTGCCAGTCTTGGAGG - Intergenic
921287495 1:213622302-213622324 ACTTATTTTGCCAGTCGTGGAGG + Intergenic
921719042 1:218450209-218450231 CTTTATGTAGGCAGTCTTGCTGG - Intergenic
922353672 1:224756399-224756421 CCTTATTTGGGCAGTGCTAGAGG - Intergenic
923848537 1:237765697-237765719 CCTTATTCTGCCATTCTTGTGGG + Intronic
1062948580 10:1478847-1478869 CCTTATTTTGGCACTCCTGTCGG - Intronic
1063303139 10:4871682-4871704 CTTTATTTTGGCAGTTGTGGGGG + Intergenic
1065268566 10:24002659-24002681 TTTTATTTTGGTAGTTTTGGGGG + Intronic
1067090114 10:43262148-43262170 CCAGATTTGGGCAGCCTTGGTGG + Intronic
1068375864 10:56179701-56179723 CCTTTTTTTGGCAGTATAGAAGG - Intergenic
1071303327 10:84274268-84274290 GCTTGTTTTGCCAGTCATGGAGG + Intergenic
1079324281 11:19478192-19478214 CCTCCTTTTGGCAGGCATGGTGG + Intronic
1079614783 11:22478805-22478827 CCTTATATTTGCAGTATTTGGGG + Intergenic
1085981981 11:81736152-81736174 CTTCCTTTTGGCAATCTTGGAGG + Intergenic
1088795776 11:113265758-113265780 CCATCTTCTGGGAGTCTTGGGGG + Intronic
1091141515 11:133239269-133239291 CATTCTTTTGCCAGCCTTGGTGG + Intronic
1091209838 11:133846721-133846743 CCCTGCTTTGGCAGTCATGGAGG - Intergenic
1093744388 12:22722984-22723006 CCTAGTTTTGGCAGGATTGGTGG - Intergenic
1095649340 12:44588437-44588459 CGTCATTTTGGCAGTCTGAGGGG - Intronic
1097953263 12:65456486-65456508 CCTAATTTTGGCATTGTTTGTGG - Intronic
1098656642 12:73039381-73039403 CCCCATTGTGGCAGTATTGGGGG + Intergenic
1099747447 12:86723465-86723487 CCTGGTTTTGGCAGCCTCGGGGG + Intronic
1101418244 12:104527300-104527322 CTTTATTTTGGCAGCCTGAGTGG + Intronic
1101746335 12:107544427-107544449 CCTCATGAAGGCAGTCTTGGAGG + Intronic
1103171899 12:118827953-118827975 CCTTTTGTTGGTAATCTTGGGGG + Intergenic
1103804340 12:123560646-123560668 CTTCACTTTGACAGTCTTGGGGG + Intergenic
1104789447 12:131472668-131472690 CCTGATTTTGGCAGTGATGGCGG + Intergenic
1106043331 13:26114885-26114907 CCTCTTTATGGCAGTCTTGGGGG + Intergenic
1106550752 13:30768922-30768944 CCCTAGTGTGGCAGTGTTGGAGG - Intergenic
1108789189 13:53946171-53946193 CCTTATTTTCCCTGTCTTGTAGG + Intergenic
1111268239 13:85848051-85848073 GGTTATTTTGGCAGTTTTAGAGG - Intergenic
1112663994 13:101547078-101547100 CATTATTTTTGTAATCTTGGTGG - Intronic
1113080818 13:106518050-106518072 CCTTATGTTGCCAGGCGTGGTGG + Intronic
1119063019 14:71495489-71495511 CCTGATTTTGGTAATTTTGGGGG + Intronic
1121067353 14:90980882-90980904 CCTTATATTGCCAGGCGTGGTGG + Intronic
1124101474 15:26698132-26698154 CATTTCTTTGGCAGTCTGGGAGG - Intronic
1126770371 15:52049898-52049920 CCTTAATTTGCCAGGCGTGGTGG - Intronic
1128962327 15:72020188-72020210 CCTTATTTTTCCATTGTTGGAGG - Intronic
