ID: 1170237496

View in Genome Browser
Species Human (GRCh38)
Location 20:14123481-14123503
Sequence CTAGGTGACCAGGTGAAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 164}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170237496_1170237502 4 Left 1170237496 20:14123481-14123503 CCATGCTTCACCTGGTCACCTAG 0: 1
1: 0
2: 0
3: 12
4: 164
Right 1170237502 20:14123508-14123530 TTTGAAGAAATCTTGCAGTGCGG 0: 1
1: 0
2: 3
3: 21
4: 265
1170237496_1170237503 25 Left 1170237496 20:14123481-14123503 CCATGCTTCACCTGGTCACCTAG 0: 1
1: 0
2: 0
3: 12
4: 164
Right 1170237503 20:14123529-14123551 GGCATACCATTAGTCTCCCTTGG 0: 1
1: 0
2: 1
3: 7
4: 68

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170237496 Original CRISPR CTAGGTGACCAGGTGAAGCA TGG (reversed) Intronic
901777819 1:11572537-11572559 GGAGGTGACCAGGGCAAGCAAGG - Intergenic
902554715 1:17240152-17240174 CTGTGGGAACAGGTGAAGCAAGG + Intronic
905369548 1:37475740-37475762 CTGGGTGAGCTGGTGAAACACGG + Exonic
907531526 1:55103217-55103239 CTAGTGAACCAGGTGAAGCAAGG - Intronic
907905067 1:58777095-58777117 CTAGGTGACCAGATAAAGTCAGG + Intergenic
909249494 1:73333783-73333805 CTAGGTTACCAGAAGAATCAGGG - Intergenic
910350929 1:86296885-86296907 CTAGGCCAAAAGGTGAAGCAGGG - Intergenic
910474111 1:87588643-87588665 CTGGGTGACCATGAGAAGCATGG + Intergenic
913482644 1:119303601-119303623 CTAGGTCAGCAGGAGAAACATGG + Intergenic
915427840 1:155842204-155842226 CTAGGTGTCCTGGTTAAACAGGG - Intronic
917511409 1:175672248-175672270 CTGGCTGACCAGGGGAGGCAGGG - Intronic
918186247 1:182130071-182130093 CTTGGGGAGCAGGTAAAGCATGG - Intergenic
918292614 1:183123328-183123350 GTAGGGGAGCAGGTGAGGCAGGG - Intronic
919521285 1:198591544-198591566 CTAAATGACGAGGTGAGGCATGG + Intergenic
920819579 1:209367898-209367920 CTAGATGACCAGATGGAGAATGG + Intergenic
922755648 1:228095408-228095430 CTAGGGGAGCAGCTGCAGCAGGG - Intronic
923541135 1:234888989-234889011 CAATGTGGCAAGGTGAAGCAGGG + Intergenic
924629056 1:245720168-245720190 CTAGATGACCAGATAAATCATGG - Intergenic
1069145985 10:64892117-64892139 CTAGGTCAACAGGTTAAGGAGGG + Intergenic
1070846023 10:79523453-79523475 CTGAGTGCCCAGGTGAAGCTGGG + Intergenic
1070927774 10:80236857-80236879 CTGAGTGCCCAGGTGAAGCTGGG - Intergenic
1073632308 10:105161279-105161301 CAAGGTGTCCAGGGCAAGCAGGG - Intronic
1076476666 10:130758432-130758454 CTGGGTGACCTGGAGTAGCAAGG - Intergenic
1080013689 11:27483103-27483125 CCAGGTGAGGAGGTGAAGGAAGG + Intergenic
1083852116 11:65374306-65374328 CCATGTGCCCAGGTGGAGCAGGG + Intergenic
1083852123 11:65374332-65374354 CCATGTGCCCAGGTGGAGCAGGG + Intergenic
