ID: 1170262555

View in Genome Browser
Species Human (GRCh38)
Location 20:14426759-14426781
Sequence CCATTTTTCCTCCCTAATGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 188}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170262555 Original CRISPR CCATTTTTCCTCCCTAATGG GGG (reversed) Intronic
905937021 1:41832890-41832912 CCATTATTCCTCCCACATAGGGG + Intronic
907372574 1:54012844-54012866 CCTTTTCTCCTCCCATATGGGGG - Intronic
907938787 1:59066933-59066955 GCATTTTTCCTCCCTTACAGAGG - Intergenic
908020605 1:59894299-59894321 CCACTTTTCCTCCTTAATCATGG + Intronic
908356129 1:63326263-63326285 CCACTTTGCCTCCCTGGTGGTGG + Intergenic
912053276 1:105559971-105559993 CCAGTTTTCATCTCTAAAGGAGG - Intergenic
917897619 1:179506940-179506962 CCAGCTTTCCTTCCTTATGGGGG + Intronic
921285710 1:213607506-213607528 CCATCCTTCCTCCTTAAAGGTGG + Intergenic
923784518 1:237054342-237054364 CCATTTTTCCTGACAGATGGAGG - Intronic
924598766 1:245469827-245469849 ACATTTTTCCTCCCTACCTGTGG + Intronic
1063663677 10:8049815-8049837 CCATATTTCCTTCCCTATGGTGG - Intergenic
1064639819 10:17404323-17404345 CCATTCTACCTCCCTCATAGGGG + Intronic
1064731928 10:18339963-18339985 CCATTTTGCATCCATCATGGTGG - Intronic
1065836818 10:29665913-29665935 CCTTTTTTCCCCCGTTATGGGGG - Intronic
1067081867 10:43216743-43216765 CCTTCTTTCCTCCCTGAGGGTGG - Intronic
1067238782 10:44473055-44473077 CCAGCTTTCCTCCCTTTTGGAGG + Intergenic
1069118313 10:64535941-64535963 CCATGATTCCTCCCTTAGGGTGG + Intergenic
1069595639 10:69668274-69668296 CAAATTGCCCTCCCTAATGGGGG - Intergenic
1069656035 10:70089440-70089462 CCTTCTTTCCTTTCTAATGGTGG - Intronic
1071244571 10:83749235-83749257 CCTTTTTTCCTTTCTAATAGAGG - Intergenic
1072234678 10:93443259-93443281 GGATTTTGCCTCCCTAATGTAGG - Intronic
1072780402 10:98247315-98247337 CCCTTTTTACTCCCTAAGGAGGG + Intergenic
1073601140 10:104847190-104847212 ACATCCTTCCTCCCTAATTGAGG - Intronic
1076170444 10:128314903-128314925 CCAAGTGGCCTCCCTAATGGTGG - Intergenic
1076306345 10:129467716-129467738 CCATATTTCCTTCCTGCTGGAGG + Intronic
1081229456 11:40566695-40566717 CAATTTTTCTTCCCTAAAGAAGG + Intronic
1085131192 11:74040290-74040312 CCATTTTTCTTCCACAAGGGTGG - Intronic
1085852204 11:80134486-80134508 CCATTTTTCCTTTTTAATGTAGG + Intergenic
1086299396 11:85409383-85409405 CAGTTTTTCCTCCCTAAAAGGGG + Intronic
1086769069 11:90738019-90738041 CCATTTTTCTTCCCCACTGTGGG - Intergenic
1087796558 11:102460578-102460600 CCTTTTTTCTTCCCTTGTGGGGG + Intronic
1089919362 11:122193814-122193836 ACATTTTTCCAGCCTCATGGAGG + Intergenic
1091967692 12:4759160-4759182 CCAATTTTCCTAGCTGATGGAGG - Intronic
1095372653 12:41487792-41487814 CCATCTTTCCTCATTAAGGGTGG - Intronic
1096413782 12:51395444-51395466 CCAGGTTTCCTGCCTTATGGTGG - Intronic
1098209779 12:68151535-68151557 CCAGTTTTCCTCACTATTGAAGG - Intergenic
1098722454 12:73918246-73918268 CCACTGTTCATCCCTACTGGCGG + Intergenic
