ID: 1170271919

View in Genome Browser
Species Human (GRCh38)
Location 20:14537064-14537086
Sequence AACAGAAAACAGAAGGAAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1988
Summary {0: 1, 1: 1, 2: 21, 3: 193, 4: 1772}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170271919_1170271931 21 Left 1170271919 20:14537064-14537086 CCCCCTTCCTTCTGTTTTCTGTT 0: 1
1: 1
2: 21
3: 193
4: 1772
Right 1170271931 20:14537108-14537130 TTGATCACTGGGATAGTGGTTGG 0: 1
1: 0
2: 1
3: 9
4: 111
1170271919_1170271927 10 Left 1170271919 20:14537064-14537086 CCCCCTTCCTTCTGTTTTCTGTT 0: 1
1: 1
2: 21
3: 193
4: 1772
Right 1170271927 20:14537097-14537119 CTACCCTGGGATTGATCACTGGG 0: 1
1: 0
2: 1
3: 10
4: 100
1170271919_1170271930 17 Left 1170271919 20:14537064-14537086 CCCCCTTCCTTCTGTTTTCTGTT 0: 1
1: 1
2: 21
3: 193
4: 1772
Right 1170271930 20:14537104-14537126 GGGATTGATCACTGGGATAGTGG 0: 1
1: 0
2: 0
3: 7
4: 98
1170271919_1170271925 -3 Left 1170271919 20:14537064-14537086 CCCCCTTCCTTCTGTTTTCTGTT 0: 1
1: 1
2: 21
3: 193
4: 1772
Right 1170271925 20:14537084-14537106 GTTCACTCTCATTCTACCCTGGG 0: 1
1: 0
2: 2
3: 6
4: 135
1170271919_1170271924 -4 Left 1170271919 20:14537064-14537086 CCCCCTTCCTTCTGTTTTCTGTT 0: 1
1: 1
2: 21
3: 193
4: 1772
Right 1170271924 20:14537083-14537105 TGTTCACTCTCATTCTACCCTGG 0: 1
1: 0
2: 1
3: 9
4: 160
1170271919_1170271926 9 Left 1170271919 20:14537064-14537086 CCCCCTTCCTTCTGTTTTCTGTT 0: 1
1: 1
2: 21
3: 193
4: 1772
Right 1170271926 20:14537096-14537118 TCTACCCTGGGATTGATCACTGG 0: 1
1: 0
2: 1
3: 5
4: 100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170271919 Original CRISPR AACAGAAAACAGAAGGAAGG GGG (reversed) Intronic
900560220 1:3301352-3301374 AAAAAAAAAAGGAAGGAAGGAGG + Intronic
900754054 1:4421181-4421203 AAAAAAAAACAGACAGAAGGAGG - Intergenic
900827379 1:4937659-4937681 AACAGCAGAGGGAAGGAAGGAGG + Intergenic
900943081 1:5813751-5813773 AGGAGAACAGAGAAGGAAGGAGG + Intergenic
901027976 1:6289074-6289096 ACCAGAAAACAGTGGGAATGCGG - Intronic
901419676 1:9142555-9142577 AAAAAAAAAAAAAAGGAAGGAGG - Intergenic
901441932 1:9283273-9283295 AAAAGAAAAGAAAAGGAAGGGGG + Intergenic
901574036 1:10185550-10185572 AAAAGAAAAAAGAAAGAAAGGGG + Intergenic
901600033 1:10416484-10416506 CACAGCAACCAGAAGAAAGGTGG - Intronic
901788265 1:11638904-11638926 AAAAAAAAAAAAAAGGAAGGGGG - Intergenic
901796758 1:11684018-11684040 AATCACAAACAGAAGGAAGGTGG + Intronic
902253603 1:15172399-15172421 AAAAAAAAAAGGAAGGAAGGAGG + Intronic
902335448 1:15751853-15751875 AAAAAAAAAAAAAAGGAAGGTGG + Intergenic
902652077 1:17843660-17843682 AAGTGAAAGGAGAAGGAAGGTGG - Intergenic
903004919 1:20292193-20292215 AAAAAAAAAAAGAAGGAAGGAGG - Intronic
903116589 1:21183388-21183410 AAAAAAAAAAAAAAGGAAGGAGG + Intergenic
903395294 1:22997435-22997457 AAGAGAAAATAGGAGGAAGAAGG - Intergenic
903593085 1:24471995-24472017 AAAAAAAAAGGGAAGGAAGGGGG - Intronic
903605749 1:24573963-24573985 AAAAAAAAACAGAAAAAAGGGGG + Intronic
903609176 1:24597502-24597524 AAAAAGAAAGAGAAGGAAGGGGG + Intronic
903799460 1:25955717-25955739 AAGAGAAAAAGGAAGGAAGGAGG + Intergenic
903953299 1:27008966-27008988 AAAAAAAAAAAGAAGGATGGAGG - Intronic
903959221 1:27046256-27046278 AAAAAAAAAAAGAAGGAAGGAGG - Intergenic
904492011 1:30866860-30866882 AACAGAATCAAGAGGGAAGGAGG - Intergenic
904573015 1:31481550-31481572 AACAGAAATCACAAGAAAGCTGG + Intergenic
904696537 1:32334847-32334869 AAGAGAAATCGGAAGGAGGGTGG - Exonic
904752251 1:32748292-32748314 AACTCAAAAAAAAAGGAAGGTGG + Intronic
904998521 1:34650214-34650236 AAAAGAAAAGAAAAGGAGGGAGG + Intergenic
905053696 1:35075206-35075228 AACAGAAACCAAAAGTAAGCAGG - Intronic
905160695 1:36031157-36031179 AAAACAAAACAAAAGTAAGGAGG - Intronic
905411131 1:37768985-37769007 AACAAAAAACAGAAGAAAAAAGG + Intergenic
905619454 1:39430571-39430593 AAAAAATAACTGAAGGAAGGAGG + Intronic
905715741 1:40148175-40148197 ACCTCAAAACAGAAAGAAGGAGG - Intergenic
905827394 1:41036302-41036324 ACCATAGAAGAGAAGGAAGGTGG - Intronic
905848479 1:41255303-41255325 AACAGAAAACATAAAAAAGCAGG - Intergenic
906043584 1:42809284-42809306 AATTGAAAAGACAAGGAAGGGGG + Intronic
906180908 1:43817879-43817901 AAAAGAAAGAAGAAAGAAGGAGG - Intronic
906428128 1:45731440-45731462 AAAACAAAACAGAACAAAGGTGG + Intronic
906485871 1:46234573-46234595 AATATAAAGTAGAAGGAAGGAGG - Intergenic
906590556 1:47021155-47021177 AAAAAAAAAAAAAAGGAAGGAGG + Intergenic
906668560 1:47638686-47638708 AACACAAGCCAGGAGGAAGGAGG + Intergenic
906798346 1:48715114-48715136 AACAAAGAACTGAAGGAAGTGGG + Intronic
906814396 1:48863362-48863384 AACAGAAAACACAAATATGGTGG + Intronic
906836525 1:49088413-49088435 AACAGAAAACAGAAAAAAGCAGG + Intronic
906993813 1:50768115-50768137 AACAGAAAACAGAACAAAACAGG + Intronic
907255284 1:53174166-53174188 AACAGGACAAAGAAGGCAGGAGG + Intergenic
907665540 1:56431184-56431206 AAGAGAAGAAAGAAGAAAGGAGG + Intergenic
907770105 1:57452995-57453017 AAAAGAAAAAAGAAGGAGGGAGG + Intronic
907923958 1:58938689-58938711 AAAAGAAAAGAAAAGGAAGAAGG - Intergenic
907928667 1:58978835-58978857 AACAGAAAGCAGTAGGATGGGGG + Intergenic
908356295 1:63327439-63327461 AAAAAAAAACTAAAGGAAGGGGG + Intergenic
908391057 1:63683962-63683984 GCCAGAAAACAGAAAGGAGGGGG - Intergenic
908464678 1:64381435-64381457 AACAGAAAACTCATTGAAGGTGG + Intergenic