1084594692 11:70109907-70109929 CAAGGTGTCATGGTGAAGCAGGG - Intronic
1085316509 11:75548325-75548347 GGAGGTGACCAGGGGATGCAAGG + Intergenic
1087008853 11:93494884-93494906 CTTGGGGACCAGGTTAGGCAAGG - Intronic
1087202833 11:95363494-95363516 CTCTGTGACCAGGTGAGGCCAGG + Intergenic
1088087123 11:105994741-105994763 CAAGGTGGCCAGGTGCAGCTTGG + Intergenic
1091975038 12:4817513-4817535 TTAGGGTACCAGGTGAAGCCAGG - Intronic
1095781821 12:46068376-46068398 CAAAGTGAGCAGGGGAAGCAGGG - Intergenic
1098796335 12:74893062-74893084 TTATTTCACCAGGTGAAGCAGGG + Intergenic
1103028465 12:117593091-117593113 CTTGGAGACCTGGAGAAGCATGG + Intronic
1110281554 13:73699559-73699581 TTTGGTTACCAGGTGAAGTATGG - Intronic
1115966034 14:38889279-38889301 CTGGGGGACCAGGTGAATGATGG + Intergenic
1117002244 14:51382610-51382632 CTTGGTGACTGGGTGAAGAAAGG + Intergenic
1120491021 14:85179051-85179073 GGAGGTGACCAGGAAAAGCAGGG - Intergenic
1121322144 14:92998239-92998261 CTAGGAGCCCAGGTGTTGCAGGG - Intronic
1122169470 14:99860099-99860121 AGAGGTGCCCAGGTGAAGGAGGG - Intronic
1122693822 14:103543399-103543421 CTAGGTGACCATGCTCAGCAGGG - Intergenic
1123168211 14:106346751-106346773 CTAGTTGACCATGTGGAGAAGGG - Intergenic
1125419661 15:39491951-39491973 CTAGGTGAGCAGCTGACTCAAGG - Intergenic
1126527361 15:49671274-49671296 CTAAGCTACCAGGTTAAGCATGG - Intergenic
1127320822 15:57844289-57844311 CTATGTGACAAGATGAAGTAAGG + Intergenic
1128581195 15:68811352-68811374 CTAGGTGCCCAGGAGGAACAAGG + Intronic
1128855814 15:71013619-71013641 CTAACTGACGAGGTGGAGCATGG + Intronic
1129458345 15:75687600-75687622 GTTGGTGTCCAGGTGGAGCACGG + Exonic
1135222036 16:20622260-20622282 CTGAGTGCCCAGGTGAAGCTGGG + Intronic
1136170515 16:28486559-28486581 CCAGGTAAGCAGGTGGAGCAGGG - Exonic
1139582113 16:67879960-67879982 CTCCTTGACCAGGTGAGGCAAGG + Exonic
1141501944 16:84450514-84450536 CTAGGTGGCCACTAGAAGCAGGG + Intronic
1144092304 17:11868994-11869016 CTATGGGACCAGGGAAAGCAGGG - Intronic
1144944447 17:18962620-18962642 CAAGGTGCCCAGGTGGAGCGGGG + Intronic
1146634595 17:34494677-34494699 CCAGGTGACCAGAAGGAGCAGGG + Intergenic
1147314957 17:39615645-39615667 GCAGGTGACCAGGTGAACCGTGG - Intergenic
1149291752 17:55224616-55224638 ATGTGTGACCAGGTGAACCAGGG - Intergenic
1149441427 17:56677834-56677856 CTAGGTGTGGAGGTGAAGCCAGG + Intergenic
1152204820 17:78968971-78968993 GTGGGTGAACAGGTGAAGAAGGG + Intergenic
1155931627 18:31714742-31714764 CTAGGGGAGATGGTGAAGCAGGG + Intergenic
1157052304 18:44180522-44180544 ATTGGTGACCATTTGAAGCAAGG - Intergenic
1160140961 18:76322524-76322546 CTAGGTGACCAGTTAAAGAGGGG + Intergenic
1160978939 19:1807590-1807612 CAGGGTGACCTGGGGAAGCAGGG - Intronic
