ID: 1170270426

View in Genome Browser
Species Human (GRCh38)
Location 20:14521492-14521514
Sequence AAATGCTTACAGTCTTCCGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 2, 3: 6, 4: 115}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170270426 Original CRISPR AAATGCTTACAGTCTTCCGT AGG (reversed) Intronic
902732610 1:18379292-18379314 GACTGCTTACAATCTTCCATGGG - Intergenic
910007156 1:82411977-82411999 ACATGTTTACAATCTTCCTTTGG - Intergenic
915746277 1:158161200-158161222 AAATTCTTTCAGTATTCAGTTGG + Intergenic
916508444 1:165449404-165449426 AAATGCTCAAAGTCTACAGTAGG + Intergenic
918106852 1:181422914-181422936 AAAGGATTAGAGTCATCCGTTGG + Intronic
920153232 1:203926494-203926516 AACTGCCTACAGTATTCTGTAGG - Intergenic
921627129 1:217389048-217389070 AAAGGCTTTCAGTCTGCTGTCGG + Intergenic
923616211 1:235539884-235539906 AAAGGATTAGAGTCATCCGTTGG - Intergenic
1065039509 10:21677371-21677393 AAATGTATACAGTCATCCTTTGG + Intronic
1073161500 10:101400943-101400965 AAATGATTGCAGTGTTCGGTGGG - Intronic
1076018113 10:127045434-127045456 ATATGCTTACAGTATTCTCTGGG + Intronic
1078065723 11:8078091-8078113 AAATGCTAACCTTCTTCCCTGGG + Intronic
1078678649 11:13452869-13452891 CAATGCTTACTGTCTTTAGTAGG + Intronic
1079953061 11:26828153-26828175 AAATGTTTACAGTTTTAAGTTGG - Intergenic
1081107230 11:39085383-39085405 AAATTCTCAAAGTCTTCTGTAGG - Intergenic
1082741023 11:56911265-56911287 AAAGGCTTACAGCCTTGCCTTGG + Intergenic
1082889269 11:58121335-58121357 AAATGCCTAAAGCCTTCCTTGGG + Intronic
1085730589 11:78995216-78995238 AGATGCTTACAGTTTTCAGCCGG - Intronic
1085930642 11:81078904-81078926 AAATGATGAGAGTCTTCCTTAGG - Intergenic
1090594307 11:128304834-128304856 AAATGCTTTCTGTCTTCTGCTGG - Intergenic
1092840778 12:12539342-12539364 ATATCCTTGCAGTCTTCTGTTGG - Intronic
1093246381 12:16742777-16742799 AAATGCTTACAGTCTCACACAGG + Intergenic
1094400058 12:30053005-30053027 AAATGCTGACAGCCTACAGTTGG + Intergenic
1096060646 12:48696550-48696572 AAAAGCTTACAATTTTCCTTAGG - Intronic
1098202473 12:68070433-68070455 AAATGGTTACAGTCTGCACTAGG + Intergenic
1098718394 12:73861707-73861729 AAGTGAATACAGTCTTCCCTTGG - Intergenic
1099230511 12:80018437-80018459 AAATGTGTACAGTCTTCCTGGGG - Intergenic
1100815962 12:98387512-98387534 AAATGCTTACAATCTTTGCTTGG + Intergenic
1101427459 12:104599704-104599726 ACATGCCCACAGTCTTCCCTGGG - Intronic
1101863751 12:108504282-108504304 AAATGATTTCTGTCTTCTGTAGG - Intergenic
1105482094 13:20787376-20787398 AAATGCTTCCATTCTTTCGGGGG - Intronic
1106532214 13:30603967-30603989 AAATGCATACAGTCGTTCCTTGG - Intronic
1110624660 13:77639209-77639231 AAGTGCTTACAGTCTTAAATGGG + Intronic
1113028877 13:105972056-105972078 AATAGCTTTCAGTCTTCCTTTGG - Intergenic
1115764101 14:36605001-36605023 AAATGCTGTCAGTCTGCCTTGGG + Intergenic
1117255004 14:53968645-53968667 AATTGCATACAGACTTCCATGGG + Intergenic
1124453939 15:29822912-29822934 AAATGCATTCCGCCTTCCGTGGG - Intronic
1124799168 15:32812967-32812989 AAATGTTTTCAGTCTGCAGTTGG - Intronic