908710963 1:67013595-67013617 GACAGCAAAGAGGAGGAAGGAGG - Intronic
908792997 1:67801936-67801958 GAAGGAAAAAAGAAGGAAGGGGG + Intronic
908879648 1:68716433-68716455 AAATAAAAACAGAAAGAAGGAGG - Intergenic
909184517 1:72469477-72469499 AAAAGAAAATAAAAGAAAGGAGG + Intergenic
909559497 1:76993820-76993842 AATTGAAAACAGAAGGAATATGG - Intronic
909606236 1:77511401-77511423 AACAGGATAAAGAAGGATGGAGG + Intronic
909615953 1:77607923-77607945 AAAAAAAAAAAAAAGGAAGGAGG + Intronic
909973402 1:82018182-82018204 CAAAGAGAAAAGAAGGAAGGTGG - Intergenic
910059167 1:83068133-83068155 AAGAGAGAAAGGAAGGAAGGAGG - Intergenic
910064654 1:83139161-83139183 AACACAAAACAGAATAAAGCAGG - Intergenic
910187023 1:84555032-84555054 AACAGCAAACTGAAGAAATGTGG - Exonic
910707635 1:90146679-90146701 AAAAGGAAAAAGAAGGAAGAGGG + Intergenic
910720918 1:90285560-90285582 AAAAGAAAAGAAAAGAAAGGAGG - Intergenic
910838694 1:91540902-91540924 AACAGTCAGGAGAAGGAAGGTGG + Intergenic
910855519 1:91691210-91691232 GAGAGAAAACAGAAAAAAGGGGG + Intronic
910980537 1:92956069-92956091 AAAAGAAAAGAAAAGGAGGGAGG + Intronic
911122745 1:94312423-94312445 AAAAAAAAAAAGAAGGAGGGGGG - Intergenic
911586111 1:99692784-99692806 AACAGAAGGCAGAAGGCAGAAGG - Intronic
911836119 1:102621387-102621409 AACATAAAACAGAAAAAAGCAGG - Intergenic
911883973 1:103273851-103273873 AACAGAAACCTAAAGGAAAGAGG + Intergenic
911888494 1:103335479-103335501 AACACAAAACAGAATGGATGAGG - Intergenic
911993108 1:104727617-104727639 AACAAAAAACAGAAGGAAAGTGG + Intergenic
912153987 1:106893326-106893348 AACAGAAAACAGAAAGAAAAAGG + Intergenic
912276000 1:108259544-108259566 AACAGGTAAAAGAAGGAAGAAGG - Intergenic
912292228 1:108434815-108434837 AACAGGTAAAAGAAGGAAGAAGG + Intronic
912323053 1:108732715-108732737 AAGAGAAAAGAGAGGGAGGGAGG - Intronic
912357375 1:109065928-109065950 AAAAAAAAACAAAAGGAAGAAGG + Intronic
912594968 1:110865895-110865917 AACAGAAAACAGAAAAAAGTAGG + Intergenic
912604584 1:110976129-110976151 AGCAGAAAACAGCAGCTAGGAGG - Intergenic
912639186 1:111328671-111328693 AATGGAAAACAGAAAAAAGGAGG - Intergenic
912832746 1:112968149-112968171 AACATAGAACAGATGGAAGGTGG + Intergenic
913310994 1:117493115-117493137 AGGAGAAAACAGAAGGATAGAGG - Intronic
914344449 1:146786470-146786492 GACAGAAAAGAGAAAGAAGAAGG - Intergenic
914383721 1:147146693-147146715 AACAGGTAAAAGAAGGAAGAAGG - Intergenic
914476642 1:148029063-148029085 AAAAGAAAAGAGAAGAAAAGAGG - Intergenic
914735502 1:150412535-150412557 AAGAGAAAACACAAGGTAGCAGG + Intronic
914850192 1:151308453-151308475 AAGAAAAAGCAGATGGAAGGAGG + Intronic
915053746 1:153105341-153105363 AACAAAAAACAGAAAAAAGCAGG + Intronic
915092689 1:153437548-153437570 AACATGTAAGAGAAGGAAGGCGG - Intronic
915123752 1:153649168-153649190 AACAGAGAAGAGAAAGGAGGTGG + Intergenic
915272715 1:154766654-154766676 AAAACAAAACAGTAGGAAAGTGG - Intronic
915360574 1:155284237-155284259 AACAGAAAATAGGAGCGAGGAGG + Intronic
915450111 1:155998943-155998965 TACCAAAAACAGATGGAAGGGGG - Intronic
916231061 1:162541801-162541823 AACAGAGAACTGAGGGAAGAGGG - Intergenic
916275739 1:162991324-162991346 AACAAAAAACTGAAGTAATGTGG + Intergenic
916522020 1:165572173-165572195 AACAAAAAAAAGGAGGTAGGGGG - Intergenic
916610666 1:166388369-166388391 AAAAAAAAAAAGAAGGAAGAAGG + Intergenic
916644731 1:166771650-166771672 AACAGAAACTAAAAGGAAGCAGG + Intergenic
916867854 1:168879560-168879582 AACAGGAAAAAAAATGAAGGTGG - Intergenic
916904248 1:169264413-169264435 AACGGAAAACAGAAAAAAGCAGG + Intronic
916929669 1:169562550-169562572 AAAAGAAAACAGAAAGGAAGGGG - Intronic
916946206 1:169730367-169730389 ATCAAAAAACAGAAGCAATGAGG + Intronic
916981122 1:170138195-170138217 GACAGAAAAGAGAAGAAAAGAGG - Intergenic
917049352 1:170901896-170901918 AACAGAAAAAAGATGGTAGGAGG - Intergenic
917077395 1:171219622-171219644 AACTGAACACAGCAGTAAGGTGG + Intergenic
917129913 1:171730671-171730693 AACAAAAGAGAGAGGGAAGGAGG + Intronic
917159299 1:172039767-172039789 AACAGAGAAAGGAAGGCAGGAGG - Intronic
917211210 1:172633682-172633704 AACAGATAATAGAAGGAGTGTGG - Intergenic
917245429 1:172995925-172995947 AACAGAAAAGAGAGAGAATGAGG - Intergenic
917249787 1:173045922-173045944 AAGAGAAAATAGAAGTACGGAGG - Intronic
917307272 1:173639474-173639496 AAGAGAACACAGAAGGAAAATGG + Intronic
917601568 1:176579271-176579293 AACAGGAAAAAGGAGGAAGTGGG + Intronic
917608537 1:176661806-176661828 AAGACAGACCAGAAGGAAGGTGG + Intronic
917683783 1:177395162-177395184 AACAGAGAAGAGAAGGTTGGGGG + Intergenic
917991221 1:180381038-180381060 AACAGAAACCAAAAGCAAGCAGG + Intronic
918120880 1:181539171-181539193 AACGGAAAATAGAAGGAAATGGG - Intronic
918230967 1:182531389-182531411 AACAGAAAAAAGGAAGAAAGAGG + Intronic
918430489 1:184454935-184454957 AAGAGAAAAGAGAAAGAAAGAGG + Intronic
918694316 1:187524320-187524342 AAAATAAAACAGAAGCAGGGTGG - Intergenic
918820963 1:189253724-189253746 AATAGTTAACAGAAGGAGGGGGG + Intergenic
918876120 1:190046223-190046245 AGAAGAGAAAAGAAGGAAGGAGG + Intergenic
918930343 1:190847220-190847242 AAAAGAAAAAGGAAGGAAGGAGG + Intergenic
918948886 1:191109026-191109048 AACAGAAAGCAGAAAAAAGCAGG - Intergenic
919015534 1:192028879-192028901 AATGGAAAACAGAAAGAAGCAGG - Intergenic
919058868 1:192606057-192606079 GAAAGAAAAAAGAAGGAGGGAGG + Intergenic
919333050 1:196195429-196195451 GAAAGAAAACAGAAGAAAGAAGG + Intergenic