1163134232 19:15297860-15297882 CCAAGGGACCAGGTGCAGCACGG + Intronic
1163721269 19:18899302-18899324 CTAGGGGCCAGGGTGAAGCATGG + Intergenic
1164413747 19:28028248-28028270 AAAGGTGACCAGGAAAAGCATGG - Intergenic
1165016293 19:32882653-32882675 TTAGGTTACCAGTTGATGCAGGG - Intronic
1165134019 19:33654084-33654106 CTAGGAGACAAGGTGATCCAGGG - Intronic
1166428399 19:42700318-42700340 TTAGGTGACCAGCTGTAACATGG + Intronic
926827041 2:16915676-16915698 CCACGTGACCAGCTGCAGCAAGG + Intergenic
930027738 2:47039716-47039738 CTAGGAGTGCAGGTGAGGCATGG + Intronic
931381265 2:61755656-61755678 CTTGGAGACAAGGTGAAGAAAGG - Intergenic
935622703 2:105143703-105143725 AGAGGTGACCAGGTGAGGCCGGG + Intergenic
937789643 2:125944659-125944681 ATAGGAATCCAGGTGAAGCAGGG - Intergenic
939906227 2:147919386-147919408 CTATGTGACCAGGTAGGGCAAGG - Intronic
939952267 2:148489530-148489552 CTTGGTCAACAGGTGAAGGATGG + Exonic
941999328 2:171630419-171630441 GTAGGTGACCAGGAAAAGTATGG - Intergenic
944987010 2:205188673-205188695 CTAGGTGACCAGCAGCAGCAGGG + Intronic
946053395 2:216881956-216881978 CTAGGTTCCCAGGTAAAGCCTGG + Intergenic
946353100 2:219168489-219168511 CAAGGAGACCAGATGAATCAAGG + Intronic
946422894 2:219574955-219574977 AGAGGTGGCCAGGTGCAGCACGG - Exonic
946631013 2:221669140-221669162 CTAGGTAACCCTGTGAAGCTAGG - Intergenic
948638882 2:239360640-239360662 CTAAGGGACCAGGTGGAGCTCGG - Intronic
1169974097 20:11303915-11303937 CTAGGGTACAAGGAGAAGCAAGG - Intergenic
1170237496 20:14123481-14123503 CTAGGTGACCAGGTGAAGCATGG - Intronic
1170807381 20:19644347-19644369 CGAGGTGCCCAGGTGACTCAAGG - Intronic
1170910347 20:20560228-20560250 CTAGTTGAACACGTGCAGCATGG - Intronic
1174521520 20:51134520-51134542 ATAGGTCAAAAGGTGAAGCAGGG + Intergenic
1175879119 20:62246517-62246539 CTAGGCGTCCGGGTGATGCATGG + Intronic
1177514529 21:22131677-22131699 CAAGGTTACCAGGTGAACCAAGG - Intergenic
1180158951 21:45990537-45990559 GAAGGTGACCAGGGGAAGGACGG + Intronic
1182160085 22:28112804-28112826 CTAGGTGACAACGTGCTGCAGGG + Intronic
1183987395 22:41577081-41577103 CTGGGCCACCAGGTGGAGCATGG + Exonic
1184235669 22:43181854-43181876 GTGGGTGACCACGTGATGCAGGG + Intronic
949960112 3:9304878-9304900 CCAGGTGAGCAGGTGGAGAATGG - Intronic
952697374 3:36283255-36283277 CTGGGAGACCAGGTGAGGAAAGG - Intergenic
954217235 3:49131434-49131456 ATAGATGACCTGGAGAAGCAGGG + Exonic
955337209 3:58096697-58096719 CTAGGTGACCTGGTGAAACCTGG - Intronic
959858913 3:111194465-111194487 CTTGGTGACCAGGTAAAGTAGGG - Intronic
961033793 3:123628534-123628556 ATAGGTGACTAGATGAGGCAGGG - Intronic
962676432 3:137761765-137761787 CTAGGAGACAAGCTGATGCACGG + Intergenic