1129528308 15:76238481-76238503 CCTGATTGAGGCAGTCTTAGGGG - Intronic
1130825843 15:87545614-87545636 TTTTATTTTGACATTCTTGGAGG + Intergenic
1131931271 15:97444911-97444933 CATTTTTCTGACAGTCTTGGTGG - Intergenic
1131957926 15:97757608-97757630 CCTTATTTGGGCACTCTGGCAGG + Intergenic
1138297417 16:55898913-55898935 CCTCATAATGGAAGTCTTGGTGG + Intronic
1140088485 16:71817627-71817649 TATTATTTTGGCACTTTTGGAGG + Intergenic
1143004620 17:3821352-3821374 GCTTATTTTGGCATTCTTGCAGG - Exonic
1143325856 17:6097845-6097867 CCTTATTTTGTGTGTGTTGGGGG + Intronic
1143726147 17:8847951-8847973 CCTGCTTATTGCAGTCTTGGTGG + Intronic
1146281598 17:31548853-31548875 GCTTAATTTGGCAGTGGTGGTGG + Intergenic
1146621135 17:34398846-34398868 ACTCCTTTTGGCAGTGTTGGTGG - Intergenic
1151103863 17:71589184-71589206 CCTTATTTTCACATTCTTGGTGG + Intergenic
1156701068 18:39825612-39825634 GCTTATGTTGGCAGTCTTGGTGG - Intergenic
1158783955 18:60686242-60686264 TCTGATTTTGGAAGTCCTGGGGG - Intergenic
1159666445 18:71167221-71167243 CCGTATTTGGGGAGTCCTGGGGG - Intergenic
1160813187 19:1022179-1022201 CTTTTTTTTGGCGGGCTTGGTGG - Intergenic
1161626741 19:5331418-5331440 CCTGATTTTGCCAGGCATGGTGG - Intronic
1165331459 19:35143014-35143036 CGTTTTATTGGAAGTCTTGGCGG - Exonic
1165465493 19:35972315-35972337 CCTTATTTTGCCTCACTTGGTGG - Intergenic
1166919083 19:46216227-46216249 CTTGATTATGGCAGTCCTGGGGG + Intergenic
1166922057 19:46235381-46235403 CTTGATTATGGCAGTCCTGGGGG + Intergenic
1167067994 19:47201594-47201616 TCTCATTTTGGCCGTATTGGAGG - Intronic
1167859902 19:52274217-52274239 TCTGATTTGGGTAGTCTTGGGGG - Intronic
924972414 2:141025-141047 TCTTATTTTCTAAGTCTTGGAGG - Intergenic
925964251 2:9048889-9048911 GCTTATTTTAGCAGTGTTGTGGG + Intergenic
926759399 2:16264288-16264310 CCTAATTTTGTCAGCATTGGGGG + Intergenic
930926647 2:56826301-56826323 CTTTATTTTTGCATTTTTGGTGG + Intergenic
931424258 2:62156802-62156824 CCTTATTTAATCAGTCTTTGAGG + Intergenic
931504089 2:62904733-62904755 CTTTGCTTTGGCAGTCTGGGAGG - Intronic
932017392 2:68045072-68045094 CCTTATTTTGAAGTTCTTGGGGG - Intronic
933429929 2:82163226-82163248 ACTTATTTTGGGAGTCTGAGAGG + Intergenic
934179070 2:89603703-89603725 CTTTATTCTGTCAGTGTTGGTGG + Intergenic
934289356 2:91677973-91677995 CATTATTCTGTCAGTGTTGGTGG + Intergenic
941059426 2:160828289-160828311 CATTGTTTTGGCTGTCTTAGAGG + Intergenic
945015167 2:205507580-205507602 CCTTATTTATGGAGTCTGGGTGG - Intronic
1170231375 20:14050362-14050384 CCTTATTTTGGCAGTCTTGGGGG + Intronic
1170868537 20:20183087-20183109 CCTTTTTTTGGCAGACTCTGAGG - Intronic
1173187489 20:40851880-40851902 CCTAATTTTAGCAGTCTGGGAGG - Intergenic
1173539647 20:43841996-43842018 ACTTATTTTGATATTCTTGGTGG + Intergenic