919381533 1:196867278-196867300 AAAAAAAAACAGAAGGAAATGGG - Intronic
919423258 1:197398426-197398448 AAGGCAAAACTGAAGGAAGGCGG + Intronic
919457960 1:197842330-197842352 AAAAAAAAACAGAAGCAGGGAGG - Intergenic
919464329 1:197912003-197912025 AACAGAAAATAAAAGACAGGTGG + Intronic
919651487 1:200153765-200153787 AAGAAAAAATAAAAGGAAGGAGG + Intronic
919846002 1:201642607-201642629 AAAAGGAAAGGGAAGGAAGGTGG - Intronic
920043689 1:203120259-203120281 ACTAGAGAAAAGAAGGAAGGAGG - Intronic
920049528 1:203154926-203154948 CAGAGAAAAAAGAAGGAAGAGGG - Intronic
920055914 1:203191567-203191589 AAGAGGAAACAGGAGTAAGGGGG - Intergenic
920061594 1:203230545-203230567 AAAAAAAAACAGAAGAATGGTGG + Intronic
920120902 1:203657313-203657335 AACAGGAAAGAGAAAGAAGAAGG - Intronic
920131012 1:203731857-203731879 AAAAAAAAAAAAAAGGAAGGAGG + Intronic
920350340 1:205333934-205333956 AAGAGAAAAAAGAAAGAAGAGGG - Intergenic
920457740 1:206113904-206113926 AGCACAGAATAGAAGGAAGGAGG - Intronic
920683705 1:208092933-208092955 AAGAGAACAAAGAGGGAAGGTGG + Intronic
920859390 1:209692981-209693003 AAAATAAAAGAGAATGAAGGAGG - Intronic
920947335 1:210542028-210542050 AAGAGAAAGCAGAAGGAAGGAGG - Intronic
921203925 1:212831943-212831965 AACAGAAAACAGCAGGGTGGGGG - Intronic
921274205 1:213501947-213501969 AACAGGAAATGGAAGGATGGAGG - Intergenic
921304545 1:213782676-213782698 AACAGAGAAAAGGAAGAAGGAGG + Intergenic
921333308 1:214062149-214062171 ATCAGAGACCAGAAGGAAGTAGG - Intergenic
921349886 1:214224339-214224361 AAGAAAAAAAAAAAGGAAGGAGG + Intergenic
921746087 1:218742393-218742415 AACAAAAAACAGAGGGGAGGTGG + Intergenic
921969688 1:221134433-221134455 AAGAGAAAAAAGATGGGAGGTGG - Intergenic
922114014 1:222591567-222591589 AGCATAAACAAGAAGGAAGGAGG + Intergenic
922386647 1:225091889-225091911 AACAGGAAACAGAAAAAAGCAGG + Intronic
922587657 1:226747553-226747575 AAAAGAAAAGAAAAGGAATGTGG + Intergenic
922663032 1:227446962-227446984 AAGAGCAAACAGAAGGCTGGGGG - Intergenic
922707575 1:227797316-227797338 AAGAGGACACAGGAGGAAGGTGG + Intergenic
922781281 1:228255029-228255051 AAAAAAAAAAAAAAGGAAGGGGG - Intronic
922873164 1:228919220-228919242 GCCAGAAGGCAGAAGGAAGGGGG - Intergenic
922884760 1:229009639-229009661 AAAAGAAAAAAGAAGAAATGAGG + Intergenic
922912326 1:229228196-229228218 TACAGTAAACAAAAGGCAGGTGG + Intergenic
923028002 1:230221958-230221980 AAAAGAAGACAGAAGTAAGGAGG - Intronic
923105006 1:230847706-230847728 AACAGAATACAGAAAGACTGTGG + Intronic
923211012 1:231804452-231804474 AAAAAAAAAAAAAAGGAAGGGGG - Intronic
923283191 1:232464794-232464816 AATTGAAAACATAAGGATGGCGG + Intronic
923292947 1:232564432-232564454 AACAAAAACCAGGAGGGAGGGGG + Intergenic
923353870 1:233134540-233134562 AAAAGAAAACAGAAGAAAAAAGG + Intronic
923428849 1:233900406-233900428 AAGAGACAACATAAGGAATGAGG + Intergenic
923942853 1:238847719-238847741 AACAAACAACAGGAAGAAGGAGG + Intergenic
923943784 1:238859695-238859717 AAAAGAAAAGAGAAGGCTGGAGG + Intergenic
923986174 1:239385590-239385612 GAAAGAAAAAGGAAGGAAGGAGG - Intergenic
924156023 1:241177424-241177446 AACAGAAAATGGAAGTAAAGGGG + Intronic
1062840738 10:669299-669321 AAGACAAGACAGAAGCAAGGGGG + Intronic
1062922890 10:1293193-1293215 AATAGAAAAAAGAGGGAGGGAGG + Intronic
1063095481 10:2904970-2904992 AACAAAAAACACAAAGACGGAGG - Intergenic
1063201860 10:3791600-3791622 AAGAGAAAAGAAAAGAAAGGGGG + Intergenic
1063246475 10:4225038-4225060 AAGAGAAAATAAAAGGAAGAGGG + Intergenic
1063289982 10:4735188-4735210 AACTGAAAGAGGAAGGAAGGAGG - Intergenic
1063440291 10:6067455-6067477 TGCAGAAAAAAAAAGGAAGGAGG + Intergenic
1063440801 10:6071449-6071471 AACAAAAAAAAGAAAGAAGGAGG - Intergenic
1063460495 10:6212352-6212374 AAGACAAAACAGCAGGAAGGGGG - Intronic
1063834078 10:9992141-9992163 ACCAAAAGACAGAAGGAAAGAGG + Intergenic
1063986159 10:11505105-11505127 TAGAGATAACAGAAGAAAGGAGG + Intronic
1064074098 10:12255163-12255185 AGGAGAAAACAGAGGGAGGGTGG - Intergenic
1064125057 10:12652220-12652242 AACAAAAAACAGAATAAAGATGG - Intronic
1064218208 10:13417933-13417955 GACAGCAAAGAGAAGGAAGAGGG - Intergenic
1064232181 10:13538681-13538703 AAAAGAAAAAAGAAAAAAGGTGG + Intergenic
1064242058 10:13639879-13639901 AACAGAAAGCAAATAGAAGGGGG - Intronic
1064366772 10:14715660-14715682 AACAGAAAGGTGGAGGAAGGGGG + Intronic
1064421731 10:15196687-15196709 AAGAGAGGAAAGAAGGAAGGAGG - Intergenic
1064700974 10:18021442-18021464 AACAGAAAACAGAAAAGAGCAGG - Intronic
1064947386 10:20806109-20806131 ATTAGAAAAGAGAAGGAATGTGG + Intronic
1064952863 10:20873524-20873546 AGAAGAAGAAAGAAGGAAGGAGG + Intronic
1064971041 10:21067465-21067487 AAGAGAAAGCAGGAGGAGGGAGG + Intronic
1065275484 10:24081521-24081543 AACAGGAAAAGGAAGGAACGAGG - Intronic
1065360040 10:24880993-24881015 AAGAGAGAAAGGAAGGAAGGAGG - Intronic
1065388221 10:25155417-25155439 AAAAGAAAGCAGAAAGAAGTGGG + Intergenic
1065497279 10:26342089-26342111 AAGAGAGAAAGGAAGGAAGGAGG + Intergenic
1065698832 10:28404904-28404926 AAAAAAAAAAAGAAGGAAGGCGG + Intergenic
1065904800 10:30240757-30240779 AAAAGAAGAAAGAAGGAAGAAGG + Intergenic
1065939668 10:30552908-30552930 AATAGAAAAAAGAAGAAAAGAGG - Intergenic
1066168139 10:32810338-32810360 AACAGAAAACAAAAGTGAGCAGG + Intronic
1066336531 10:34483507-34483529 AAAAAAAAACAGAAAAAAGGGGG + Intronic