1101954225 12:109199303-109199325 CCATTTCCCCTTCCTAAAGGGGG - Intronic
1102191757 12:110993932-110993954 AAATTTTTCCACCCTCATGGTGG - Intergenic
1102521664 12:113481084-113481106 ACATTTTCCCTCCCTCGTGGGGG + Intergenic
1108261015 13:48656598-48656620 TCATCTTTCCTCCAAAATGGAGG - Intronic
1110079466 13:71292325-71292347 CCATGATTCTTCCCTTATGGTGG + Intergenic
1110373933 13:74770624-74770646 CCACTTTTCTTCCCTTATTGTGG - Intergenic
1111517252 13:89350820-89350842 CCATGATTCTTCCCTTATGGTGG - Intergenic
1114715572 14:24820397-24820419 CCATTTTTCTTCTTTAATGGTGG + Intronic
1116593211 14:46806945-46806967 CCATTTTCTCTCCCTTATGTTGG + Intergenic
1118705514 14:68477038-68477060 TCATTTATCCTCCCTATTGAAGG - Intronic
1124920575 15:34022387-34022409 TATTTTTTCCTCCCTAATGTTGG - Intronic
1125342147 15:38685738-38685760 CCATTTCTCCTCTAAAATGGTGG - Intergenic
1128142269 15:65310541-65310563 CCTTCTTCCCTCCCTACTGGGGG + Intergenic
1131030190 15:89179921-89179943 CCACTTTTCCTGCCAAATGGTGG + Intronic
1131217119 15:90547461-90547483 CCAATTTTCTATCCTAATGGAGG + Intronic
1131379521 15:91952495-91952517 CCATTTTTACTCTCAAAAGGTGG - Intronic
1131737053 15:95344872-95344894 ACATTTTTCCTCTCTAAAGTTGG - Intergenic
1132937940 16:2491236-2491258 ACATTTTTACTCCCTAATTTTGG + Intronic
1133299788 16:4775342-4775364 CTATGTTTCCAGCCTAATGGGGG + Intergenic
1135470503 16:22725337-22725359 CAGATTTTCCTCCCTAATGTGGG - Intergenic
1138214928 16:55195827-55195849 CCATTTTACATTCCTACTGGTGG - Intergenic
1138830118 16:60365233-60365255 ACATTTTACCTCCCTCAAGGAGG - Intergenic
1139398327 16:66658802-66658824 CCATTCTTCCTCCCTGTGGGAGG - Intronic
1143125840 17:4640529-4640551 CCTTTTTTCCTCCCTATGGTGGG - Intronic
1143402638 17:6656293-6656315 CCTTTTTTCCTCCCTATGGTGGG + Intergenic
1143479910 17:7222163-7222185 CCATTCTTCCACAGTAATGGGGG + Exonic
1147805118 17:43125736-43125758 CACTCTTTCCGCCCTAATGGAGG + Intergenic
1147811124 17:43170577-43170599 CACTCTTTCCGCCCTAATGGAGG + Exonic
1151023113 17:70642430-70642452 CCATTTTTCCTCCCTGAATGGGG - Intergenic
1155025071 18:21933961-21933983 CCATTGTTTCTCCCTGCTGGTGG + Intergenic
1155369299 18:25080999-25081021 CAGTCTTTCCTTCCTAATGGAGG + Intronic
1155840187 18:30633464-30633486 CTATTTGTCCTCGCCAATGGAGG - Intergenic
1156619464 18:38832198-38832220 CAATTATTCCTCCTTAAAGGAGG - Intergenic
1157315791 18:46588762-46588784 CCTCTTTTCCTCCCCACTGGAGG + Intronic
1157794949 18:50564830-50564852 CCATTTTCCTTCCCGACTGGTGG - Intronic
1159031654 18:63238110-63238132 CAACTTTTACTCCGTAATGGAGG + Intronic
1160800653 19:966555-966577 CCTTTTTTCCTACCTAGAGGAGG + Exonic
1167716856 19:51147587-51147609 CCATTTTTCCTCCCTAAGAATGG + Intronic
925692774 2:6541886-6541908 CCATGATTCCTCCCTTAGGGTGG + Intergenic
925989504 2:9242759-9242781 GCAATTTTCCTCCATAAAGGAGG - Intronic
926305022 2:11631741-11631763 CCATTTTTCCTCCCTTTTACTGG + Intronic
928521908 2:32097405-32097427 CCATTTCCCCTCCCTAGAGGCGG + Intronic