1182239972 22:28908312-28908334 CCTTCTCCTGGGAGTCTTGGTGG + Intronic
949295930 3:2522728-2522750 CCATATGATGTCAGTCTTGGTGG + Intronic
949399401 3:3649952-3649974 CCTTATTTTTGCAGGCTTTATGG + Intergenic
949611506 3:5708045-5708067 CCTTAGTTGGGATGTCTTGGAGG - Intergenic
951119862 3:18914001-18914023 CTTTATTTTAGCTGTTTTGGAGG - Intergenic
951557427 3:23934938-23934960 CCTTATTTTGCCATTCTTTCAGG - Intronic
952561853 3:34604178-34604200 TCTGATTATGGCATTCTTGGGGG - Intergenic
958027284 3:88063269-88063291 CCTTACTTTGGGACTCTTAGTGG + Intronic
958424888 3:93968520-93968542 CTTTATTATGGCAGTCCTAGGGG + Intronic
959141667 3:102493426-102493448 GCATTTTTTGGCAGCCTTGGTGG + Intergenic
960720805 3:120622861-120622883 CCTTAGTTGGGAAGCCTTGGAGG - Intergenic
960889705 3:122434664-122434686 TCTTATTTTGGTAATCTGGGAGG - Intronic
963878555 3:150503207-150503229 GATTATTTTGGCTGTCTTTGTGG - Intergenic
964554163 3:157917477-157917499 CCATTTTCTGGCAGTCTGGGAGG + Intergenic
966656737 3:182366901-182366923 CCTTTTTTTGGGAGTGGTGGTGG - Intergenic
967116001 3:186339609-186339631 CATTATTTTGGAAGATTTGGGGG - Intronic
969574458 4:8028879-8028901 TCTTATTTTTGCAGCCTTTGTGG - Intronic
969830214 4:9789913-9789935 CTTTATTCTGTCAGTGTTGGTGG - Intronic
976415961 4:84774954-84774976 CATTAATTTGGCATTCTTTGAGG + Exonic
976602533 4:86950914-86950936 CATTATTTTCACAATCTTGGAGG - Intronic
979374786 4:119933490-119933512 CCTTGTTTTGGCAACCTTGTAGG - Intergenic
982296202 4:153832297-153832319 CCTTATTTTGGATGGCTTGAAGG - Intergenic
982418836 4:155169765-155169787 CCTCATTTTGGCAGCCTATGAGG - Intergenic
984455733 4:179965733-179965755 CTGTGTTTTAGCAGTCTTGGTGG - Intergenic
988151091 5:27381402-27381424 ATTTATTTTGTCAGTTTTGGGGG - Intergenic
990356312 5:54969741-54969763 ACTTAGTTAGACAGTCTTGGTGG - Intergenic
990494044 5:56329011-56329033 TCATATTTTTGCATTCTTGGAGG + Intergenic
990986711 5:61647466-61647488 CCTTGTCTTGGCAGTCCAGGAGG - Intronic
995190044 5:109310213-109310235 GCTTATTTTGGCATTCTGTGTGG - Intergenic
997067303 5:130576654-130576676 ACTTAATTTGGCAGTTTAGGTGG + Intergenic
997821027 5:137066044-137066066 CCTTATAATGGCAGACTTGGAGG + Intronic
999553910 5:152720517-152720539 CCTCACTGTGGCAGCCTTGGGGG + Intergenic
1002107839 5:176888926-176888948 CCTTCTTTGGGAACTCTTGGAGG - Intronic
1002201907 5:177533628-177533650 ACTTATTTTGGAGGACTTGGGGG - Intronic
1002934873 6:1662933-1662955 CCTTATTCTGACAGTCTCGTTGG - Intronic
1003002268 6:2347241-2347263 CATTTGTTTGGCAGCCTTGGTGG + Intergenic
1007413279 6:41677604-41677626 CTGTATTTTGGCAGGCCTGGTGG - Intergenic
1009159375 6:60262758-60262780 TCTTTTTTTTGCAGTTTTGGGGG + Intergenic
1011638421 6:89397196-89397218 CCTAATTTTAGCTGTCTTAGTGG - Intronic