1128645547 15:69376270-69376292 AAATGATTGCAGTTTTCCTTTGG + Intronic
1130745268 15:86646653-86646675 AAAAGCATACAGTATTCTGTGGG - Intronic
1130803113 15:87287551-87287573 ACATTCTTACAGTCTTCCTTTGG - Intergenic
1131013393 15:89038173-89038195 AAATCCATGCAGTCTTCCTTGGG + Intergenic
1141045555 16:80713373-80713395 AAATGCTACCAGTCTTCTGGAGG - Intronic
1144998374 17:19286509-19286531 AAATGCTCTCAGTCTACCATTGG + Intronic
1146833071 17:36086913-36086935 AAATGCAAACAGTCATCAGTAGG - Intergenic
1146847592 17:36193534-36193556 AAATGCAAACAGTCATCAGTAGG - Intronic
1150600882 17:66649906-66649928 AAATACCTACAGTATTCAGTCGG - Intronic
1153055612 18:943221-943243 AGTTGCTTACAGTATTCAGTAGG - Intergenic
1155086861 18:22467434-22467456 AAATGCTTAAAGTTCACCGTGGG + Intergenic
1157301626 18:46483784-46483806 AAATGCTTACCTGCTTCAGTGGG - Intronic
1159472564 18:68876967-68876989 AAATGATTACAGGCTTTCATTGG - Intronic
1163758977 19:19123023-19123045 CAATACTTACAGTTTTCCTTTGG - Intronic
925757432 2:7147266-7147288 AAATGCTTACTGTCATTTGTTGG + Intergenic
926852788 2:17219228-17219250 AAATGCTTACAGATTTCCAGAGG - Intergenic
930232932 2:48860821-48860843 AAATGCCTAAAGTGTTCTGTGGG + Intergenic
931617138 2:64171147-64171169 AATTGCCTACAGTATTCAGTAGG + Intergenic
938740617 2:134228310-134228332 AAATGCTTAGAGTCTGCCCTTGG + Intronic
941310435 2:163922421-163922443 AAAATCTAACATTCTTCCGTTGG - Intergenic
943608476 2:190004413-190004435 AAATTCTTACAGTGACCCGTAGG + Intronic
1170270426 20:14521492-14521514 AAATGCTTACAGTCTTCCGTAGG - Intronic
1174239133 20:49118680-49118702 AAATGCTTCCCGTCTTCCTGTGG - Intronic
1174999854 20:55615586-55615608 AAATGTTTGCAGACTTCTGTAGG + Intergenic
1182571152 22:31239163-31239185 AAATGCCTAAAGTCTACAGTTGG - Intronic
1183300851 22:37058449-37058471 TAAAGCTTACAGCCCTCCGTAGG + Intronic
949818578 3:8089863-8089885 AAATGCTATCAGTCTTCCCGAGG - Intergenic
951058156 3:18172652-18172674 AAAGGATTTCAGACTTCCGTGGG - Intronic
955039970 3:55306689-55306711 AATTGCTATCAGTGTTCCGTGGG - Intergenic
957031066 3:75242135-75242157 AAATGCTTCCAGTTTTACTTGGG + Intergenic
960037481 3:113116449-113116471 AAATGCTTACAGTGTTCCATAGG - Intergenic
963596427 3:147332601-147332623 AAATACTTATAGTCTTCCTTAGG - Intergenic
964166503 3:153712933-153712955 AAATATTTCCAGTCTTCAGTAGG - Intergenic
964488309 3:157208612-157208634 AAATTCTTACATTCTGCTGTGGG + Intergenic
965770135 3:172173492-172173514 AAATGTTTAAAGCCTTCTGTAGG + Intronic
967594194 3:191311258-191311280 AAATGGTTACAGGTTTCTGTGGG + Intronic
969706619 4:8795755-8795777 TTAAGCTTACAGTCTTCAGTAGG - Intergenic
970451768 4:16174660-16174682 AAATGCTCACATTTTTCTGTCGG + Exonic
971335304 4:25717921-25717943 AAAGGATTAGAGTCATCCGTTGG - Intergenic
979554185 4:122026046-122026068 AATTGCTTACAGTATTTAGTAGG - Intergenic
983295981 4:165869781-165869803 AAATGATTGCATTCTTCCTTTGG - Intergenic
983733826 4:171032234-171032256 AAATGCTTATACTCTTCCTATGG + Intergenic
988661601 5:33276260-33276282 AAATGCTTCCAGGCTTGCCTGGG + Intergenic