931586653 2:63837360-63837382 CCCTTTTTCCTCTCTCATGTGGG + Intergenic
931639495 2:64369611-64369633 CCACTTATCCTCCCTGCTGGTGG - Intergenic
932778551 2:74544756-74544778 CCATTTTTTTTCCCTAAGGAGGG + Intronic
939160457 2:138582748-138582770 CCATGTTTCTTCCCTCAGGGTGG + Intergenic
939666454 2:144958220-144958242 GCAATTTTCTTCACTAATGGTGG + Intergenic
940978174 2:159970392-159970414 CCAGTTTTTCTTCGTAATGGGGG - Intronic
941310821 2:163928647-163928669 CCATTTTTCTTCCCTCATACCGG + Intergenic
943249247 2:185495947-185495969 CCATTATTCTTCCCTTAGGGTGG + Intergenic
944488613 2:200233911-200233933 TGACTTGTCCTCCCTAATGGTGG + Intergenic
948778383 2:240301803-240301825 CCGTTTTTATTCCCAAATGGTGG - Intergenic
949078027 2:242073750-242073772 CGATTTTTCCTCTCTAATGTGGG - Intergenic
1169512387 20:6278235-6278257 AAAGTTTTCCTCCCTGATGGAGG + Intergenic
1170262555 20:14426759-14426781 CCATTTTTCCTCCCTAATGGGGG - Intronic
1172005011 20:31813240-31813262 CTATTTTTCCTACCTTATGTTGG + Intergenic
1172762148 20:37330479-37330501 ACATTTTCCCTCCCTCCTGGAGG + Intergenic
1173458018 20:43219309-43219331 CCCCTGTTCCTCCCTAAAGGGGG - Intergenic
1173522638 20:43711088-43711110 CCTTTGTTCCACACTAATGGGGG - Intronic
1175620475 20:60441838-60441860 ACATTTATCTTCTCTAATGGAGG + Intergenic
1176525099 21:7860172-7860194 GCATATTTCCTCCCCAAGGGTGG - Intergenic
1178093880 21:29193393-29193415 CCATAATTCCTCCCTTAGGGTGG - Intergenic
1178659119 21:34490185-34490207 GCATATTTCCTCCCCAAGGGTGG - Intergenic
1178681689 21:34677688-34677710 GCATTTCTCCTCCCTGATGAAGG - Intronic
1178754138 21:35331943-35331965 CAGATTTTCCTCCATAATGGGGG + Intronic
1179964460 21:44793368-44793390 CCCTTTCCCCTCCCTAAGGGAGG - Intronic
1180668880 22:17537199-17537221 CTTTTTTTCCTCTCTCATGGGGG - Exonic
949098308 3:112947-112969 CCATTGTGCCTCCATTATGGAGG - Intergenic
950835897 3:15918746-15918768 CCATGATTCTTCCCTCATGGTGG + Intergenic
951035601 3:17928571-17928593 CAATTTTTCCTACATATTGGTGG - Intronic
951458742 3:22925448-22925470 CCATTTTTCTTTCCTAATATAGG - Intergenic
952147716 3:30551238-30551260 CCATGTTTCTTCCCTTAGGGTGG + Intergenic
952390656 3:32876742-32876764 TCATTTTTTCTCCCCCATGGTGG - Intronic
952554220 3:34513393-34513415 CCATTTATCCTCCGTGCTGGTGG + Intergenic
955320402 3:57970221-57970243 CCATTTTCCTTCCCAAATGGAGG - Intergenic
955566130 3:60248810-60248832 CCCTTTTTCTTCCCGAATGCAGG + Intronic
959574370 3:107918533-107918555 CTATTTTTTATCCCTATTGGAGG - Intergenic
961188594 3:124938027-124938049 TGATGTTTCCTCACTAATGGAGG + Intronic
961323709 3:126097126-126097148 CCATGATTCCTCCCTGAGGGTGG + Intronic
963344551 3:144079161-144079183 CAGATTTTCCTCCCTAATGTGGG + Intergenic
963378311 3:144497709-144497731 CCATTTAACCTCCCCAGTGGAGG + Intergenic
966216999 3:177514296-177514318 ACATTTTTTCTCCTGAATGGGGG - Intergenic
968472431 4:788233-788255 CCCTCCTTCCTCCCAAATGGAGG + Intronic
