ID: 1170232461

View in Genome Browser
Species Human (GRCh38)
Location 20:14065237-14065259
Sequence GAGGAGTCCTAACACCAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 108}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170232461_1170232463 -8 Left 1170232461 20:14065237-14065259 CCCTCTTGGTGTTAGGACTCCTC 0: 1
1: 0
2: 0
3: 8
4: 108
Right 1170232463 20:14065252-14065274 GACTCCTCGCATCTGATCTGTGG 0: 1
1: 0
2: 0
3: 4
4: 71

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170232461 Original CRISPR GAGGAGTCCTAACACCAAGA GGG (reversed) Intronic
902233601 1:15043897-15043919 GAGGGGGCCTAACTCCTAGATGG - Intronic
902722058 1:18310297-18310319 GAGGTTTCCTTCCACCAAGAGGG + Intronic
904042020 1:27590627-27590649 AAGGAGAGCTAAGACCAAGAGGG - Intronic
907534321 1:55135879-55135901 CTGGAGTCCTAACACAGAGAAGG + Intronic
914313236 1:146486182-146486204 GAGGTGTCCTATCCCCAGGATGG - Intergenic
914501111 1:148247199-148247221 GAGGTGTCCTATCCCCAGGATGG + Intergenic
917345218 1:174022295-174022317 GAGGAGGCCGAGCAACAAGATGG - Exonic
918091287 1:181297314-181297336 GAGGGCTACTAACACAAAGAGGG + Intergenic
920757540 1:208748603-208748625 GAGGAGTAGGGACACCAAGATGG - Intergenic
922010901 1:221585960-221585982 GAGGAGCTTAAACACCAAGAAGG + Intergenic
922455027 1:225767729-225767751 GAGGCTTCCCAACACCAAGACGG + Intergenic
923133219 1:231095456-231095478 GAGATGTACTAACACCAGGATGG + Intergenic
1063383526 10:5601733-5601755 CAGGAGTCCTAACACCAGCCAGG + Intergenic
1063417727 10:5888060-5888082 GAGGAGTCCTAAGGCCAACCAGG + Exonic
1064531417 10:16314442-16314464 GAGAAATCCTGACACCTAGAGGG - Intergenic
1065357260 10:24854626-24854648 GCCTAGTTCTAACACCAAGAAGG - Intronic
1065562736 10:26979830-26979852 GAAGAGTCCTCAGACCGAGAGGG + Intergenic
1068887254 10:62110378-62110400 GAGAATTCCCAACACCAAAAAGG + Intergenic
1069756950 10:70779338-70779360 GAGGAGTAATAACACACAGAGGG - Intronic
1069757168 10:70780386-70780408 GAGGAGTCCTGGCACCAAAAGGG - Intronic
1071262789 10:83936006-83936028 GAGGAGGCCCAGGACCAAGAGGG - Intergenic
1071452333 10:85809564-85809586 AAGGAGTGCTATCAGCAAGATGG + Intronic
1075688199 10:124378384-124378406 GAGGAGGCCTGAGTCCAAGAAGG + Intergenic
1077455055 11:2673431-2673453 AAGGAGGCCCAACACCAAGTTGG - Intronic
1079306755 11:19330115-19330137 GGGGAGTCCTGGCACCAAGCAGG - Intergenic
1083682666 11:64358642-64358664 GAGGAGCCTCATCACCAAGAGGG - Intergenic
1083940203 11:65891512-65891534 AAGAAATCCTGACACCAAGAAGG + Exonic
1084182258 11:67452636-67452658 GAGGACTCCTACCCCCAAGGTGG - Exonic
1085048028 11:73364501-73364523 GGGGAGCCCCATCACCAAGATGG + Exonic
1085440741 11:76560234-76560256 GCAGAGACCTAAGACCAAGATGG - Intergenic
1086064499 11:82732184-82732206 GAGGAGTCAAGAAACCAAGATGG - Exonic
1089739765 11:120574284-120574306 GAGAAGACCTAAAACCAAGGAGG - Intronic
1090277198 11:125428737-125428759 GAGGTTTCCCAAGACCAAGATGG - Intronic