989798155 5:45501141-45501163 AAATGATTACAGTCTTCCAAAGG + Intronic
990044440 5:51412030-51412052 AAATGATTGCAGCCTTCAGTGGG + Intergenic
992995933 5:82332850-82332872 AATTGCTTGCAGTCATCAGTAGG + Intronic
993948242 5:94140628-94140650 AAAAGCTCAAAGTGTTCCGTCGG - Intergenic
1000688214 5:164280318-164280340 AAATGCATAGCGTCTTCTGTAGG - Intergenic
1003747056 6:9014142-9014164 AATTGCCTACAGACTTCTGTGGG + Intergenic
1005211552 6:23470696-23470718 AAGAGCTTACAGTGTTCCGAGGG - Intergenic
1010599942 6:77812488-77812510 ATATGCTTAGAGTGTTCTGTAGG + Intronic
1012545548 6:100415004-100415026 AGAAGCATACAGTCTTCTGTAGG + Intronic
1017070650 6:150573120-150573142 CACTGCTTGCAGTCTTCCGAGGG + Intergenic
1017266420 6:152451390-152451412 AAATCCTTTCAGTCTGCTGTGGG + Intronic
1017680622 6:156860650-156860672 AAAGGATTTCAGTCTTCAGTTGG + Intronic
1019095151 6:169573584-169573606 AAATAGTTACAGTCATCCCTCGG - Intronic
1020102397 7:5401566-5401588 AAAAGCTTGCTGTCTTCAGTGGG - Intronic
1028746387 7:94331744-94331766 AAATGCTTACAATCTTCCCTGGG + Intergenic
1030677245 7:112397026-112397048 AAATGCCTAGAGTCTTATGTAGG - Intergenic
1035655989 8:1305441-1305463 AACTGCTTATAGTCATCCCTGGG + Intergenic
1035993845 8:4523204-4523226 ACATGTTCACAGTCTTCTGTGGG + Intronic
1036959786 8:13231358-13231380 AAATGCACACAGTCATCAGTGGG - Intronic
1037089975 8:14901938-14901960 AAATGCTGACAGTCAGCCTTAGG + Intronic
1038649691 8:29391134-29391156 AAATGCTTACAGCCTTCAAACGG - Intergenic
1041249663 8:55922004-55922026 AAATAGGTACATTCTTCCGTGGG + Intronic
1041544253 8:59023816-59023838 AAATGATTATAGTCATCTGTTGG + Intronic
1044520776 8:93196948-93196970 AAGTGCTTACAGTCTTGCAGAGG - Intergenic
1045740796 8:105357362-105357384 AAATGCTTACATTCTTCATAGGG - Intronic
1047312878 8:123707106-123707128 AAATACTGACAGCCTTCTGTGGG - Intronic
1047693221 8:127377663-127377685 AAATGCTTACATGCTGCTGTGGG - Intergenic
1050968052 9:11834034-11834056 AATTACTTACAGGCTTCCTTTGG + Intergenic
1052412442 9:28139576-28139598 AAATGCTTAGATTCTTCAGTTGG + Intronic
1055203354 9:73695225-73695247 AAATCCTTAGAGTTTTCCTTTGG - Intergenic
1055584223 9:77740367-77740389 ATATGCTTACAGTCTTTGGTGGG - Intronic
1058556964 9:106179424-106179446 AGATGCAAACAGACTTCCGTCGG - Intergenic
1061919263 9:133773237-133773259 AACTGCCTACAGTATTCAGTAGG - Intronic
1186601270 X:11040358-11040380 AAATGCTGACACTCTTTCTTGGG - Intergenic
1187027303 X:15448913-15448935 AAATGCTCACAGTCTAGCTTGGG - Intronic
1187095595 X:16144472-16144494 CAATTCCTACAGACTTCCGTAGG + Intronic
1196739498 X:119012079-119012101 AAATGCTCATATTCTTCAGTTGG - Intronic
1198246089 X:134833116-134833138 AATTACTTACAGTCATCCCTTGG - Intronic
1198436577 X:136622589-136622611 ACATGTTTAGAGTCTTCTGTTGG + Intergenic
1198502251 X:137262336-137262358 AAATACATACAGTCATCCCTTGG + Intergenic
1198736006 X:139785951-139785973 AACTACTTAAAGTCTTCCATGGG - Intronic
1200020130 X:153196429-153196451 AAATGTTTACAGTGTTACGCTGG - Intergenic
1202042259 Y:20697840-20697862 AAATGCTTCCAGTGTGCCCTAGG - Intergenic