968767547 4:2481336-2481358 CCATTTTTCCTCACAAATGGTGG + Intronic
969692918 4:8715832-8715854 CCATTTTCCTTCTCTAATGTAGG - Intergenic
972026668 4:34387728-34387750 CCATTTTACTTCTCTAATGGAGG - Intergenic
972120521 4:35696110-35696132 CCATTTTTTCTCCTTAATTTAGG + Intergenic
974243366 4:59281597-59281619 CAATTTGTTCTTCCTAATGGAGG - Intergenic
977446192 4:97136200-97136222 CCAACTTTCCTCTCTAATGCTGG - Intergenic
977883329 4:102231727-102231749 CCATTGTTCCTCCCTTACTGTGG - Intergenic
977982555 4:103342071-103342093 CCATTTTTCCTCCCTATCCTTGG - Intergenic
978753688 4:112281419-112281441 CCATTTTTTCTCTCTAACAGTGG - Intronic
979798289 4:124875246-124875268 CCATGATTCCTCCCTTAGGGTGG + Intergenic
979807738 4:124996102-124996124 CAAGTTTTCCTCCCTAATGAAGG + Intergenic
979884052 4:126001931-126001953 CAGTTTTTCTTCCCTAAGGGAGG - Intergenic
980681012 4:136160200-136160222 CCATGATTCTTCCCTTATGGTGG - Intergenic
982726374 4:158910635-158910657 CTATTTATCCTCCATAATGTGGG + Intronic
986092339 5:4522808-4522830 CCATCTTTCATCCCTAATTATGG - Intergenic
986279754 5:6313778-6313800 TCATTTGTCCTCCCTCTTGGGGG + Intergenic
987844116 5:23259296-23259318 TCTTTTGTCCTCCCTAATGTGGG - Intergenic
995211856 5:109549779-109549801 CAAATTATCCTCCCTAATGCGGG - Intergenic
998181782 5:139951120-139951142 CCATGCTACCTCCCTAATGTGGG + Intronic
1002076553 5:176711966-176711988 ACACATTTCCTGCCTAATGGAGG + Intergenic
1003019093 6:2494601-2494623 CCATTATTCCTCCATAAAGTGGG - Intergenic
1003036188 6:2642272-2642294 CCATTTGTCCTCCCTTATCCTGG - Intergenic
1003196415 6:3919113-3919135 CCATGGTTCCTCCCTTAGGGTGG + Intergenic
1006290970 6:33136520-33136542 CCATTGTTCCTCCCAGAAGGAGG + Intergenic
1007198321 6:40082797-40082819 ACATTTTTCCCCCCAAAAGGGGG + Intergenic
1008031651 6:46702482-46702504 CCATCTCTCCTCTGTAATGGAGG + Intronic
1008355958 6:50553451-50553473 TCCTTTTTCCTCCCTAATGCAGG + Intergenic
1008885064 6:56423616-56423638 CAATTTTTCCTCTCAAAGGGAGG - Intergenic
1013179987 6:107709242-107709264 ATATTTTTCCTTCTTAATGGAGG + Intronic
1013473824 6:110489019-110489041 AGCTTTTTCCTCCCTAAAGGAGG + Intergenic
1013671355 6:112406878-112406900 CCGTTCTCCATCCCTAATGGAGG - Intergenic
1013870774 6:114756735-114756757 CCATTCTTACTCCATATTGGTGG - Intergenic
1015302161 6:131666388-131666410 CCATTTTTCCTCCCTAGATTTGG + Intronic
1016125218 6:140393526-140393548 CCAATTTTCCTCTCTTATTGTGG + Intergenic
1016772299 6:147865029-147865051 ATATTTTACTTCCCTAATGGAGG - Intergenic
1017348958 6:153417412-153417434 CCACTGTTCCACCCTAAAGGTGG - Intergenic
1021615267 7:22497577-22497599 CTATTTTTCCTCTTTAATGTTGG - Intronic
1025223425 7:57135799-57135821 AGATTTTTCCTCCCTAAAGTGGG + Intronic
1025634232 7:63307447-63307469 AGATTTTTCCTCCCTAAAGTGGG + Intergenic
1025648466 7:63440719-63440741 AGATTTTTCCTCCCTAAAGTGGG - Intergenic
1028377226 7:90157056-90157078 CTATTTTTCCTCTTTAATGTTGG + Intronic
1030189925 7:106800660-106800682 AGATTTTTCCTCCCTAAAAGGGG - Intergenic