1091644146 12:2260816-2260838 AAGGAGTCCTGAGACCAAAAAGG - Intronic
1092080127 12:5709225-5709247 CAGGAGCTCTAACACCATGAGGG - Intronic
1098326948 12:69312826-69312848 CATCAGTCCTGACACCAAGAGGG + Intergenic
1101431696 12:104632489-104632511 TAGGACTCCTAACACCTAGTGGG - Intronic
1103542075 12:121673078-121673100 GAGCAGTCCAAACCCCAACAAGG - Intergenic
1107700677 13:43044353-43044375 GAGAATTCCTAACACCTAGAGGG - Intronic
1114040541 14:18674302-18674324 ATGGATTCCTAACACCAAGCAGG + Intergenic
1122230355 14:100303856-100303878 GAGGAGAGGTAACCCCAAGAGGG - Intronic
1122683611 14:103486765-103486787 CAGTAGGCCTAACACCCAGAAGG - Intronic
1123210111 14:106751261-106751283 GAGGAATCAGGACACCAAGAAGG - Intergenic
1130213505 15:81947718-81947740 GATGAGTTCTACCACCAAGCAGG + Intergenic
1130360397 15:83179517-83179539 GAGAAGTCCTAAGAACCAGAGGG + Intronic
1134243789 16:12524832-12524854 GAGCAGTACTTACACGAAGAAGG - Exonic
1138336519 16:56257794-56257816 AAGGAGTCCTAATGCCAACAGGG + Intronic
1150130583 17:62666742-62666764 GAGGAGGCCTGACAGCAAGGAGG - Exonic
1150957562 17:69877266-69877288 GGGGAGTCCTCACACCATCATGG + Intergenic
1151551515 17:74825069-74825091 GAGGAATTCCAACACCAAGCTGG - Intronic
1152551613 17:81033190-81033212 GAGGCCTCCTCACTCCAAGAGGG - Intergenic
1155085187 18:22451760-22451782 GTGAAGTCCTAACTCCAATAAGG - Intergenic
1155275979 18:24187854-24187876 GAGGGATCCAAACACCAGGATGG + Intronic
1159896853 18:74005490-74005512 GAGGTTTCCTAACAGCAAGGTGG - Intergenic
1160465731 18:79074355-79074377 GAGGAGTCTTAGCACCACCATGG + Intronic
1163002216 19:14375568-14375590 GAGGAGCCCAAACATAAAGAGGG - Intergenic
1163363604 19:16863707-16863729 GTGGAGTCCTCAGACCAGGAAGG - Exonic
1165699633 19:37927485-37927507 GAGAATTCCAAAAACCAAGAAGG - Intronic
1167583633 19:50360895-50360917 TATGAGTCCTATCCCCAAGAAGG - Intronic
925515836 2:4680557-4680579 GAGCAGTCATAACACGGAGAGGG - Intergenic
932426834 2:71643112-71643134 GGGGTGTCCTATCACCTAGAGGG - Intronic
932471711 2:71963428-71963450 CAGGAGTGCTAACCACAAGAGGG - Intergenic
933650125 2:84843732-84843754 GAGGAGTCTTAATCCCAAAAAGG + Intronic
937167830 2:119837253-119837275 GAGGAGACCTAACCCAAAGTGGG - Intronic
939853741 2:147331411-147331433 GATGAGTCCTACCAGCAGGATGG + Intergenic
940289943 2:152068613-152068635 AACCAGTCCTAACACCCAGATGG + Intronic
944115903 2:196185759-196185781 AAAGAGTCCTAACGCAAAGAGGG - Intergenic
944583219 2:201150951-201150973 GAGGAGTCCTGGAACCCAGAGGG + Intronic
945025487 2:205615889-205615911 GAGAATTCCTAACACCAAGGAGG - Intronic
1168972949 20:1943330-1943352 GAGGACTCCGAAAACCAAGCTGG - Intergenic
1170232461 20:14065237-14065259 GAGGAGTCCTAACACCAAGAGGG - Intronic
1170359184 20:15525766-15525788 GAATAGTCATAACACCAAAAAGG - Intronic
1170419622 20:16179909-16179931 TAGGAGTGCTGTCACCAAGAAGG - Intergenic
1173215305 20:41076208-41076230 GAGAAGACCAAACACAAAGATGG + Exonic
1173332913 20:42090205-42090227 GAGGGTTCCTCAAACCAAGATGG + Intronic
