ID: 1170262484

View in Genome Browser
Species Human (GRCh38)
Location 20:14425732-14425754
Sequence AGTCCCCAGGGTAACGGTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 112}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170262484 Original CRISPR AGTCCCCAGGGTAACGGTGA GGG (reversed) Intronic
901611779 1:10504478-10504500 TGCCCCCAGGGTCACTGTGAAGG - Intronic
902508955 1:16955273-16955295 TGTCCCCAGGGCAGCGGTCAGGG - Intronic
902802228 1:18837824-18837846 GGTCCCCAGGGCAAGGGGGATGG + Intergenic
906116581 1:43360993-43361015 AGTCCCCAGATTATAGGTGAGGG - Intronic
908375468 1:63534149-63534171 AGCCCCCATGGTAACTGTGAAGG - Exonic
913210151 1:116575660-116575682 AGTTCCCAGAGTAAAGGAGATGG + Exonic
913510794 1:119559759-119559781 AGACACCATGGTAAGGGTGAAGG - Intergenic
913515013 1:119597164-119597186 AGACACCATGGTAAGGGTGAAGG - Intergenic
919640173 1:200039025-200039047 AGCCCCGAGGGTGACGGTGCTGG - Intronic
919907182 1:202086023-202086045 AGGCCCCAGGGAAACTGTGAGGG - Intergenic
920374998 1:205503590-205503612 AGTCCCCAGGGAAAGGGTTCAGG + Intergenic
920945450 1:210524414-210524436 AGTCACCAGGGAAAGGGCGAGGG + Intronic
920970813 1:210742384-210742406 AGTCCCCAGGGGAACAATGCTGG + Intronic
1062811747 10:471628-471650 AGTTCCCAGGGCACCGGTGAGGG - Intronic
1063091210 10:2867539-2867561 AATCCCCAGGGTTAGCGTGAGGG + Intergenic
1064092621 10:12397599-12397621 AGGCCCCAGGGTCACAGGGATGG - Intronic
1069894627 10:71672774-71672796 AGGCCCCAGGGTGAAGGGGATGG + Intronic
1071856935 10:89635500-89635522 AATCCCCAGTGTAACAGTGTTGG - Intronic
1072833410 10:98684183-98684205 AATCCCCAGGATAATGGTGAAGG + Intronic
1074088928 10:110228416-110228438 AATCCCCAGGGTAGTGGTAAAGG - Intronic
1079145753 11:17850233-17850255 GGTCCCCAGTGTAACAGTGCTGG - Intronic
1084190708 11:67497485-67497507 TGTGCCCAGGGTAGGGGTGATGG + Intronic
1084730355 11:71069231-71069253 AGTAACCATGGTAATGGTGATGG - Intronic
1087751882 11:102015002-102015024 AATCCCCAGGGTGACGGTAAAGG + Intergenic
1089054987 11:115578128-115578150 AGTCCCCAGGGTATCTTTAATGG - Intergenic
1092898413 12:13035968-13035990 AGTCCCCAGGTGAAAGCTGATGG + Intergenic
1101736974 12:107470530-107470552 CATCCCCAGGGTCACGGTGTGGG + Intronic
1105277273 13:18943546-18943568 AGTCCCCCGGGTCACGGGGACGG - Intergenic
1128524836 15:68405232-68405254 AGTCCCCAGAGTAAAACTGAGGG + Intronic
1128861345 15:71076608-71076630 AATCCCCAGTGCAACGGTGTTGG + Intergenic
1129700786 15:77767536-77767558 AATCCCCAGGGTCATGGAGATGG + Intronic
1132092960 15:98960548-98960570 AATCCCCAGGGTAAAGGCGTGGG + Exonic
1133025314 16:2986712-2986734 AGTGCCCAGGGTAGCTGGGACGG - Intergenic
1134264432 16:12681198-12681220 AATCCCCAGGGTAACAGCGTTGG + Intronic
1138586817 16:57976016-57976038 AGTATCCAGGGTAAGCGTGAGGG - Intergenic
1139912819 16:70408578-70408600 AGTCCCTAGGGTAGCACTGAGGG - Intronic
1140309965 16:73839830-73839852 AGTCCCCAGGGATAGGGTTAGGG - Intergenic
1141166091 16:81661894-81661916 AGTGCCCAGGGTACCTGTCAGGG + Intronic
1141175169 16:81713845-81713867 AGTTCCCAGGCTAAGGCTGAAGG - Intergenic