1066386863 10:34948521-34948543 AAAAGAAAAAAGAAAGATGGAGG + Intergenic
1066556002 10:36613725-36613747 AATAGAAGTCAGAAGAAAGGGGG - Intergenic
1066714828 10:38275571-38275593 AACTGAAAATAGAGAGAAGGGGG - Intergenic
1066783249 10:38975131-38975153 AACTGAAAATAGAGAGAAGGGGG + Intergenic
1066951442 10:42121938-42121960 AACAGAGAAAGGAAGAAAGGAGG - Intergenic
1067009039 10:42692233-42692255 AAAAAAAAAAAAAAGGAAGGGGG + Intergenic
1067030625 10:42877114-42877136 AACAGAAAGGCCAAGGAAGGAGG + Intergenic
1067383274 10:45794837-45794859 CAAAGAAAACAGAAAGAAGCTGG - Intergenic
1067788219 10:49268064-49268086 AGAAAAAAACAGAATGAAGGAGG + Intergenic
1067798714 10:49341290-49341312 CACAGAAAAAAGAAAGAAAGAGG + Intergenic
1067890980 10:50135385-50135407 CAAAGAAAACAGAAAGAAGCTGG - Intergenic
1067945117 10:50684357-50684379 ACCTGGAAACAGAAGGAAGAAGG - Intergenic
1068170183 10:53382728-53382750 AACGGAACACATTAGGAAGGAGG - Intergenic
1068201429 10:53788634-53788656 AAGAGAGAAAGGAAGGAAGGAGG + Intergenic
1068311040 10:55275013-55275035 AAGAGAAAACAGCAGGAAATGGG - Intronic
1068357217 10:55924053-55924075 GAGAGAAAAGAAAAGGAAGGAGG + Intergenic
1068414434 10:56699798-56699820 AACAGAAAATAGAAAGAAAGGGG + Intergenic
1068519048 10:58059256-58059278 AACAGAAAGCAGAAAAAAGCAGG + Intergenic
1068654399 10:59559894-59559916 AACAGAAAGCATGAGGAAGGAGG + Intergenic
1068771057 10:60821012-60821034 AAGAAAAATCACAAGGAAGGAGG + Intergenic
1068885052 10:62089511-62089533 AAAAAGAAAAAGAAGGAAGGAGG - Intronic
1068895512 10:62195552-62195574 AAGACAAAAAGGAAGGAAGGAGG + Exonic
1068901539 10:62274823-62274845 GATAGAAAACAGTAGGAAGGGGG + Intergenic
1068909281 10:62360829-62360851 AACACAAAAGAAAAGGAAGATGG + Intergenic
1069108171 10:64409424-64409446 AAAAGAAAGAGGAAGGAAGGAGG + Intergenic
1069167475 10:65180483-65180505 AACGGAAAACAGAAAAAAGAAGG - Intergenic
1069340741 10:67405362-67405384 AATAGAAAACAGAAAAAAGCAGG + Intronic
1069346753 10:67478936-67478958 AACAGAAAACAAAAAAACGGCGG + Intronic
1069364140 10:67678774-67678796 AACACACAAAAGAAGGAAGAAGG + Intronic
1069397513 10:68005941-68005963 ATCAGAAAACAGGAGGCAAGAGG - Intronic
1069493365 10:68880654-68880676 AACAAAAAACAGTAGGAATTAGG - Intronic
1069556333 10:69400959-69400981 ACGAGAAAACAGAAGGTAGTTGG - Intronic
1069649168 10:70031083-70031105 GACAGAAAACAGGAGGAAGTAGG + Intergenic
1069718518 10:70535587-70535609 AAGAGGAAGGAGAAGGAAGGAGG - Intronic
1069817277 10:71206411-71206433 AAAACAAAGCAGGAGGAAGGAGG + Intergenic
1069917067 10:71793707-71793729 AAGAGAAAGGAGAAAGAAGGGGG - Intronic
1070050680 10:72886623-72886645 AACACAAATCAGAGGGAAAGGGG + Exonic
1070081115 10:73188735-73188757 AAAAAAAAAAGGAAGGAAGGAGG + Intronic
1070347249 10:75557009-75557031 AACAGAAAACAAAAGTAAAATGG + Intronic
1070458439 10:76641539-76641561 AACAGAAGACAGGAGGAAAAGGG - Intergenic
1070652641 10:78249013-78249035 CACAGCACACAGGAGGAAGGAGG - Intergenic
1070759753 10:79016691-79016713 AGGAGAGACCAGAAGGAAGGAGG + Intergenic
1070866622 10:79711229-79711251 ACCTGGAAACAGAAGGAAGAAGG - Exonic
1070880411 10:79849350-79849372 ACCTGGAAACAGAAGGAAGAAGG - Exonic
1070947741 10:80407611-80407633 AACAAAAAACAAAAAGTAGGAGG - Intergenic
1071013355 10:80965417-80965439 AAAAGGAAACAAAAGGAAAGAGG - Intergenic
1071186841 10:83056234-83056256 AAGACAAAACAGGAGGAAGAAGG - Intergenic
1071191959 10:83111105-83111127 AATGGAAAACAGAAAAAAGGGGG + Intergenic
1071467867 10:85957560-85957582 ATCAGAGAGCAGTAGGAAGGAGG + Intronic
1071616964 10:87083615-87083637 AACAGAAACTAGAAGGAGGAAGG + Intronic
1071633534 10:87233452-87233474 ACCTGGAAACAGAAGGAAGAAGG - Exonic
1071646981 10:87365668-87365690 ACCTGGAAACAGAAGGAAGAAGG - Exonic
1072276307 10:93826696-93826718 AACAGAAAATAGAGAGAAGGCGG - Intergenic
1072363787 10:94688095-94688117 AACAGAAAACAGAAGCTACGAGG - Intronic
1072484896 10:95845648-95845670 AACAGAAAACAACAGGATGTGGG - Intronic
1072783728 10:98266996-98267018 GACAGAAGAGGGAAGGAAGGTGG + Intronic
1073542269 10:104323883-104323905 CACAGTAAAGAGCAGGAAGGTGG - Intronic
1073704714 10:105970143-105970165 AAGAGAAAGAAGAACGAAGGAGG + Intergenic
1073761876 10:106637959-106637981 AACAGAATACATAAGACAGGAGG + Intronic
1073840547 10:107494396-107494418 AAGGGAAAAGAGAATGAAGGTGG - Intergenic
1073946779 10:108759957-108759979 AAAGGAAAACAGATGAAAGGAGG + Intergenic
1074088095 10:110224009-110224031 AAAAGAAAACAAAAGGTATGAGG + Intronic
1074194751 10:111173541-111173563 AACAGACAACAGAAAAAAGCGGG - Intergenic
1074213252 10:111357964-111357986 TACAGAAAATAGTAGGAGGGGGG + Intergenic
1074335955 10:112575996-112576018 AAAAGAAAAGAAAAGGCAGGGGG - Intronic
1074561450 10:114538982-114539004 AACTGAAAACAGAAGCCTGGAGG - Intronic
1074609017 10:115003704-115003726 AGCAAAAACTAGAAGGAAGGAGG + Intergenic
1074874127 10:117601156-117601178 AAAAGAAAAAATAAAGAAGGAGG - Intergenic
1075866456 10:125725144-125725166 AACAAAAAACAAAAGAAAGGTGG + Intronic
1076565778 10:131398125-131398147 AGCAGAAAACAGAGGCAAAGTGG - Intergenic
1077003841 11:341120-341142 AAAAGGAAAGAGGAGGAAGGAGG + Intergenic
1077915633 11:6609907-6609929 AAGAGAAAACAGATAGAAGGAGG - Intronic
1078152374 11:8769970-8769992 AACATAAAAAAGAAAGAAAGGGG + Intronic
1078162660 11:8855175-8855197 AAAAGAAAAGGGAAGGGAGGGGG + Intronic
1078377584 11:10808788-10808810 AACGGAAAACAAAAAAAAGGGGG + Intronic
1078392108 11:10944221-10944243 AACAGCAGACAGCAGGAAGTAGG - Intergenic