1173447049 20:43128604-43128626 GAGGTTTCCTAATATCAAGAAGG + Intronic
1176082657 20:63281820-63281842 GAGCAGGCCTGACACCAGGATGG + Intronic
1176129608 20:63491110-63491132 GAGGAGTCCTCAGACAAAGGAGG - Intronic
1183552908 22:38502690-38502712 GAAGAATCTTAACACTAAGATGG + Intronic
1184370709 22:44080313-44080335 CAGGAGTCCCAACATCAAGGTGG + Intronic
949352850 3:3142777-3142799 TAGGAGAAATAACACCAAGATGG + Intronic
953189050 3:40666380-40666402 GAGGAGTCTCAACACAAGGAAGG + Intergenic
953571349 3:44074249-44074271 GAGGAGTCCTAGCACCTACAGGG - Intergenic
954871865 3:53773433-53773455 GAGGAGCCCTAACATCAAGTGGG + Intronic
965680667 3:171248044-171248066 GAGGAGTCCTCTCACACAGAGGG + Intronic
970226236 4:13860240-13860262 GAGGAGTGCTGCCCCCAAGAGGG + Intergenic
974356138 4:60814960-60814982 TAGGAGTCCCAAAATCAAGAAGG - Intergenic
975065904 4:70063558-70063580 GAGGTCTCCTACCACCAAGAAGG + Intergenic
975268882 4:72405688-72405710 GAGGCATCCTAAGACCAAAAGGG - Intronic
981734450 4:147934465-147934487 GAGGAGTGGCATCACCAAGATGG - Intronic
984007256 4:174327339-174327361 GAGTCTTCCTAACACGAAGATGG - Intronic
984087490 4:175330597-175330619 GAGGAGCTCTGGCACCAAGATGG - Intergenic
988526654 5:31993049-31993071 GAGCAGTGCAACCACCAAGATGG - Intronic
996382754 5:122878433-122878455 GAGAAGTCATAAGAGCAAGAAGG + Intronic
1003143876 6:3493613-3493635 GAGGTGTCCTAACCACGAGAAGG + Intergenic
1007439551 6:41846350-41846372 GAGGAGTGATATCAACAAGATGG + Intronic
1007586699 6:42994961-42994983 GAGGACTGATAAGACCAAGAAGG - Intronic
1007650490 6:43417406-43417428 GAAGAGTCCTCACAGCACGATGG - Intergenic
1012390469 6:98732244-98732266 CTGGAGTCCAAACACCAAAAAGG + Intergenic
1015883706 6:137894787-137894809 AAGGAGTCCTAAGACCAGAAAGG - Intergenic
1016231489 6:141810733-141810755 CATGAGTCCTAACAAGAAGAGGG - Intergenic
1019460210 7:1154236-1154258 TAGGAGTCAGAACTCCAAGAGGG + Intronic
1019874240 7:3794646-3794668 GCAGAGTCCTCACAGCAAGAAGG + Intronic
1022508789 7:30922414-30922436 GAGGAGTGCTGACCCCAAGCTGG - Intronic
1022883961 7:34622424-34622446 GAGGAGTCCTCTCACAAAGCTGG + Intergenic
1029269312 7:99367320-99367342 GAAGAGCCCTCACTCCAAGAGGG + Intronic
1030217264 7:107057163-107057185 GAGGAGTCCAAACAGCAAGTGGG - Intronic
1032695438 7:134331798-134331820 GAGGAGACTTCACATCAAGAGGG - Intergenic
1037175205 8:15939098-15939120 GACTTGTCCTAACACCAAGCAGG - Intergenic
1038749080 8:30279730-30279752 GAGGAGTCCTCAAGCCATGAAGG + Intergenic
1040899561 8:52403775-52403797 GAGGAGTGATATCAGCAAGATGG - Intronic
1047417446 8:124676660-124676682 GAAGATTCTTAACACCTAGAGGG - Intronic
1052973613 9:34396568-34396590 GAGGAGTCTGCAGACCAAGAAGG - Intronic
1057060350 9:91998593-91998615 GGGCAGGACTAACACCAAGAAGG + Intergenic
1194386295 X:93259507-93259529 AAGTAGTCATAACACCAAGTTGG + Intergenic
1196633930 X:117978281-117978303 GAGAATTCCTCACACCATGATGG + Intronic
1198238541 X:134760874-134760896 GTGGAGTCCTCACACTACGATGG + Intronic