1031839193 7:126716899-126716921 TTATTATTCCTCCCTACTGGTGG - Intronic
1033740758 7:144274061-144274083 ACACTTTTCCCCCCGAATGGAGG + Intergenic
1033753148 7:144375552-144375574 ACACTTTTCCCCCCGAATGGAGG - Exonic
1035120780 7:156564778-156564800 CCATTTTTCCCTCCTATGGGAGG + Intergenic
1035465090 7:159069726-159069748 CCATTTTTCCCCCCAAATAAGGG + Intronic
1035536563 8:395551-395573 TGATTTTTCCTCTCTAATGTGGG - Intergenic
1039259772 8:35758871-35758893 CAATTTTTCTTCACTAATGCAGG - Intronic
1042021156 8:64372238-64372260 CCATTGTTCCTCCTCAATGAAGG - Intergenic
1042041571 8:64597217-64597239 CTATTTTTGCTCCCTAAGGTGGG + Intronic
1042208811 8:66356677-66356699 ACATTTTTCCTCCCCTATGCAGG + Intergenic
1044433645 8:92136784-92136806 CCCTTTTTCCTACCTAAGGAAGG - Intergenic
1044493400 8:92847348-92847370 CCCTCCTTCCTCCCTTATGGAGG + Intergenic
1045523178 8:102921046-102921068 CCAATTGTCCTCCCTAATGTGGG - Intronic
1046524057 8:115361389-115361411 GCATTTTTCCTCTGTACTGGTGG - Intergenic
1047023713 8:120804946-120804968 CCATTTTTCCTCCCTCTTGTAGG + Intronic
1051545319 9:18267460-18267482 CCATTTGTCCTCTCTTCTGGTGG - Intergenic
1052438482 9:28462515-28462537 CCATTTTTTCCCCCTATTTGTGG - Intronic
1052520982 9:29548161-29548183 AGCTTTTTCCTCCCTAATAGGGG + Intergenic
1055791168 9:79924761-79924783 CCAATTTTCCTGCCTAATGCAGG - Intergenic
1056477479 9:86967091-86967113 CCAATTTTAATCCCTAATGCTGG + Intergenic
1061264579 9:129497596-129497618 CCCTTTTTCCTGCCTCTTGGTGG + Intergenic
1061472778 9:130840572-130840594 TAACTTTTCCTCCATAATGGTGG + Intronic
1061938480 9:133871663-133871685 ACAAATGTCCTCCCTAATGGTGG + Intronic
1186611971 X:11146313-11146335 CACTGTTTCCTCCCTGATGGAGG - Intronic
1186909262 X:14144055-14144077 CTATTTCTCCTCCCTTCTGGAGG + Intergenic
1187360773 X:18625779-18625801 ACATTTATCTTCCGTAATGGAGG + Intronic
1187934699 X:24324501-24324523 CCATTTTACCTATCTAATGAGGG + Intergenic
1190098218 X:47499840-47499862 CCCTTTTTCCTCCCAATTGGAGG - Intergenic
1190815327 X:53924314-53924336 CTTTTTTTCCTCCCTAAAAGGGG + Intergenic
1192542645 X:71988291-71988313 AGCTTTTTCCTCCCTAAAGGGGG - Intergenic
1192962067 X:76141917-76141939 GCATTTTTCTTCTCAAATGGTGG + Intergenic
1192963466 X:76153170-76153192 GCATTTTTCTTCTCAAATGGTGG - Intergenic
1194398779 X:93418514-93418536 CCATGATTCTTCCCTAAGGGTGG + Intergenic
1194589682 X:95784215-95784237 CCATTTTTTCTCCACAATTGTGG + Intergenic
1195745705 X:108115871-108115893 CCATTTTTAATCTCTAATAGTGG - Intronic
1196470665 X:116021374-116021396 ACAGTGTTCCTCCCTACTGGAGG + Intergenic
1197902828 X:131392459-131392481 CCATTTTCCCTGACTCATGGGGG + Intronic
1197995761 X:132370800-132370822 CCTTTTCTCATCCCTCATGGTGG - Intronic
1198509228 X:137332554-137332576 TCATTTTTCTTCCCTAATTCAGG - Intergenic
1199753537 X:150843773-150843795 CCATTTCTCTGCCTTAATGGAGG + Intronic
1201922829 Y:19253204-19253226 CCATGTTTTCTCCCTTAGGGTGG + Intergenic