1078444744 11:11395693-11395715 AAGAAAAGAGAGAAGGAAGGAGG + Intronic
1078587152 11:12601675-12601697 AAGAGAAAAGAGATGGAAAGAGG - Intergenic
1078626355 11:12962379-12962401 AAGAGAAGACAGAAGGCAGGAGG + Intergenic
1078731605 11:13980038-13980060 AAAAAAAAAAAGAAGGAATGAGG - Intronic
1078806618 11:14712062-14712084 AACAGAAAACAGAAGTAGACAGG - Intronic
1078892168 11:15567260-15567282 AGAAGGAAACGGAAGGAAGGAGG - Intergenic
1078908272 11:15707596-15707618 AACAAAGAACAGAAGAAAGAAGG + Intergenic
1078946448 11:16073263-16073285 AACAGAAAACAGAAAAAAGCAGG + Intronic
1079030303 11:16981686-16981708 AAGAGAAAAATGAAGGAATGAGG + Intronic
1079217179 11:18524341-18524363 CACATAAAACATAAGGCAGGTGG + Intronic
1079441204 11:20516446-20516468 AAAAGAAAAAAGAAGGCAGAAGG + Intergenic
1079496946 11:21055577-21055599 AACAGATAACAGAAGAAAGAAGG - Intronic
1079530932 11:21452113-21452135 AAAAGAAAAGAGAAGGAGAGAGG + Intronic
1079654521 11:22972063-22972085 AATGGAAAACAGAAGAAAGCAGG - Intergenic
1079796055 11:24804754-24804776 AAGAGAAAGCAGAAGCAAGAGGG - Intronic
1080186521 11:29493846-29493868 CAAAGAAGACAGAAGGAAGAGGG - Intergenic
1080232922 11:30037868-30037890 AAGAGACAAGAGAAGGAGGGAGG + Intergenic
1080295297 11:30720326-30720348 AAGAGAAAGAAGAAGGAAGAAGG - Intergenic
1080344182 11:31304091-31304113 AAGAGAAAACAAAAAGTAGGAGG + Intronic
1080359538 11:31495814-31495836 AACATAAAAAAGAATGAAGTTGG + Intronic
1080455736 11:32417011-32417033 AATAAAAAAAAGAAGGCAGGTGG - Intronic
1080641157 11:34159172-34159194 AACAGAATACAGAAGGCACTGGG + Intronic
1080950700 11:37029391-37029413 AACAGAGAACAGGAGTCAGGAGG + Intergenic
1080971046 11:37277360-37277382 AAAGGGAAAAAGAAGGAAGGAGG - Intergenic
1081076816 11:38685550-38685572 AACCAACAACAGAAGGAACGAGG - Intergenic
1081170585 11:39865825-39865847 AACAGAAGGCAGAAGATAGGAGG - Intergenic
1081379459 11:42396685-42396707 AACAGAAAACAGAGAAAAAGCGG + Intergenic
1081480438 11:43482147-43482169 AAGAGAAAACAAAAAGATGGTGG - Intronic
1081648527 11:44807226-44807248 AAAAAAAAAAAGAAGGAAAGAGG + Intronic
1081885433 11:46491850-46491872 AACAGGAAATTGAAGTAAGGAGG + Intronic
1082014483 11:47474378-47474400 AGCAGAGAACTGAAGGAAGTAGG - Intronic
1082995121 11:59247940-59247962 TACAAGAAACAGAAGGAAGTGGG + Intergenic
1083069642 11:59963978-59964000 AACAGAAAACCTAGGGAAGTGGG - Intergenic
1083148793 11:60777103-60777125 ATGAAGAAACAGAAGGAAGGAGG - Intergenic
1083337451 11:61932258-61932280 AAAAGAAAAGAAAATGAAGGGGG + Intergenic
1083433309 11:62626204-62626226 ATAACAGAACAGAAGGAAGGAGG + Intronic
1083454525 11:62769812-62769834 AACAGTAAACCTAAGCAAGGAGG + Intergenic
1083557375 11:63641495-63641517 GACAGAACACACAAAGAAGGCGG + Intronic
1084400491 11:68940222-68940244 ACCAGCAGACAGAAGGAAAGTGG - Exonic
1084790420 11:71472264-71472286 AAAAGAAAAGAGTATGAAGGTGG - Intronic
1085080738 11:73632113-73632135 AAGAGCAAACAGAAGGTTGGAGG + Intergenic
1085191539 11:74629515-74629537 AAAATAACACAGAAGGAAAGAGG + Intronic
1085378425 11:76089523-76089545 AATTGAAAATGGAAGGAAGGGGG + Intronic
1085432978 11:76471947-76471969 AACAGAAACCAGAAGGAAGTAGG - Intronic
1085539197 11:77250972-77250994 AACAGAAACCAAAAGCAAGCAGG - Intronic
1085687427 11:78636315-78636337 AACAGAAACCAAAAGCAAGTGGG + Intergenic
1085824947 11:79836038-79836060 AATAGAAAATAGAAGAAATGTGG + Intergenic
1085827379 11:79862218-79862240 AACAGAAAACAGAAGAAAGCAGG + Intergenic
1085857513 11:80192247-80192269 AAATGAAAAGAGAAAGAAGGAGG + Intergenic
1085890313 11:80571884-80571906 AACAGAAAATAGAATGATGGTGG - Intergenic
1085983645 11:81757012-81757034 AAGAAGAAAGAGAAGGAAGGAGG + Intergenic
1086070745 11:82796322-82796344 CACAGTAACGAGAAGGAAGGAGG - Intergenic
1086165425 11:83772435-83772457 AAAAAAAAAGAGAAGGAGGGAGG + Intronic
1086168430 11:83807602-83807624 AACAGAAAAGAAAAGGAGAGAGG + Intronic
1086170586 11:83831924-83831946 AAGGGAAATTAGAAGGAAGGGGG + Intronic
1086221619 11:84452113-84452135 AAAAAAAAAAAGAAGGAAGAAGG + Intronic
1086279984 11:85173791-85173813 AATGGAAAACAGAAAAAAGGGGG + Intronic
1086462986 11:87023895-87023917 AACGGAAAACAGAAAAAAGTAGG + Intergenic
1086651263 11:89294227-89294249 AAAAGAAAACAGAATGAAAAGGG - Intronic
1086669203 11:89526921-89526943 AACAGAAGACAGAAAGATGTGGG + Intergenic
1086776958 11:90848586-90848608 AAGAGAAAAGAAAAGAAAGGAGG + Intergenic
1086852085 11:91821723-91821745 AACAGAAAACACAAGCAATAGGG + Intergenic
1087058625 11:93957218-93957240 AAGAGAAAAGAGAGAGAAGGAGG + Intergenic
1087078446 11:94147584-94147606 AACAGAAACGAGAAGGAGGCTGG - Intronic
1087406992 11:97743088-97743110 AAAAGAAAAAAAAAGAAAGGGGG - Intergenic
1087707139 11:101506019-101506041 AAAAAAAAAAAAAAGGAAGGGGG + Intronic
1087787066 11:102366924-102366946 ATCAAGAAACAGAAAGAAGGTGG - Intronic
1087918153 11:103833741-103833763 AATAGAAAACAGAAAAAAGCAGG + Intergenic
1087992375 11:104760631-104760653 AACAGAAACCAAAAGTAAGTTGG + Intergenic
1088011157 11:105002420-105002442 AAGAAAAAGGAGAAGGAAGGGGG - Intronic
1088235527 11:107718997-107719019 GAGAGAAAATAGAAGGAAGTGGG + Intronic
1088312767 11:108477413-108477435 AACAAAAAACAAAAAAAAGGGGG + Intronic
1088438394 11:109841148-109841170 AAGAGAAGAAGGAAGGAAGGAGG + Intergenic
1088489656 11:110374482-110374504 CAAAGAAAAAAGGAGGAAGGAGG - Intergenic
1088591595 11:111408263-111408285 AACAGGAGACAAAAGGAAGTGGG - Intronic
