ID: 1170268148

View in Genome Browser
Species Human (GRCh38)
Location 20:14491633-14491655
Sequence CTGGTTAAACAGATGGGCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 135}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170268140_1170268148 6 Left 1170268140 20:14491604-14491626 CCATCCACCCACATCTATTGGAC 0: 1
1: 0
2: 1
3: 17
4: 134
Right 1170268148 20:14491633-14491655 CTGGTTAAACAGATGGGCCTTGG 0: 1
1: 0
2: 2
3: 10
4: 135
1170268136_1170268148 23 Left 1170268136 20:14491587-14491609 CCAATTCTTACACCTACCCATCC 0: 1
1: 0
2: 5
3: 64
4: 620
Right 1170268148 20:14491633-14491655 CTGGTTAAACAGATGGGCCTTGG 0: 1
1: 0
2: 2
3: 10
4: 135
1170268143_1170268148 -2 Left 1170268143 20:14491612-14491634 CCACATCTATTGGACAAGTGCCT 0: 1
1: 0
2: 0
3: 8
4: 106
Right 1170268148 20:14491633-14491655 CTGGTTAAACAGATGGGCCTTGG 0: 1
1: 0
2: 2
3: 10
4: 135
1170268142_1170268148 -1 Left 1170268142 20:14491611-14491633 CCCACATCTATTGGACAAGTGCC 0: 1
1: 0
2: 0
3: 9
4: 73
Right 1170268148 20:14491633-14491655 CTGGTTAAACAGATGGGCCTTGG 0: 1
1: 0
2: 2
3: 10
4: 135
1170268139_1170268148 7 Left 1170268139 20:14491603-14491625 CCCATCCACCCACATCTATTGGA 0: 1
1: 0
2: 0
3: 8
4: 137
Right 1170268148 20:14491633-14491655 CTGGTTAAACAGATGGGCCTTGG 0: 1
1: 0
2: 2
3: 10
4: 135
1170268137_1170268148 11 Left 1170268137 20:14491599-14491621 CCTACCCATCCACCCACATCTAT No data
Right 1170268148 20:14491633-14491655 CTGGTTAAACAGATGGGCCTTGG 0: 1
1: 0
2: 2
3: 10
4: 135
1170268141_1170268148 2 Left 1170268141 20:14491608-14491630 CCACCCACATCTATTGGACAAGT 0: 1
1: 0
2: 0
3: 5
4: 71
Right 1170268148 20:14491633-14491655 CTGGTTAAACAGATGGGCCTTGG 0: 1
1: 0
2: 2
3: 10
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170268148 Original CRISPR CTGGTTAAACAGATGGGCCT TGG Intronic
900216840 1:1486246-1486268 CTGGCTGAACAGGTGGGCCAGGG + Intronic
900223921 1:1523975-1523997 CTGGCTGAACAGGTGGGCCAGGG + Intronic
902171927 1:14618710-14618732 CTGGTTAAAAATATAGGCTTTGG - Intronic
903213332 1:21830382-21830404 CTGGGTAATAAGATGGGACTGGG + Intronic
905101413 1:35526068-35526090 CTTGTTCAACAAATGGTCCTGGG - Intronic
907740476 1:57160864-57160886 CTGGTTGATTAGATGGGGCTGGG + Intronic
908148279 1:61271341-61271363 CCGACTAAACAGATGGGCCCTGG + Intronic
908511945 1:64856710-64856732 CTTGCTGAACAGCTGGGCCTCGG - Intronic
914247271 1:145895657-145895679 CTGGATGCACAGGTGGGCCTGGG + Exonic
919840468 1:201605598-201605620 TTGTTTAGACAGATGGGACTGGG + Intergenic
919915926 1:202139272-202139294 CAGGCTAAAGAGATGGGGCTCGG + Intronic
920284928 1:204872480-204872502 CTGGTGAGACAGCTGGGGCTGGG + Intronic
921949528 1:220915104-220915126 CTTGGTAAACAGACGGCCCTAGG + Intergenic
924843425 1:247739052-247739074 CTGGCTCAACAGAGGGGCCTTGG + Exonic
924886417 1:248222119-248222141 CTGGATAGACAGCTGTGCCTGGG + Intergenic
1066399331 10:35059739-35059761 GTGGTTAAATGGATGGGCTTTGG + Intronic
1068047405 10:51905261-51905283 CTGGTGCAACAGATGGTCCTGGG + Intronic
1070266187 10:74905525-74905547 CAGGTTAAACAGGTGGGCTTGGG + Intronic
