ID: 1170248081

View in Genome Browser
Species Human (GRCh38)
Location 20:14246258-14246280
Sequence GATTTGCTCTGAGGACAATC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170248076_1170248081 20 Left 1170248076 20:14246215-14246237 CCATTTGTAACACTTCATGGTGC No data
Right 1170248081 20:14246258-14246280 GATTTGCTCTGAGGACAATCAGG No data
1170248074_1170248081 29 Left 1170248074 20:14246206-14246228 CCACAGCAGCCATTTGTAACACT No data
Right 1170248081 20:14246258-14246280 GATTTGCTCTGAGGACAATCAGG No data
1170248073_1170248081 30 Left 1170248073 20:14246205-14246227 CCCACAGCAGCCATTTGTAACAC No data
Right 1170248081 20:14246258-14246280 GATTTGCTCTGAGGACAATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170248081 Original CRISPR GATTTGCTCTGAGGACAATC AGG Intronic