963622305 3:147625675-147625697 CAAGGTGACCAGCATAAGCATGG + Intergenic
964898931 3:161633945-161633967 AAAGGTGACCAGGAGAAGCATGG + Intergenic
965340392 3:167483761-167483783 CTAGGTGAAGAGCAGAAGCAAGG - Intronic
965942357 3:174200540-174200562 ATAGCAGACGAGGTGAAGCATGG + Intronic
967055914 3:185828032-185828054 CAAAGTGACTTGGTGAAGCAGGG - Intergenic
968993983 4:3933897-3933919 CTATGTGACAAAGTGAAGAAAGG - Intergenic
969498045 4:7537286-7537308 CTGGGAGACCAGGAGAAGCTAGG - Intronic
970399675 4:15705125-15705147 CTCGGGGACCAGGTGAGGCCAGG - Intronic
971361060 4:25939088-25939110 CTTGGGGACCAGCTGTAGCAAGG - Intergenic
973911869 4:55589870-55589892 GGAGGTGACCAGGAAAAGCAGGG + Intronic
975485384 4:74929638-74929660 GGAAGTGACCAGGTAAAGCATGG + Intergenic
976241766 4:82965519-82965541 ATAGGTCTGCAGGTGAAGCAGGG + Intronic
980270088 4:130573387-130573409 CTGGGTGACCAGGGGACTCATGG - Intergenic
980629784 4:135416282-135416304 CTACGTGACCAGTTGCAGAAAGG + Intergenic
983737482 4:171080272-171080294 CTAGATGACCAGTTTAAGAAAGG + Intergenic
984754664 4:183314028-183314050 CTAGGTCACGTGGTGGAGCAGGG + Intronic
985877625 5:2612413-2612435 CTAGGAGACCAGGGGAACCAAGG - Intergenic
995693716 5:114856852-114856874 CTAAGTGAGCAGGAGAAACAGGG - Intergenic
996781036 5:127186778-127186800 CTAAGTGATCAGGTGAGGCGAGG - Intergenic
997898660 5:137742993-137743015 CTAGGTGCCCAGATGAATCCAGG - Intergenic
999105196 5:149064424-149064446 TTGGGTGACCAGGTGAAGAATGG + Intergenic
999528313 5:152433155-152433177 GTAAGTGGCCAGGGGAAGCATGG - Intronic
1001648043 5:173296868-173296890 CTAGGGTAGCAGGTGGAGCAGGG + Intergenic
1002311784 5:178319503-178319525 CTAGGTGGGCAGGTGAGGCCTGG + Intronic
1003880678 6:10477093-10477115 CATGGTGACCAGGTGATCCATGG + Intergenic
1004062189 6:12208520-12208542 CTGGGTGACGCGGTGCAGCACGG - Intergenic
1007244613 6:40451769-40451791 CTATGTGATCAGGGGAGGCAAGG + Intronic
1010047407 6:71462376-71462398 CTAGGAGAACAGGTGCAGGACGG - Intergenic
1012344894 6:98172606-98172628 CCATGTGACCAGTTGAAGAAAGG + Intergenic
1013007999 6:106092371-106092393 CTGTGGGAGCAGGTGAAGCAAGG + Intronic
1013241584 6:108251412-108251434 CCAGGTGGCCATGTGAAGAAGGG - Intronic
1014406453 6:121057900-121057922 CTAGGTGATAAGCTGGAGCAGGG - Intergenic
1014443370 6:121498569-121498591 TTAGGTGATCTGGTGAAACATGG - Intergenic
1019175170 6:170155722-170155744 CTAGGTGAGCAGTGGATGCAGGG + Intergenic
1019641396 7:2105671-2105693 CGAGGCCACCAGGTAAAGCAGGG - Intronic
1020000832 7:4754634-4754656 CTGGGTCACCAGGTGCACCACGG - Intronic
1021174679 7:17437553-17437575 CTAGGTGACCAAGGAAAGGAGGG + Intergenic
1021743023 7:23706808-23706830 CCAAGTGACCAGGTGTACCAGGG - Intergenic