1074103780 10:110374230-110374252 CTGGGCATACAGGTGGGCCTGGG + Intergenic
1074813724 10:117129280-117129302 CTGATTCATCAGATGGGACTAGG + Intronic
1074875850 10:117612839-117612861 GTGATTACACAGATGGGCTTCGG + Intergenic
1076501913 10:130943855-130943877 CTGGGTACTCAGATGGTCCTGGG + Intergenic
1076594865 10:131619146-131619168 CTGGTGAACCAGATGGTCCCTGG - Intergenic
1083391925 11:62358066-62358088 CTGTTTTAAAAGATTGGCCTTGG + Intronic
1085996571 11:81923301-81923323 GTGGTTACACAGATGGGGTTAGG - Intergenic
1087794071 11:102437274-102437296 AGGGTTAAAGAGATGGGGCTGGG - Intronic
1088840450 11:113623247-113623269 TTTGTTATACAGATGGGCCAAGG - Intergenic
1089446192 11:118554349-118554371 CTGTCAAAAGAGATGGGCCTGGG - Intronic
1092721697 12:11447537-11447559 CTAGTTATAGAGTTGGGCCTAGG + Intronic
1095478335 12:42608897-42608919 CTGGTTTCACAGCTGGGCCCTGG + Intergenic
1096575534 12:52550423-52550445 CTTCTTAAACTGTTGGGCCTTGG - Intronic
1097707491 12:62882927-62882949 TTTGCTAAACAGATGGGGCTGGG - Intronic
1098892907 12:76027861-76027883 TTGCTTAAAAAGATGCGCCTAGG - Exonic
1100175146 12:92021891-92021913 CAGGCTAAACAGATGAGCATGGG + Intronic
1101542343 12:105676626-105676648 CTGGGTAAAAAGTTGGGCCTTGG + Intergenic
1102889470 12:116547207-116547229 CTGGTTAAGCACACGGGCTTCGG + Intergenic
1104280524 12:127372469-127372491 CTGGAAAAACACATGGGACTTGG - Intergenic
1105762034 13:23524228-23524250 CTGGTTAACCACATGGACCTGGG - Intergenic
1107170762 13:37340451-37340473 TTGGATAAAAAGATGTGCCTGGG + Intergenic
1117160095 14:52980921-52980943 AAGTTTAAACAGATGGGGCTGGG - Intergenic
1117337900 14:54770361-54770383 TTGCTTAAACAGGTGGGGCTGGG + Intronic
1119828732 14:77681644-77681666 CTGCTTACAAAGATGGTCCTTGG + Intronic
1121729144 14:96174220-96174242 CCGGGTAGACAGAAGGGCCTGGG + Intergenic
1122282951 14:100635016-100635038 TTGGGTCAACAGATGGCCCTGGG + Intergenic
1124183801 15:27503012-27503034 CTGGTTAAACCGATGGCCATTGG + Intronic
1125681385 15:41532671-41532693 GTGGTTAAAAAGTAGGGCCTCGG + Intronic
1136569150 16:31086492-31086514 CTGGTGAAAGAGACGGGGCTGGG + Intronic
1137364359 16:47848012-47848034 CATGTTAAAAAGATGGGTCTTGG + Intergenic
1138375201 16:56558613-56558635 CTGGTTAATTACATGGGACTCGG - Intergenic
1143203828 17:5129854-5129876 CTGGTTAGACTGAAGGGCCATGG + Intronic
1144875008 17:18392966-18392988 CTGGTTAGACTGAAGGGCCATGG + Intergenic
1145157216 17:20551455-20551477 CTGGTTAGACTGAAGGGCCATGG - Intergenic
1148328889 17:46801195-46801217 ATGGGTAAGCACATGGGCCTGGG - Intronic
1152419490 17:80184418-80184440 CAGGCTACACAGAGGGGCCTGGG - Intronic
1158111948 18:53949877-53949899 ATGGTTAAACTGATGTGTCTTGG + Intergenic
1158910659 18:62058120-62058142 CTTGTAAAACAGATGGGCCCTGG + Intronic
1160665632 19:326723-326745 TTGGGTAAACAGATGGGCACAGG + Intronic
1161040513 19:2108676-2108698 CTGGTGAAAAAGGTGAGCCTCGG - Exonic
1162721884 19:12667385-12667407 CTGGTGAATCACTTGGGCCTGGG + Intronic
1162811236 19:13165326-13165348 CTGTGTAAACAGAGGGGACTTGG - Intergenic
1163291725 19:16383630-16383652 GTGTTTACACAGATGAGCCTGGG - Intronic
