ID: 1170248081

View in Genome Browser
Species Human (GRCh38)
Location 20:14246258-14246280
Sequence GATTTGCTCTGAGGACAATC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 9, 3: 35, 4: 156}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170248074_1170248081 29 Left 1170248074 20:14246206-14246228 CCACAGCAGCCATTTGTAACACT 0: 1
1: 0
2: 0
3: 17
4: 177
Right 1170248081 20:14246258-14246280 GATTTGCTCTGAGGACAATCAGG 0: 1
1: 0
2: 9
3: 35
4: 156
1170248076_1170248081 20 Left 1170248076 20:14246215-14246237 CCATTTGTAACACTTCATGGTGC 0: 1
1: 0
2: 0
3: 8
4: 130
Right 1170248081 20:14246258-14246280 GATTTGCTCTGAGGACAATCAGG 0: 1
1: 0
2: 9
3: 35
4: 156
1170248073_1170248081 30 Left 1170248073 20:14246205-14246227 CCCACAGCAGCCATTTGTAACAC 0: 1
1: 0
2: 1
3: 13
4: 139
Right 1170248081 20:14246258-14246280 GATTTGCTCTGAGGACAATCAGG 0: 1
1: 0
2: 9
3: 35
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170248081 Original CRISPR GATTTGCTCTGAGGACAATC AGG Intronic
900203005 1:1419731-1419753 GATTTGCTCTAAGGACTCTTAGG - Intronic
901642985 1:10702448-10702470 GATTTGCTCTGAGAAGCATCTGG + Intronic
901661968 1:10804288-10804310 GCTTTGCTCTGAGGACAGTGGGG - Intergenic
902821688 1:18947327-18947349 GCTGTGCCCTGAGGACACTCAGG + Intronic
903045382 1:20560772-20560794 TATGTGCTCTGAGGACAGGCAGG - Intergenic
904982160 1:34514919-34514941 GATTTTCTATGTGGATAATCTGG - Intergenic
905421320 1:37847293-37847315 GATTTGAACTGAGGACTTTCTGG - Intronic
907010222 1:50956198-50956220 GATTTTCTTAGAGGACAATTTGG + Intronic
908141655 1:61191395-61191417 GATTTGCTTTCCGGAGAATCTGG + Intronic
914200336 1:145479035-145479057 GTTTTGCACTGAGGACATTCAGG - Intergenic
914479451 1:148052178-148052200 GTTTTGCACTGAGGACATTCAGG - Intergenic
915880387 1:159664907-159664929 AAGTAGCTCTGAGGACAGTCAGG - Intergenic
918156939 1:181857204-181857226 TATTTGCTCTGAGGATCATATGG - Intergenic
919608137 1:199711841-199711863 TATTTGCTCAGAAGTCAATCAGG - Intergenic
920544964 1:206808798-206808820 CATTTGGTCTGTGGACAATAAGG + Intronic
921440993 1:215185826-215185848 AATCTGCTCTGAGGAGGATCAGG + Intronic
923307694 1:232703184-232703206 GACTTGCTCTGAGGACACGTGGG - Intergenic
1066348960 10:34618937-34618959 GGTGTGCTCTGAGGACAAAGAGG - Intronic
1069597410 10:69681424-69681446 GATTTGGTCTGATGACATTTGGG + Intergenic
1069756701 10:70778003-70778025 GAATTGCTCTTAGGACAGTCTGG - Intronic
1072568879 10:96641416-96641438 GATTCGCTCACAGGACAAACAGG - Intronic
1074859267 10:117497949-117497971 GATGTTCTCTGAGGTCTATCAGG - Intergenic
1075479473 10:122767707-122767729 GAGTTGCTCTGAGGACTAAATGG - Intergenic
1079743779 11:24099538-24099560 GTTTTGATCAGAGGGCAATCTGG - Intergenic
1081352608 11:42072807-42072829 GAAATGCTCTGAGGAAAATCTGG - Intergenic
1081708169 11:45198701-45198723 GATTTGCTCAGAGGCAAAGCTGG + Intronic
1085268866 11:75257863-75257885 GATTTGATCTGAGATCAAACAGG - Intergenic
1085849980 11:80108960-80108982 CATTTGCTATGAGGATAAACAGG - Intergenic
1089579480 11:119472514-119472536 GATTTGCACAGAGGAAAGTCTGG + Intergenic