1026350205 7:69508959-69508981 CTATATGACCAGGTCAGGCATGG + Intergenic
1027839380 7:83289083-83289105 CTAGGTGACTAGGGGAATCTAGG + Intergenic
1028035431 7:85975871-85975893 ATAGGTGAGCTGGAGAAGCAGGG - Intergenic
1028810214 7:95077785-95077807 GGAGGTGACCAGGAAAAGCATGG + Intronic
1028854301 7:95573240-95573262 AAAAGTGACTAGGTGAAGCATGG - Intergenic
1029095254 7:98079985-98080007 CTAGGAGAACAGGTGCAGAAAGG - Intergenic
1029978299 7:104854236-104854258 GGAGGTGACCAGGAAAAGCATGG + Intronic
1031095091 7:117407722-117407744 CTATGTGAAGAGATGAAGCAGGG + Intronic
1033454894 7:141493777-141493799 CTAGAAGACCAGGTGAAGGAAGG - Intergenic
1034275514 7:149822150-149822172 CTGGGTGTCCAGGTGGAGGAAGG - Intergenic
1035079025 7:156200817-156200839 CTAGCTGAGCAGGGGGAGCAGGG + Intergenic
1036591530 8:10172975-10172997 CAAAGTGAGGAGGTGAAGCAGGG + Intronic
1037567005 8:20126524-20126546 TTAGGTGAACATGTGAAGCGGGG + Intergenic
1039759512 8:40559279-40559301 GTATGTGAAGAGGTGAAGCAGGG - Intronic
1040443740 8:47472247-47472269 CTAGGAGACAATGTGAAGGAGGG - Intronic
1042411806 8:68474867-68474889 CTTGGTGCCCAGGAGAAGCAAGG + Intronic
1044358950 8:91258982-91259004 CAAGGAGATCATGTGAAGCAAGG - Intronic
1049698304 8:143994356-143994378 CGAGGAGGCCAGGTGAGGCAGGG - Intronic
1051785416 9:20737495-20737517 CGAGGTTACTAGGTGAAGCCTGG + Intronic
1056692189 9:88816904-88816926 CCAGGGGACCAGGTGTAGCAGGG + Intergenic
1057280758 9:93709869-93709891 CTAAGTCACCAGGTCAAGGATGG + Intergenic
1059269404 9:113062495-113062517 CTCGGTGAGCACGTGAATCAAGG + Intergenic
1059270535 9:113067942-113067964 CTCGGTGAGCACGTGAATCAAGG + Intergenic
1059271670 9:113073390-113073412 CTCGGTGAGCACGTGAATCAAGG + Intergenic
1059272803 9:113078836-113078858 CTCGGTGAGCACGTGAATCAAGG + Intergenic
1059273937 9:113084278-113084300 CTCGGTGAGCACGTGAATCAAGG + Intergenic
1059275072 9:113089722-113089744 CTCGGTGAGCACGTGAATCAAGG + Intergenic
1059948818 9:119440610-119440632 TTAGGTGACCTGGAGAAGAAAGG - Intergenic
1060768681 9:126314520-126314542 CAAGGGGACCTGGTGAAGGAAGG - Intergenic
1061908321 9:133710097-133710119 CTTGGGGACCAGGTGAGCCAGGG - Intronic
1062367215 9:136216609-136216631 GTTGTTGACCAGGTCAAGCACGG + Exonic
1187302287 X:18062557-18062579 CTAGCAGCCCAGGGGAAGCATGG - Intergenic
1188488523 X:30710332-30710354 CTAGGTTAGCAGATGAAGGAAGG - Intronic
1193741014 X:85216913-85216935 CTAGGTGAACAGGGGAAAAATGG + Intergenic
1198074202 X:133179332-133179354 CCAGGTGACCAGTTGCACCAAGG + Intergenic
1198928500 X:141825800-141825822 ATTGGTCACCAGGTGATGCAGGG + Intergenic
1199819130 X:151427306-151427328 CTTGGTGCAGAGGTGAAGCATGG + Intergenic