1165307502 19:35011543-35011565 CTGCTTGAAAAGGTGGGCCTGGG + Exonic
1165470358 19:35999881-35999903 CTTGTTTAACAGATGGGTCAAGG - Intergenic
1168403091 19:56097351-56097373 CTGGTTAGATAGATTGACCTGGG - Intronic
1168595072 19:57668865-57668887 CTGGTGAAACAGAGGGGGCCCGG - Intergenic
925075279 2:1011293-1011315 CTGGTTACACAGATAAGCTTTGG + Intronic
926035649 2:9633373-9633395 GTGGTTAAAAAGATGGGCTTTGG - Intergenic
926578804 2:14612355-14612377 CTGGTTAAACACATGGGTAGAGG - Intergenic
928941656 2:36733144-36733166 TTGCTTAAGCAGATTGGCCTTGG - Intronic
931956742 2:67435484-67435506 CTGGTTTCACAAATGGGCTTAGG + Intergenic
936232496 2:110715502-110715524 CTGGTTATACAGATGTGCCTAGG + Intergenic
938311745 2:130294541-130294563 CCTGTTCAACAGATGGTCCTGGG - Intergenic
939122443 2:138133956-138133978 GTGGTGATACAGATGGGCCCTGG - Intergenic
939123985 2:138152906-138152928 CTGATTAGACAGATGGCACTAGG + Intergenic
941592530 2:167437642-167437664 CTGTTTGAACAGATGAGCCAGGG - Intergenic
942299335 2:174547017-174547039 CTAGAGAAAGAGATGGGCCTGGG + Intergenic
943692637 2:190883606-190883628 CCTGTTAAAGAGATTGGCCTTGG + Intronic
944402922 2:199348917-199348939 TTGGTTTATCAGATGGGCCATGG + Exonic
944947284 2:204703383-204703405 CTTGTTAAAGAGATGGGAATGGG + Intronic
946942196 2:224781027-224781049 CTTGGTAAACAGATGGCCTTTGG + Intronic
947316977 2:228870223-228870245 CTGGTTAAATAAATGAGCCTGGG + Intronic
948050710 2:234977342-234977364 TTGGGAAAAGAGATGGGCCTCGG - Intronic
949081050 2:242100032-242100054 CTGGTGAAACAGATAGGCAGTGG + Intergenic
1170268148 20:14491633-14491655 CTGGTTAAACAGATGGGCCTTGG + Intronic
1172910997 20:38408709-38408731 CTGGAGAAACAGCTGGGCTTTGG - Intergenic
1172966871 20:38842160-38842182 GTGGTTAAATACATGGGCTTCGG - Intronic
1173541549 20:43855914-43855936 GTGGTTAAACACATGGGCTTTGG + Intergenic
1174506081 20:51018423-51018445 ATGGTTCTACAGATGGTCCTGGG + Intronic
1175390333 20:58623112-58623134 CTGGTTAAGCACATGGGTTTTGG - Intergenic
1180177897 21:46098888-46098910 CTGGTGGAACCGCTGGGCCTGGG + Intronic
1180649939 22:17369451-17369473 CCGGAGAAACAGATGGGGCTAGG - Exonic
1182237346 22:28885299-28885321 CTGATTAATCGCATGGGCCTGGG - Intronic
1182466547 22:30520413-30520435 CTGGAAGAACAGATGGGCCCTGG - Intergenic
1184980823 22:48095118-48095140 ATGGTTAAACAAATGGGCGGAGG + Intergenic
950196019 3:11009744-11009766 CTTGTTAAAATGCTGGGCCTTGG + Intronic
957145818 3:76422413-76422435 CTACTTGAACAGGTGGGCCTGGG + Intronic
961826240 3:129600624-129600646 CTGGAGAAACAGATAGGGCTTGG - Intronic
965041098 3:163507985-163508007 CTGGAGAAACAGGTGGGTCTGGG + Intergenic
965634027 3:170763045-170763067 GTGGTTAAAGACATGGGCTTTGG - Intronic
971404298 4:26307134-26307156 CTGTTTTTACAGATGTGCCTCGG - Intronic
975348204 4:73318393-73318415 CTGGTGACACAGCTGGGCATTGG - Intergenic
979398989 4:120224497-120224519 CTGGACAAACAGATGGGGCGGGG - Intergenic
981578633 4:146230224-146230246 CTGGATACCCAGAGGGGCCTGGG - Intergenic
996303105 5:122011905-122011927 CTGGTGAAGCAGATGGGCTCAGG - Intronic
999626904 5:153530648-153530670 TTTGTTCAACAGTTGGGCCTGGG + Intronic