1089633066 11:119795451-119795473 GATTTGCTCTGAGTAAGATGAGG + Intergenic
1091861648 12:3790620-3790642 GATTTGCTCTTTAGACAATCAGG - Intergenic
1092489439 12:8931910-8931932 GCTTTGATCTCTGGACAATCTGG + Intronic
1093351248 12:18105453-18105475 GATCTTCTCTGAGGACCAACTGG + Intronic
1099830478 12:87836112-87836134 GATTTGGCCTGAGGACATTTGGG + Intergenic
1101383255 12:104232828-104232850 GGTATGCTCTCATGACAATCAGG - Intronic
1105213392 13:18271049-18271071 GATGGGCTCTGAAGACAAGCAGG - Intergenic
1105420414 13:20247384-20247406 ACTTGGCTCTGAGGACACTCTGG - Intergenic
1106351798 13:28937708-28937730 GCTATGCTCTGAGGACACGCAGG - Intronic
1106435356 13:29718874-29718896 CATCTGCTCTTAGGACAATGAGG - Intergenic
1108102145 13:46967939-46967961 TAGTTGCTCTGGGGACAGTCAGG + Intergenic
1114405893 14:22455807-22455829 GAATTGGTCTGGGGATAATCAGG - Intergenic
1114621454 14:24098715-24098737 GATTTCCTCTGAGTACAAGAAGG - Intronic
1114804016 14:25813180-25813202 GATTTGTGCTGAGTACAATTTGG - Intergenic
1114867941 14:26620705-26620727 GTTATGTTCTGAGGACACTCAGG + Intergenic
1115291719 14:31779594-31779616 GGGATGCTCTGAGGACATTCAGG - Intronic
1115651687 14:35406628-35406650 GATTAGTTCTGAGAACAATGTGG - Intergenic
1117602010 14:57385837-57385859 GATTTACTCTTATGTCAATCAGG - Intergenic
1119530365 14:75355858-75355880 GATTTGCACTCAGGAACATCGGG - Intergenic
1120366807 14:83581714-83581736 GATTTGCTATGAGGACTTACAGG - Intergenic
1122725153 14:103745740-103745762 TATTTACTCTGAGGACACTGAGG - Intronic
1123693154 15:22856076-22856098 GCTGTGCTCTGAGGACACTCAGG + Intronic
1124379593 15:29154187-29154209 GATTTTCTGTGTAGACAATCAGG + Intronic
1125147981 15:36494848-36494870 GATCTGCTCAGAGAACAATCTGG - Intergenic
1125186739 15:36939637-36939659 TATTTGTTCTGAGGATAAACAGG - Intronic
1126581970 15:50250282-50250304 GAGTAGCTCTGAGGACCCTCAGG + Intronic
1126750621 15:51873179-51873201 GAATTACTCTGAGGACCTTCTGG - Intronic
1128407754 15:67360488-67360510 GACTTGCTCAAAGGAGAATCAGG - Intronic
1129905590 15:79185078-79185100 GATGAGCTCTGAGGGCAACCAGG + Intergenic
1131055013 15:89369963-89369985 GATTATCTCTGAGGAGAACCGGG - Intergenic
1131529469 15:93179523-93179545 GATTTGAACTCAGGACTATCTGG + Intergenic
1135616932 16:23918937-23918959 GACTTGCTTTGAGCATAATCTGG + Intronic
1135682910 16:24473544-24473566 CCTTTGCTCAGAGGAGAATCAGG - Intergenic
1135884318 16:26291508-26291530 AATTTGTACTAAGGACAATCAGG - Intergenic
1138101012 16:54252540-54252562 GATTTGCAGAGAGGGCAATCTGG + Intronic
1140245355 16:73243396-73243418 GATTGGCTATGAGTACAATGAGG - Intergenic
1140981179 16:80111246-80111268 GTTTTGCTCTGAGCTGAATCAGG + Intergenic
1141748473 16:85942247-85942269 ACTGTGCTCTGAGGACCATCTGG + Intergenic
1143317883 17:6046549-6046571 GATGTGCTCTGGGGAAAATGCGG - Intronic
1144270387 17:13609842-13609864 TATCTGCCCTGAGGAAAATCTGG - Intergenic
1145789429 17:27616785-27616807 GCTTTGCTCTGGGGGCAGTCGGG + Intronic
1146284445 17:31565053-31565075 GATGAGCTCAGAGGAAAATCAGG - Intergenic
1150188341 17:63210743-63210765 GATTTGCTCTTAAAATAATCAGG + Intronic