1088900763 11:114115330-114115352 AAAAAAAAAAAGGAGGAAGGAGG - Intronic
1088951706 11:114578261-114578283 AAAAGAAAACTGAAGTAAGTTGG - Intronic
1089050897 11:115544982-115545004 AAAAGAAAAGAAAAGAAAGGAGG + Intergenic
1089090234 11:115868112-115868134 AACAGAAACCAAAAGCAAGCAGG - Intergenic
1089175571 11:116546677-116546699 ATCAGAAAACAGAAGGGGCGAGG + Intergenic
1089618868 11:119711074-119711096 AACCAAAAACAGAAAGAAAGGGG + Intronic
1089633761 11:119799287-119799309 AACAGAGTACAGAGGGAAAGAGG - Intergenic
1089702258 11:120252539-120252561 CACAGAAAGCAGAAACAAGGTGG - Intronic
1090162278 11:124508383-124508405 AATGGAAAACAGAAGAAAGCAGG - Intergenic
1090332238 11:125941389-125941411 AATGGAAAGCAGATGGAAGGAGG + Intergenic
1090592311 11:128285372-128285394 AAAACAAAACAGAAAGAAGCAGG + Intergenic
1090907378 11:131088755-131088777 AACACAAAAAACAAGAAAGGGGG + Intergenic
1091324293 11:134673178-134673200 AACAGCAAACACAAGTAAGCTGG + Intergenic
1091409806 12:231771-231793 TCCAGAAAACATAAAGAAGGTGG - Intronic
1091530834 12:1353966-1353988 AAAAGAAAACAAAAAGAAGGTGG - Intronic
1092092248 12:5812596-5812618 AGAAGAAAAAGGAAGGAAGGTGG + Intronic
1092678338 12:10947453-10947475 AATGGAAAACAGAAAAAAGGGGG - Intronic
1092683526 12:11015843-11015865 AACAGGGAACAAAAGGAAAGGGG - Intronic
1092857137 12:12684782-12684804 AAGAAAATAGAGAAGGAAGGAGG - Intronic
1092953569 12:13529497-13529519 AAGAGTAAACAGAAGGAAGTGGG - Intergenic
1093294917 12:17377509-17377531 AACAGAAAACTTAAGGAAATTGG + Intergenic
1093318288 12:17678938-17678960 AAAAGAAAAGAGAAGGAGGGAGG + Intergenic
1093585978 12:20836622-20836644 AACAAAAAACAGAAAGAATGAGG - Intronic
1093612031 12:21172625-21172647 AAGAAAAATCAGAAGGAAAGGGG - Intronic
1093638939 12:21502723-21502745 AACAAAAAGCAGTAGGAAAGTGG - Intronic
1093667133 12:21827994-21828016 AACAGAAAAGAGAAGGAAGATGG - Intronic
1093773900 12:23049920-23049942 AACAAAAATGAGAAGGAAGGGGG + Intergenic
1093932761 12:24970629-24970651 AAAAAAAAAAAAAAGGAAGGAGG + Intergenic
1094053593 12:26246261-26246283 AACAGAAGACTGGAGGAAGGGGG + Intronic
1094070216 12:26404545-26404567 ATCAGGAAACAGTAGGAAGAAGG + Intronic
1094169407 12:27476672-27476694 AACAGAAATCAAAAGCAAGCAGG - Intronic
1094267790 12:28578361-28578383 AACAGAAAACAGGAGGCAGAAGG + Intronic
1094404640 12:30103668-30103690 AACAGAAAACAGAAAAATAGAGG - Intergenic
1094536714 12:31327742-31327764 AACAAAAAACAGAAAGAAAAAGG + Intergenic
1094764416 12:33575784-33575806 CAAAGCAAATAGAAGGAAGGAGG - Intergenic
1094821106 12:34225769-34225791 AACAGAAACCAAAAGCAAGCAGG - Intergenic
1095093776 12:38133008-38133030 AACAGAAACCAAAAGCAAGCAGG + Intergenic
1095212860 12:39513544-39513566 AACAGAAAAGAAAAAGAGGGAGG + Intergenic
1095369197 12:41446200-41446222 TACATAAAACAGAAGGGAGGGGG - Intronic
1095399328 12:41796310-41796332 AAATGAAACCAGAAGGCAGGAGG + Intergenic
1095416229 12:41979714-41979736 AACAGAAAGCAGACGGGTGGTGG + Intergenic
1095552956 12:43466076-43466098 CAGAGAAACCTGAAGGAAGGTGG + Intronic
1095582025 12:43811273-43811295 AACAGAAAACAGGAGGAGGTGGG - Intergenic
1095619804 12:44238372-44238394 AAGGGAAAATAGAAGGAAGGAGG + Intronic
1095650121 12:44597806-44597828 AAAAGAAAACTAAAGGAAAGGGG + Intronic
1095780324 12:46051633-46051655 AACAGAAAACAAAAAAAAGCAGG + Intergenic
1095882272 12:47150617-47150639 AACAGAAGCCTGAAGGAAGTGGG + Intronic
1095912052 12:47437738-47437760 CAAAGCAAACAGAAGGAAGGAGG + Intergenic
1096371039 12:51069269-51069291 AAAAGAAAGGAGAAGGAAGCCGG - Intronic
1096395481 12:51262927-51262949 AAGAGAAGGCAGAAGAAAGGGGG - Intronic
1096413458 12:51393017-51393039 AAAAGAAAAAAGGAGGGAGGCGG - Intronic
1096456801 12:51794156-51794178 AACAGAAAACAGAGAGAAGCTGG + Intronic
1096541323 12:52308843-52308865 CAAAAAAAACAGAAGGCAGGCGG - Exonic
1096544570 12:52328768-52328790 ATCTCAAAAGAGAAGGAAGGTGG - Intergenic
1096562901 12:52449725-52449747 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096565052 12:52471388-52471410 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096567064 12:52490825-52490847 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096595069 12:52689949-52689971 TACAGAGAACAGAAGGCAGGAGG + Exonic
1096851420 12:54440486-54440508 GACAGAAAACAGCAGGTAGGTGG + Intergenic
1096949420 12:55450692-55450714 AACAGAAAACAAGAAGCAGGAGG + Intergenic
1097542953 12:60963011-60963033 AAAAAAAGAAAGAAGGAAGGAGG + Intergenic
1097547819 12:61026480-61026502 AGTAAAAAAAAGAAGGAAGGAGG - Intergenic
1097583208 12:61483381-61483403 AATGGAAAACAGAAAAAAGGAGG + Intergenic
1097625429 12:61994370-61994392 AAAAGGCAACAGGAGGAAGGAGG - Intronic
1097672206 12:62554033-62554055 AATACAAGACAGAAGGAAAGAGG - Intronic
1097890808 12:64775448-64775470 AATAGAAAACAGAAAAAAGCAGG + Intergenic
1098013330 12:66077810-66077832 ATCTGAAGACAGAAAGAAGGGGG - Intergenic
1098054309 12:66487801-66487823 AATAGAAAACAGAAAAAAGCAGG + Intronic
1098064829 12:66602717-66602739 AACAAATAACAAAAGGGAGGAGG - Intronic
1098150948 12:67545604-67545626 CACACAACACAGAAGGAGGGAGG + Intergenic
1098460769 12:70730842-70730864 GAGAGAGAGCAGAAGGAAGGAGG + Intronic
1098682877 12:73380256-73380278 AACAAAAAACAGAAGTAAAAAGG + Intergenic
1098840132 12:75467915-75467937 AACAGAAAACAAAACAGAGGAGG + Intergenic
1098895704 12:76057814-76057836 AAGAAAAAACAGAAGAGAGGTGG + Intronic