1143549175 17:7618784-7618806 GATCCCCAGGATAAAGGTGAAGG + Intronic
1144662391 17:17079691-17079713 AGTCCCCAAGGAAACAGTGCAGG - Intronic
1146747492 17:35345501-35345523 ATTCCCCAGGGTAATGCTGTCGG + Intergenic
1151969937 17:77452383-77452405 AGTCCCCAGAGTCACTGGGACGG - Intronic
1152303781 17:79509733-79509755 AGAGCCCAGGGTTAGGGTGAGGG + Intronic
1152493095 17:80651033-80651055 AGTCCCCAGCCTGACGGTGGGGG - Intronic
1154131277 18:11738772-11738794 ATTCCCCAGGGTAAAGGAGGAGG + Intronic
1157871313 18:51232412-51232434 ATTACCCAGGGAAACAGTGATGG - Intergenic
1160951191 19:1668494-1668516 AGTCCCCAGTGTGAAGGGGAAGG - Intergenic
1162147887 19:8624463-8624485 AGTCCCCAGTGCAACAGTGTTGG + Intergenic
1167617370 19:50542905-50542927 AGTCCACGGGGTGACGGTGCTGG - Intronic
1168230175 19:55026141-55026163 TGCCCCCAGGGTCACAGTGAGGG - Intronic
926176201 2:10594412-10594434 AATCCCCAGGATAATGGTAAAGG + Intronic
930345891 2:50180465-50180487 AATCCCCAGTGTAACAGTGTTGG + Intronic
930867547 2:56136678-56136700 AATTCCCAGGATGACGGTGAGGG - Intergenic
938203696 2:129399093-129399115 AGTCCCCAAGGGTAGGGTGAGGG + Intergenic
938595568 2:132784117-132784139 AGACTCCAGGGTCACGGTCAAGG - Exonic
939490841 2:142874425-142874447 AGGCCCCAGGGATATGGTGAGGG + Intergenic
940166815 2:150783163-150783185 AGTTCCAAGGATAACAGTGATGG - Intergenic
942680936 2:178478006-178478028 GGTCCCAAGGGTAATGGTGGTGG + Intronic
947646058 2:231741475-231741497 AGTCCCCTGAGTGACAGTGAAGG + Intronic
947909410 2:233791491-233791513 AGCCCCCAGGGGAGAGGTGAAGG + Intronic
1168811650 20:708710-708732 ACTCCCCAGGGTAATGGTAAAGG + Intergenic
1169614736 20:7427807-7427829 AGTCCCCAAGCTAACGCTTAAGG - Intergenic
1170262484 20:14425732-14425754 AGTCCCCAGGGTAACGGTGAGGG - Intronic
1171493543 20:25538619-25538641 TGGCCCCAGGGTCACAGTGATGG + Intronic
1172625498 20:36344393-36344415 AGTCCACAATGTAACAGTGATGG + Intronic
1178706796 21:34882243-34882265 AGGCCACAGGGAAAGGGTGATGG - Intronic
1179538823 21:42071090-42071112 AGCCCCCAGGGAAACGGCCATGG + Intronic
1181439520 22:22928608-22928630 AGGCCTCAGGGTCACTGTGAGGG - Intergenic
1181682224 22:24503346-24503368 ATTCCCCAGGGTGATGATGAGGG - Intronic
1182757439 22:32691189-32691211 AGAGCCCAGGGTATGGGTGAAGG - Intronic
1184629257 22:45763148-45763170 AGTCACCAGGGTGAGGGAGAGGG - Intronic
1184732729 22:46379730-46379752 TGTGCCCAGGGCAACTGTGATGG + Intronic
950304532 3:11907859-11907881 AGGCCACAGGGTCACGCTGAAGG - Intergenic
950711920 3:14819272-14819294 GGTCCCCAGGGTTCCGCTGAGGG + Exonic
953793267 3:45964668-45964690 AATTCCCAGGGTAACACTGAAGG + Intronic
954646195 3:52133073-52133095 AATCCCCAAGGTAACAGTGTTGG + Intronic
954860182 3:53681595-53681617 AGGCACCAGGGTTACGGTGGTGG + Intronic
955240104 3:57170311-57170333 AGTCTCCAAGGTAACCGCGAGGG + Intergenic
959554823 3:107704732-107704754 AATCCCCAGAGTAACAGTGTTGG - Intronic
960258955 3:115543515-115543537 AATCCCCAGGGTAACTGGGAAGG - Intergenic
961591224 3:127983316-127983338 GGTCCCCAGTGTAGCGGTGCTGG + Intronic