1153102010 18:1482994-1483016 GGTTTGATCTGAGTATAATCTGG + Intergenic
1153802950 18:8687131-8687153 GATTTCGGCTGAGGTCAATCTGG + Intergenic
1154559555 18:15808184-15808206 GATTTGATCTGAAGACAATCCGG - Intergenic
1154560385 18:15819717-15819739 GATTTGATCTGAAGACAATCCGG - Intergenic
1154567053 18:15911493-15911515 GATTTTCTCTGAAGACAATCCGG - Intergenic
1154592470 18:16258860-16258882 GATTTTACCTGAAGACAATCCGG - Intergenic
1154598975 18:16347921-16347943 GATTTTATCTGAAGACAATCCGG - Intergenic
1154611891 18:16525097-16525119 GATTTTATCTGAAGACAATCCGG - Intergenic
1154614851 18:16565809-16565831 GATTTGATCTGAAGACAATCCGG - Intergenic
1154627297 18:16736488-16736510 GATTTTATCTGAAGACAATCCGG - Intergenic
1154630169 18:16776316-16776338 GATTTTACCTGAAGACAATCCGG - Intergenic
1154632581 18:16809412-16809434 GATTTGATCTGAAGACAATCCGG - Intergenic
1154641478 18:16931194-16931216 GATTTTATCTAAAGACAATCCGG - Intergenic
1154651641 18:17070995-17071017 GATTTTACCTGAAGACAATCCGG - Intergenic
1154655311 18:17121558-17121580 GATTTGATCTGAAGACAATCCGG - Intergenic
1154658972 18:17171586-17171608 GATTTTATCTGAAGACAATCCGG - Intergenic
1154662564 18:17220587-17220609 GATTTTATCTGAAGACAATCCGG - Intergenic
1154669865 18:17320480-17320502 GATTTTATCTGAAGACAATCCGG - Intergenic
1154702026 18:17760866-17760888 GATTTGATCTGAAGACAATCCGG - Intergenic
1154703521 18:17781412-17781434 GATTTTATCTGAAGACAATCCGG - Intergenic
1154715453 18:17945259-17945281 GATTTTCTCTGAAGACAATCCGG - Intergenic
1154717246 18:17969680-17969702 GATTTTATCTGAAGACAATCCGG - Intergenic
1154718831 18:17991212-17991234 GATTTTATCTGAAGACAATGCGG - Intergenic
1154728520 18:18124159-18124181 GATTTTATCTGAAGACAATCCGG - Intergenic
1154729625 18:18139081-18139103 GATTTTATCTGAAGACAATCCGG - Intergenic
1154731800 18:18169106-18169128 GATTTTATCTGAAGACAATCCGG - Intergenic
1154733591 18:18193697-18193719 GATTTTACCTGAAGACAATCCGG - Intergenic
1154751613 18:18440633-18440655 GATTTTATCTGAAGACAATGCGG - Intergenic
1154755210 18:18490324-18490346 GATTTTACCTGAAGACAATCCGG - Intergenic
1154770471 18:18699180-18699202 GATTTTATCTGAAGACAATGCGG - Intergenic
1154773185 18:18736488-18736510 GATTTTATCTGAAGACAATCCGG - Intergenic
1154816969 18:19338009-19338031 GATTTTATCTGAAGACAATCCGG - Intergenic
1154818396 18:19358074-19358096 GATTTTACCTGAAGACAATCCGG - Intergenic
1154828382 18:19496296-19496318 GATTTTATCTGAAGACAATCCGG - Intergenic
1154853342 18:19839898-19839920 GATTTTACCTGAAGACAATCCGG - Intergenic
1154862890 18:19972145-19972167 GATTTTACCTGAAGACAATCCGG - Intergenic
1154868885 18:20054734-20054756 GATTTTATCTGAAGACAATCCGG - Intergenic
1154873273 18:20115282-20115304 GATTTTATCTGAAGACAATCCGG - Intergenic
1154873817 18:20122910-20122932 GATTTTATCTGAAGACAATCCGG - Intergenic
1154880406 18:20213476-20213498 GATTTTATCTGAAGACAATCCGG - Intergenic
1154882616 18:20244166-20244188 GATTTTACCTGAAGACAATCCGG - Intergenic
1154886288 18:20294707-20294729 GATTTTACCTGAAGACAATCCGG - Intergenic