1003359392 6:5409987-5410009 CTAGTTCATCAGATGGGCCCAGG - Intronic
1004001694 6:11602287-11602309 CTGGTTAAACAGAAGAGAATGGG - Intergenic
1006902194 6:37510469-37510491 CTGGAGAGACAGATGTGCCTGGG + Intergenic
1008483871 6:52014554-52014576 CTGGATAAACAGATGGATCATGG + Intronic
1010788069 6:80028837-80028859 CTGGTAGAAAACATGGGCCTTGG + Intronic
1015863968 6:137709214-137709236 CTGGTTAAATCAATGGGCATCGG + Intergenic
1016817337 6:148315436-148315458 GTGGTTGAACAGATTGGCTTTGG - Intronic
1017818744 6:158033688-158033710 TTGGTGCCACAGATGGGCCTGGG - Intronic
1023353778 7:39347000-39347022 CTTGAGAAGCAGATGGGCCTGGG + Intronic
1030696274 7:112588455-112588477 CTGGTTCAGCCTATGGGCCTCGG + Intergenic
1031297649 7:120023779-120023801 CTGGTTATACAGAGTTGCCTGGG - Intergenic
1031919952 7:127593199-127593221 CTGGGTAAGGAGAAGGGCCTAGG - Intronic
1033993004 7:147311151-147311173 GAGAGTAAACAGATGGGCCTAGG + Intronic
1035384986 7:158465665-158465687 GTGGTTAAACAGCTGGTACTTGG - Intronic
1035538954 8:416839-416861 CTGGTGAAACAGATAGGCAGTGG + Intronic
1036433680 8:8713193-8713215 CTGGTTCAAGAGATTCGCCTTGG + Intergenic
1038298611 8:26320976-26320998 CTGTTTTAACACATGGGCTTAGG - Intronic
1038887216 8:31676578-31676600 CTGCTTAATCAGAAAGGCCTGGG + Intronic
1039836889 8:41263724-41263746 CTGATTAAACATAAGGGCTTTGG + Exonic
1043285559 8:78525151-78525173 CTGGGTAAACAGATGGTGCATGG - Intronic
1043422055 8:80107870-80107892 CTGGTTAGACAGATTGGTGTTGG + Intronic
1044496251 8:92888086-92888108 CTGTGTAACCAGATGGGTCTGGG - Intronic
1044898452 8:96918542-96918564 CTGAGTAAACAGAGGGTCCTGGG - Intronic
1045272447 8:100673620-100673642 GTGGTTAAGAACATGGGCCTTGG - Intergenic
1046429157 8:114100418-114100440 CTGATTAAACACATGGGGCAGGG - Intergenic
1047974585 8:130116966-130116988 CTGGATAAGCAGACGGCCCTGGG - Exonic
1048848932 8:138626198-138626220 CGGGTAATCCAGATGGGCCTTGG + Exonic
1050286250 9:4105339-4105361 CTTGTCAAACAGCTGTGCCTGGG - Intronic
1056447978 9:86684950-86684972 CTGGTTAAAGGCATGGGCTTTGG + Intergenic
1057221294 9:93259266-93259288 CTGGGTACACAGGTTGGCCTGGG - Exonic
1059072144 9:111149117-111149139 TTGGACAACCAGATGGGCCTAGG - Intergenic
1061353918 9:130088759-130088781 GTGGTTAAACACATGGGCCTTGG - Intronic
1061665312 9:132157377-132157399 CAGGTGAAACAAATGAGCCTTGG + Intergenic
1062312390 9:135945888-135945910 CTGGTTCAGCTGAAGGGCCTTGG + Exonic
1189207877 X:39257341-39257363 CTCGTTAGACAGATGAGCCCAGG + Intergenic
1190871635 X:54429743-54429765 CTGGTTATACAGATGGGAGAAGG - Intergenic
1192988108 X:76422091-76422113 CTGATTTATCAGATGTGCCTTGG - Intergenic
1194868784 X:99101638-99101660 CTGTTTAAACTGATGGACTTTGG - Intergenic
1197130040 X:122994828-122994850 CTGGTAAATCAGATGGGTCAGGG - Intergenic
1197638439 X:128942180-128942202 CTGAATAAACCTATGGGCCTTGG + Intergenic
1197785344 X:130192196-130192218 CTGGTTACCCAGATCGCCCTGGG - Intergenic
1198049499 X:132936359-132936381 CTAGAGAAACATATGGGCCTGGG - Intronic
1199295457 X:146152944-146152966 CTGGTTAAAAACATGAGCTTGGG - Intergenic