1099070633 12:78042058-78042080 AAGTGAAAACAGAAAGGAGGAGG - Intronic
1099115368 12:78617722-78617744 AAAAGAAAAAAGAAAGAAGGGGG + Intergenic
1099229979 12:80012305-80012327 AACAGAAACCAAAAGCAAGTAGG - Intergenic
1099590147 12:84576403-84576425 AATAGAAAACAGAAAAAAGCAGG + Intergenic
1099675833 12:85759490-85759512 AAGAGAAAAGAAAAGGAAGAGGG + Intergenic
1099732512 12:86523909-86523931 AAATGAAAACAGAAGAAAGCAGG - Intronic
1099842797 12:87987404-87987426 AACAAGGAACAGAAGGAAGAAGG + Intronic
1099861152 12:88227617-88227639 AACAAAAAACACAAGGTGGGTGG - Intergenic
1099917449 12:88913099-88913121 AACAGAAACCAAAAGCAAGCAGG - Intergenic
1100078412 12:90817476-90817498 AATATAAAACTGAAGCAAGGTGG - Intergenic
1100081411 12:90855694-90855716 ACAACAAAAAAGAAGGAAGGAGG + Intergenic
1100429831 12:94521440-94521462 AACAGGAAAGAGAAAGAAGAAGG - Intergenic
1100482921 12:94996517-94996539 AAGGGAGAACAGAAGAAAGGAGG + Intronic
1100564578 12:95782963-95782985 TACAGCAAACACAAGGAAGTGGG - Intronic
1100594016 12:96056018-96056040 AAAAGAAAAGAAAAGAAAGGAGG + Intergenic
1100643440 12:96504881-96504903 AGCAAAAAGCAGAAGGTAGGGGG - Intronic
1100877221 12:98975095-98975117 AACAGAAGAAAGTAGGAGGGAGG - Intronic
1100877224 12:98975102-98975124 AAGAGGAAACAGAAGAAAGTAGG - Intronic
1101054164 12:100895047-100895069 AACATTGACCAGAAGGAAGGTGG - Intronic
1101098114 12:101364599-101364621 CACAGAAATCAATAGGAAGGTGG - Intronic
1101202306 12:102449565-102449587 AACAGAAAACCGTAGCAATGGGG - Intronic
1101214995 12:102572329-102572351 AACAGAAAATGGAAGGAGAGTGG - Intergenic
1101662880 12:106782010-106782032 AACAAGAAAAAGAAAGAAGGAGG - Intronic
1101665718 12:106811708-106811730 ATCAGACAACAGTAGGAAAGGGG + Intronic
1101729431 12:107414698-107414720 AAAAGAAAAGAAAAGAAAGGGGG - Intronic
1101792471 12:107940323-107940345 AAAAAAAAACAGAAGGAATAAGG - Intergenic
1102099695 12:110269032-110269054 AAAAAAAAAAGGAAGGAAGGAGG - Intergenic
1102578986 12:113874008-113874030 AACAGAGAACAGCAGCAAGGTGG + Intronic
1102595114 12:113986340-113986362 AAAACAAAACAAATGGAAGGGGG + Intergenic
1102631390 12:114283866-114283888 GACTGACAAGAGAAGGAAGGAGG + Intergenic
1102780215 12:115557790-115557812 AACAGAAAAAAAAAGAAAGGAGG + Intergenic
1102799651 12:115720757-115720779 AACAAAAGAAAGAAGGAAGGTGG + Intergenic
1102878972 12:116469730-116469752 TCCAAAAAACAGAGGGAAGGAGG + Intergenic
1102902231 12:116647364-116647386 AAGAGAGAACAGAAGGGAAGAGG - Intergenic
1102974167 12:117194390-117194412 AAAAGAAAAAAGAAAGAAGAAGG - Intergenic
1103319718 12:120084944-120084966 GAAAGAGAACAGAAGGGAGGGGG - Intronic
1103562244 12:121798785-121798807 AGCAGAAATCACAAGGAGGGGGG + Intronic
1103677246 12:122665551-122665573 AAGAGAAAAGAGAAGAAAAGAGG - Intergenic
1104101271 12:125613940-125613962 AACAGCAAAAAGAATGTAGGTGG - Intronic
1104152828 12:126100929-126100951 AAGAAAAAAAGGAAGGAAGGAGG + Intergenic
1104220658 12:126781691-126781713 TACAGCAACAAGAAGGAAGGAGG - Intergenic
1104272805 12:127297389-127297411 AATAGTAAACAGAAAGCAGGGGG + Intergenic
1104772872 12:131375153-131375175 AACAGGAAAGAGAGGGATGGAGG + Intergenic
1104949371 12:132432201-132432223 AAGAGAAAACAGAGACAAGGAGG + Intergenic
1105028070 12:132862884-132862906 AAAAGAAAACAAAAGAAATGAGG - Intronic
1105361373 13:19720376-19720398 AACAGAAAAAAGCAGAAAAGAGG + Intronic
1105783324 13:23723290-23723312 AAAAGAAAACAAAGGGATGGTGG - Intergenic
1106090661 13:26590397-26590419 AAAAGAAACCCGAAAGAAGGTGG + Intronic
1106366728 13:29088787-29088809 AACAGAAAACAAAAAGAACAGGG - Intronic
1106525591 13:30538814-30538836 AAAAGAAAAAAGAAAGAAAGGGG - Intronic
1106658738 13:31776242-31776264 AAAAAAAAAAAGAAGGAAAGAGG - Intronic
1106682736 13:32024997-32025019 AAAAGAGAAGAGAAGGAAAGAGG - Intergenic
1106742274 13:32657385-32657407 AACAGAAAACAGAAGAAAGCAGG - Intronic
1107252924 13:38387629-38387651 AACATAAAAAAGAATGAAGTTGG - Intergenic
1107311385 13:39082212-39082234 AATAGAAAATATAAGAAAGGGGG - Intergenic
1107421005 13:40246385-40246407 AAGAGGAATCAGGAGGAAGGAGG - Intergenic
1107514837 13:41119140-41119162 AAAAAAAAAAAGAATGAAGGTGG - Intergenic
1107779403 13:43881628-43881650 AACAGTCAACAAAAGAAAGGAGG - Intronic
1107918905 13:45183015-45183037 AAAATAATACTGAAGGAAGGGGG - Intronic
1108090220 13:46841696-46841718 AATGGAAAAGAAAAGGAAGGAGG - Intronic
1108130350 13:47292796-47292818 GAAAGGAGACAGAAGGAAGGAGG + Intergenic
1108304086 13:49113342-49113364 AAGAGAATACAAAAGAAAGGGGG - Intronic
1108417557 13:50213978-50214000 AGCAGAAACCACAGGGAAGGAGG + Intronic
1108566536 13:51704615-51704637 AACAGGAGACAGAAGGGAAGGGG - Intronic
1108895527 13:55322630-55322652 AAGAAAAAATAGAAGGAAGGAGG - Intergenic
1109105319 13:58242532-58242554 AACAGAAAACAAAAATAATGTGG + Intergenic
1109119482 13:58436034-58436056 AAAAGCACAAAGAAGGAAGGAGG - Intergenic
1110120040 13:71868394-71868416 AAAAGAAAAGAAAAGGAAAGAGG - Intergenic
1110224275 13:73103732-73103754 AAAACAAAACAGAAAGAAGAAGG - Intergenic
1110358339 13:74595415-74595437 AAAAGAAAAAAGAAGGGAAGGGG - Intergenic
1110411356 13:75206983-75207005 AACATAAACCAAAAGGAAGCTGG + Intergenic
1110601191 13:77376127-77376149 AACGGAAAACTGAATGAAGTTGG + Intergenic
1110639486 13:77805822-77805844 ATCAGAAAATAAAAGGAAAGAGG - Intergenic
1110680619 13:78307975-78307997 AACAGAAAATGGAAGGAAACTGG + Intergenic