1154886540 18:20298270-20298292 GATTTTACCTGAAGACAATCCGG - Intergenic
1154892690 18:20382843-20382865 GATTTTATCTGAAGACAATCCGG - Intergenic
1154894293 18:20404885-20404907 GATTTTATCTGAAGACAATCCGG - Intergenic
1154897986 18:20455744-20455766 GATTTTACCTGAAGACAATCCGG - Intergenic
1154901983 18:20510532-20510554 GATTTTATCTGAAGACAATCCGG - Intergenic
1155818987 18:30351338-30351360 CATTTGCTCTGAGTAAAATGGGG + Intergenic
1156469437 18:37368235-37368257 GGTTTCCTCTGAGCACAATGTGG + Intronic
1159716529 18:71830707-71830729 GCTTTTCTCTGAGGACATTCAGG + Intergenic
1160011686 18:75111043-75111065 AATGTGTCCTGAGGACAATCAGG - Intergenic
1163176754 19:15569583-15569605 GATTGATTCTGAGGACAATGGGG + Intergenic
928703773 2:33926052-33926074 GATTAGCCCTGAGGGCAATTGGG + Intergenic
932500364 2:72177941-72177963 GCTTTGCTATGAGGTCAGTCGGG - Exonic
932994088 2:76827486-76827508 GATTTAATCTGAGGACCATATGG + Intronic
934669629 2:96202538-96202560 GATTTGCTCAGAGAACAATCAGG + Intronic
935504799 2:103887246-103887268 AATTTTCTCTGAAGACAAGCCGG + Intergenic
938622257 2:133068304-133068326 GACTTGCTCTGAGGGGAAGCTGG - Intronic
940863234 2:158791477-158791499 GATTTACTCTGGGGACATACTGG - Intergenic
943647444 2:190422200-190422222 AATTTCCTCTTAGGACATTCAGG + Intronic
944736262 2:202569301-202569323 CATTTTCTCTAAGGACATTCAGG - Intergenic
945217591 2:207451162-207451184 GATTTTCGCTGAGGATAATGTGG + Intergenic
945911525 2:215655340-215655362 GACTTGCTTTGAGGAGAATTTGG + Intergenic
946884647 2:224210795-224210817 GATGTGCCCTGGGGACAATGGGG + Intergenic
947713401 2:232328403-232328425 GATATGCTCTCAGGACATCCTGG + Intronic
947861023 2:233357286-233357308 GAATGGATCTGAGGACAAGCTGG + Intronic
1170248081 20:14246258-14246280 GATTTGCTCTGAGGACAATCAGG + Intronic
1174094641 20:48078617-48078639 GATTTACTCTGAAGACACTGGGG - Intergenic
1177635003 21:23775773-23775795 GATTTGCTCTGTGGCCAGGCTGG - Intergenic
1178159830 21:29899212-29899234 GATTAGGTCTGAGGTCATTCAGG + Intronic
1179267629 21:39818690-39818712 AAAGTGCTCTGAGGAGAATCTGG - Intergenic
1180211826 21:46299479-46299501 GACCTGCTCTGACGACACTCTGG - Intergenic
949329192 3:2902310-2902332 GATTTAAGCTGAGGACCATCTGG - Intronic
950286815 3:11751566-11751588 GAATCTCTCTGAGGACAACCAGG + Intergenic
950653944 3:14425111-14425133 GATTTGCTCTCAGGAGAAACAGG - Intronic
951010624 3:17673961-17673983 CATTTGCTATGAGAACAAACAGG + Intronic
951033576 3:17908580-17908602 AATTAGCTCAGAGGACAAACAGG - Intronic
951284118 3:20788518-20788540 GATATGCTCTGTGGACAAAGGGG - Intergenic
953041514 3:39258829-39258851 GACTTGTTCTGAGGATAATGGGG - Intergenic
953213180 3:40894272-40894294 CCTTTGCTCTGAGGACCATGGGG + Intergenic
955566724 3:60255437-60255459 GACTTGCTCTGAGGATAATAGGG + Intronic
959433282 3:106282355-106282377 GATTTGCTCTGAAGTCAGCCTGG + Intergenic
962118707 3:132539898-132539920 GGTTTGCTCTGAGGATTAACTGG - Intergenic
964041561 3:152268085-152268107 TATTTGCTCTGGCGACAATATGG + Exonic
966207532 3:177420314-177420336 GACCTCCTCTGAGGACAATGAGG - Intergenic
966671181 3:182527893-182527915 GATTTGCTCTCAGGAATGTCTGG - Intergenic