963115352 3:141724371-141724393 AGACACCAGGGTGAAGGTGAAGG + Intergenic
966914122 3:184575585-184575607 AGGCCCCGGGGTAGGGGTGAGGG + Intronic
969971031 4:11048388-11048410 AGTCCCCAGGGTACGAGTGAGGG + Intergenic
973884169 4:55303988-55304010 AGTCTCCAGGGTAGTAGTGAGGG + Intergenic
974102679 4:57435295-57435317 AGTGCTGAGGGTAAAGGTGAAGG + Intergenic
976255399 4:83095198-83095220 AATCTCCAGGGTCATGGTGAAGG + Intronic
977568945 4:98610339-98610361 AGTCCCCAGTGTAACCGTGATGG - Intronic
981448509 4:144868547-144868569 AATCCCCAGGATTACTGTGAAGG + Intergenic
983363139 4:166752777-166752799 AGTTCTCAGGGTAACTGAGAAGG - Intronic
987065482 5:14285873-14285895 AGACCCCTGTGTAACAGTGAGGG + Intronic
996439301 5:123471734-123471756 AGTCCCCAGTGTAATGGTATTGG - Intergenic
997592162 5:135081209-135081231 AATTCCCAGGATAATGGTGAAGG - Intronic
998210534 5:140193896-140193918 AATCCCCAGAGCAATGGTGATGG + Intronic
998939382 5:147264266-147264288 AAACCCCAGGGTGATGGTGAAGG + Intronic
999915472 5:156254365-156254387 AGTTCCCAGGGGAGCGGGGAGGG - Intronic
1000256394 5:159542491-159542513 AATCCCCAGTGCAACGGTGTTGG + Intergenic
1001187034 5:169584008-169584030 AGACCCCAGGGTTCCGGGGAAGG - Intronic
1009533237 6:64847577-64847599 AGTTGCCAGGGAAACGGAGATGG - Intronic
1011037902 6:82997931-82997953 ATTCCCCAGGTAAATGGTGAAGG - Intronic
1014949848 6:127541828-127541850 AGTCCACAGGGTGAGGGTGGGGG - Intronic
1015817006 6:137221087-137221109 ATTCCCCAGAGGAACGCTGACGG + Intergenic
1016799062 6:148150115-148150137 AGTCCCTAGAGTGACTGTGAAGG - Intergenic
1018434790 6:163750395-163750417 AGTCCCCACCGTCACCGTGAGGG - Intergenic
1024985181 7:55188013-55188035 AGCCCCCAGGGGAAGGGTGATGG + Intronic
1032875246 7:136031719-136031741 AGTTCCCAGTGTAATGGTGCAGG + Intergenic
1033366921 7:140678829-140678851 AGACCCCAGGGAGACGGGGAAGG + Intronic
1035439108 7:158881202-158881224 AGGCCCCAGGGCAAAGGCGAGGG - Intronic
1036752646 8:11453037-11453059 AGTCCCCAGGCTCAGGCTGAGGG - Intronic
1037805446 8:22055923-22055945 GGTTGCCAGGGCAACGGTGAGGG + Intronic
1040508821 8:48075592-48075614 AGTCTCCAGGGTAACCATGTAGG + Intergenic
1041691122 8:60688266-60688288 ACTGCCCAGGGTTATGGTGAAGG + Intronic
1045193977 8:99911393-99911415 AGTTCCCAGGGTCATGGAGAAGG - Intergenic
1056789297 9:89615370-89615392 AATCCCCAGTGTAATGGTGTTGG + Intergenic
1057030336 9:91770161-91770183 AGTCCCCAGGGCCACCATGAGGG - Intronic
1058892672 9:109374507-109374529 AGTCCCCAGGGTTACTTTCATGG - Intergenic
1060016776 9:120093506-120093528 CTTCCCCAGGGTAACCCTGAAGG + Intergenic
1060668486 9:125447838-125447860 AGTCAGCTGGGTAAAGGTGAGGG + Intronic
1060993361 9:127861678-127861700 AGTCCCCAGGGTATGGGTGTTGG + Intergenic
1062223939 9:135438203-135438225 AGTCCCCACGATAAGGGAGAGGG + Intergenic
1188522168 X:31050827-31050849 AATCTTCAGGGAAACGGTGAAGG - Intergenic
1191254368 X:58273442-58273464 AGTCCCCCAGGGAACGGGGATGG - Intergenic
1192279367 X:69668013-69668035 AGTCCCCAATGCAACAGTGATGG - Intronic
1200154910 X:153970229-153970251 AGCCCGCTGGGTAACGGTGTGGG + Intronic