1011756819 6:90508604-90508626 CCTTATTTTGTCTGTTTGGGGGG + Intergenic
1015726190 6:136301904-136301926 CATTATTTTGCCAGGCATGGTGG + Intergenic
1016429758 6:143970586-143970608 CTTTATTTGGTCAGTCTGGGTGG + Intronic
1019101326 6:169632946-169632968 CTTTATTTTGGCAGATTTGATGG + Exonic
1020782548 7:12535133-12535155 TCTTATTTTGGCTATTTTGGTGG - Intergenic
1021607919 7:22427816-22427838 CATTACCTTGGCAGTCTTGCTGG - Intronic
1023968682 7:44976731-44976753 CCCCATCTTGCCAGTCTTGGGGG - Intronic
1024406934 7:48992690-48992712 CGTTTGTTTGGCATTCTTGGTGG + Intergenic
1024540153 7:50469439-50469461 TCTTATTCTGGCAATTTTGGGGG + Intronic
1037327639 8:17709719-17709741 CCTTAATTTGCCAGGCGTGGTGG + Intronic
1039604677 8:38870802-38870824 CCTCATTCTGGCAGTATTTGGGG - Intergenic
1040029437 8:42811122-42811144 GCTTTTTTTGACAGTTTTGGAGG - Intergenic
1040329759 8:46379857-46379879 CCTGATTTGGACAGCCTTGGGGG - Intergenic
1040576033 8:48652302-48652324 TCTTATTTTGGCTGTTGTGGTGG - Intergenic
1041976642 8:63806597-63806619 GCTGATTTTAGAAGTCTTGGAGG + Intergenic
1043536233 8:81207681-81207703 CGTTATATTTTCAGTCTTGGTGG - Intergenic
1043949103 8:86288140-86288162 TCTTAATTTGGCATTCTTAGTGG - Intronic
1044825143 8:96188814-96188836 CCCTAGTTTGGAAGTGTTGGAGG + Intergenic
1051027664 9:12632880-12632902 TCTCATTTTGTCATTCTTGGAGG - Intergenic
1051782715 9:20707811-20707833 TGTTATTTTGGGAGTGTTGGTGG + Intronic
1051991159 9:23153992-23154014 CCTAAGTTTTGCAGTCTTTGTGG + Intergenic
1055739047 9:79365659-79365681 CCTTATTTTGGCTGTCCTGGTGG - Intergenic
1055909548 9:81332376-81332398 TTTTATTTTAGCAGTCTTAGTGG - Intergenic
1056008863 9:82303687-82303709 CATTGTTTTGGCTGTCTTTGTGG + Intergenic
1057878902 9:98778416-98778438 CGTTCCTTTGGCAGTCCTGGTGG - Exonic
1058922960 9:109635163-109635185 CATTATTTTGTCAGTTTTTGTGG - Intergenic
1060668966 9:125451599-125451621 CCTTAAATTGGCAGTTGTGGTGG + Intronic
1185820396 X:3197446-3197468 TCTTATTTTGGCTGTTGTGGTGG + Intergenic
1186124597 X:6399498-6399520 CCTGATTTTGGAAGGCTTTGAGG - Intergenic
1188698832 X:33233720-33233742 CCGTATTTTGACTGTCGTGGTGG + Intronic
1189856824 X:45232051-45232073 CCACATTGTGGCAGTCATGGAGG + Intergenic
1192501732 X:71658586-71658608 CCTTCTTGTGTCAGTCTTGGCGG - Intergenic
1192508826 X:71709619-71709641 CCTTCTTGTGTCAGTTTTGGCGG - Intergenic
1192517871 X:71771934-71771956 CCTTCTTGTGTCAGTTTTGGCGG + Intergenic
1194797125 X:98225621-98225643 CCCTATATTGGCAGTCATGCTGG + Intergenic
1197366511 X:125570342-125570364 CCTCATTGTGTGAGTCTTGGAGG - Intergenic
1198573618 X:137986084-137986106 CCATCTTTTGGAATTCTTGGAGG - Intergenic
1198925946 X:141795646-141795668 CCTTTTCTTGACAGTCTTGATGG + Intergenic