971258844 4:25037905-25037927 GAGTTGCTCAGAAGACAAGCAGG + Intergenic
973223424 4:47754725-47754747 GATTTGCACTGAAGAGAAACAGG + Intronic
976378796 4:84376044-84376066 GACTTGCTCTGAGGACTATGAGG - Intergenic
977378804 4:96243263-96243285 AATTTGCTATGAGAAAAATCTGG + Intergenic
981801095 4:148657354-148657376 GGATTGCTCTGAGCCCAATCAGG + Intergenic
983255526 4:165396135-165396157 GATTTGCTCTTCGCACAATGAGG + Intronic
983909158 4:173217060-173217082 AATTTGATCTGCGGAAAATCTGG + Intronic
984200722 4:176717670-176717692 GATTTGTTCTGAAGAGAAACTGG - Intronic
984207632 4:176805211-176805233 TATATGCTCTCAGGACAATTTGG - Intergenic
987161666 5:15151122-15151144 GAAGTGCTCTGTGGACTATCAGG + Intergenic
988339235 5:29948824-29948846 GATTGGATGTGAGGGCAATCTGG + Intergenic
988520771 5:31943700-31943722 GATTTAGTTTGAGGACAAGCTGG - Intronic
990507681 5:56460646-56460668 GTTTTGACCTGAGGACAATCTGG - Intronic
992916676 5:81461713-81461735 GATTTGCTCTGGCCACTATCTGG - Intronic
998813492 5:145989403-145989425 GAATTGCTCTGAAAACATTCAGG - Intronic
999089284 5:148921206-148921228 GATGGGCTCTGAGGACTTTCAGG - Intergenic
999537454 5:152532871-152532893 GATTTGCTTTGAGGAGAAAATGG + Intergenic
1000522489 5:162314372-162314394 GGTTTGGTATTAGGACAATCGGG - Intergenic
1001274402 5:170339835-170339857 TATTTGGTGTGAGGACATTCTGG - Intergenic
1001431079 5:171662775-171662797 GATTTGATCTGAGGACCCTTGGG - Intergenic
1003834597 6:10057507-10057529 GCTTTGTTTTGAGGACACTCAGG + Intronic
1007094351 6:39204183-39204205 GATTTGCTCTGATATCTATCTGG + Intronic
1014214196 6:118736981-118737003 GAATCGCTCTGAGGGCAAACAGG + Intergenic
1017749376 6:157476561-157476583 GCTTTGCTCTCAGGACATGCTGG - Intronic
1024130139 7:46343235-46343257 GATTTTCTCAGAGGAGAATGTGG - Intergenic
1024514237 7:50231090-50231112 GATTTGCTATAAGGAGAAGCTGG - Intergenic
1026021800 7:66713438-66713460 GATTTTCTATGGAGACAATCAGG + Intronic
1028894710 7:96028243-96028265 GATTGTCCCAGAGGACAATCTGG - Exonic
1030934012 7:115562137-115562159 GCTTTACTCTGAGGACATCCAGG - Intergenic
1032567846 7:132966686-132966708 GACTTGCCATGAAGACAATCTGG + Intronic
1032880864 7:136089039-136089061 CAATTGCTCTGAGGACCATGAGG + Intergenic
1035859895 8:3016758-3016780 CATTTGCTCAGAGGAAAATAAGG - Intronic
1038725214 8:30076189-30076211 GATTTGCATTGGGGACCATCTGG + Intronic
1043462822 8:80478043-80478065 CATTTGCTTTGAGAACTATCTGG - Intergenic
1044195077 8:89366409-89366431 GATTTGCTCTGAGAAATAACTGG + Intergenic
1046060186 8:109129850-109129872 GAGTTTCTCTGAGGACAACTTGG - Intergenic
1046674086 8:117089586-117089608 CATTATCTCTGATGACAATCTGG + Intronic
1049610793 8:143553857-143553879 GACTTGGTCTGAGGCCAAGCAGG - Intronic
1057945876 9:99327675-99327697 GATGTTCTCAGAGGACCATCTGG - Intergenic
1189356267 X:40312210-40312232 GACTTGCTCTGATGAGAATTCGG + Intergenic
1192445842 X:71210519-71210541 CATTTGCTCTAAGGACAGTTTGG - Intergenic
1194600947 X:95920949-95920971 CATTTGCTTTCTGGACAATCAGG - Intergenic
1202051450 Y:20784993-20785015 GATATGTTCTGAATACAATCAGG + Intergenic