1110954968 13:81542756-81542778 AAGACCAAACAGAAGTAAGGGGG - Intergenic
1110977030 13:81851420-81851442 TAAGGAAAACAGAAGGAAGAAGG + Intergenic
1111093891 13:83484209-83484231 AACAAAAGACAAAATGAAGGTGG + Intergenic
1111286895 13:86105818-86105840 CACAGAAAACAGAAAAAAGCAGG - Intergenic
1111363975 13:87216320-87216342 AAGAGAATAAAGAAGGAAAGAGG - Intergenic
1111875009 13:93882057-93882079 AAGAGAAAAGAAAAGAAAGGAGG - Intronic
1111917043 13:94372069-94372091 AAAAGAGAAAGGAAGGAAGGAGG - Intronic
1112288247 13:98122997-98123019 AGCAGAAACAAGAAAGAAGGAGG - Intergenic
1112422492 13:99265320-99265342 AACTGAGAAGGGAAGGAAGGAGG + Intronic
1112542148 13:100325303-100325325 AACTTAAAGCAAAAGGAAGGTGG + Intronic
1112848580 13:103674577-103674599 AACACAAAACAGAAGAGAGTGGG + Intergenic
1113019394 13:105866330-105866352 AAAAAAAAAAAGAAAGAAGGGGG + Intergenic
1113072215 13:106433080-106433102 AACTGCAAACAGATGGGAGGTGG - Intergenic
1113375168 13:109758836-109758858 AAAAAAAAAAAGAAGGAAAGGGG + Intronic
1113491602 13:110696837-110696859 AGCAGAGAACTGCAGGAAGGAGG - Intronic
1113618804 13:111699351-111699373 TACAGAACAGGGAAGGAAGGTGG - Intergenic
1113624333 13:111784612-111784634 TACAGAACAGGGAAGGAAGGTGG - Intergenic
1113830870 13:113294772-113294794 AAAACAAAAAAGAAAGAAGGGGG + Intergenic
1114042446 14:18691491-18691513 AAAAGAAAAGAAAAGAAAGGGGG + Intergenic
1114241289 14:20870805-20870827 AAGAGAGAAAAGAAGAAAGGAGG + Intergenic
1114293024 14:21304324-21304346 AAAAGAGGAAAGAAGGAAGGAGG + Intronic
1114529025 14:23383695-23383717 AAAAGAATGCAGAAAGAAGGGGG + Intronic
1114592191 14:23876429-23876451 AAAAGAAGACAGAAGTAATGGGG - Intergenic
1114811449 14:25905187-25905209 AACAGGAAAAAAAATGAAGGTGG + Intergenic
1114943407 14:27646080-27646102 AACAGAAAAAAGAATCAAGTTGG - Intergenic
1114970880 14:28026981-28027003 AACAGAAGAGAGAAGGAAGGAGG + Intergenic
1115024626 14:28728824-28728846 AAAAAATAATAGAAGGAAGGTGG + Intergenic
1115076361 14:29396674-29396696 AAAATAAAACAGAAGGTAGCTGG - Intergenic
1115131532 14:30057762-30057784 CTGAGAAAACAGAAGAAAGGGGG + Intronic
1115271724 14:31560338-31560360 AGAAGAAGAAAGAAGGAAGGAGG - Intronic
1115301590 14:31891426-31891448 AACAAAAAACAGGAAGAAAGAGG - Intergenic
1115302885 14:31903992-31904014 AACAAGAAAAACAAGGAAGGTGG - Intergenic
1115556505 14:34548593-34548615 AAAACAAAACAGAAGGCAGGAGG + Intergenic
1115790968 14:36877732-36877754 CACAGAAAAAAGAAGAAAAGAGG + Intronic
1116012726 14:39369630-39369652 AACAGTAAAAAGAATAAAGGAGG - Intronic
1116027280 14:39530488-39530510 AATGGAAAACAGAAGAAAGTAGG + Intergenic
1116123737 14:40755110-40755132 AATGGAAAACAGAAAAAAGGAGG - Intergenic
1116385658 14:44326612-44326634 AATTGAAGACACAAGGAAGGGGG + Intergenic
1116402805 14:44529539-44529561 AACACAAACCAGAAGGGTGGTGG - Intergenic
1117123257 14:52592266-52592288 AACAGCAAAAAGAACGAAGCTGG - Intronic
1117148960 14:52865904-52865926 AAAAGAAAACAAAGGGCAGGGGG - Intronic
1117386466 14:55218805-55218827 AACAGAAAAAAAAAGCAATGAGG - Intergenic
1117481375 14:56148666-56148688 CAGAGAACACAGAAGAAAGGAGG - Intronic
1117494196 14:56285533-56285555 AACAGAAAGAAAAGGGAAGGGGG + Intronic
1117744760 14:58858185-58858207 AACAGAAACCAAAAGTAAGCAGG - Intergenic
1117785551 14:59280948-59280970 AACAGGGAACAGAGGGAAAGGGG - Intronic
1117803629 14:59468341-59468363 CACAGAAAAAAGAAGGAAAGTGG - Intronic
1117947987 14:61050928-61050950 AACAGAATACAGAATTAAAGGGG - Intronic
1117959667 14:61150198-61150220 AAAAGAAAAGAAAAAGAAGGAGG - Intergenic
1118284448 14:64458737-64458759 AATAGAAAAGAGAAGGAAACAGG + Intronic
1118321716 14:64757362-64757384 AAGAGGAAACAGAAGAAAGGTGG - Intronic
1118483637 14:66193290-66193312 AACAGAAGCCAGAAGGCAGTGGG - Intergenic
1118528099 14:66668863-66668885 AAAAAAAAACAGCAGGAAAGTGG - Intronic
1118646352 14:67844926-67844948 AACAGAAAATAGAAAAAAGTAGG - Intronic
1118652926 14:67916976-67916998 TACTGAATACAGAAGAAAGGAGG + Intronic
1119111872 14:71982306-71982328 AAAAATAAACAGAAGGAGGGAGG - Intronic
1119328860 14:73779015-73779037 AAAGGAAGACAGGAGGAAGGAGG + Intronic
1119513236 14:75228032-75228054 AAAAGAAAAGAAAAGAAAGGGGG + Intergenic
1119885741 14:78139873-78139895 AGCAGAAAGAAGGAGGAAGGAGG + Intergenic
1120058696 14:79955878-79955900 AATAGAAAACAGAATAAAGCAGG + Intergenic
1120071337 14:80106997-80107019 AACCGACACAAGAAGGAAGGAGG + Intergenic
1120241591 14:81956089-81956111 AACACAAAACAGATTGGAGGTGG + Intergenic
1120288174 14:82532333-82532355 AAGAAAGAAAAGAAGGAAGGAGG - Intergenic
1120554981 14:85918632-85918654 AAGAGAAAGCGGAAGGATGGAGG + Intergenic
1120717036 14:87851255-87851277 AACAAAAAGCAGAGGGAGGGAGG - Intronic
1120754797 14:88232807-88232829 CCCAAAAATCAGAAGGAAGGTGG - Intronic
1121032758 14:90673430-90673452 AAGAGAAAAAAGAAGGAGCGCGG + Intronic
1121079077 14:91093130-91093152 AACAGAAAACAAGAGGTTGGAGG + Intronic
1121093409 14:91199030-91199052 GACACAAAACAGAAGGAAAAGGG - Intronic
1121347097 14:93144235-93144257 AAAACAAAACAAAAAGAAGGGGG + Intergenic
1121578723 14:95010396-95010418 AAAAAGAAACAGAGGGAAGGAGG + Intergenic
1121591996 14:95122278-95122300 TGCAGAAAACAGGAGGAAGGCGG + Intronic
1121911740 14:97798025-97798047 CACAGAAAACTGAAGTAGGGGGG - Intergenic
1122452897 14:101825533-101825555 AACAGAACACAGCATGCAGGCGG + Intronic
1122487881 14:102093970-102093992 AAAAGAAAAAAGAAGGAAGGTGG + Intronic
1122745641 14:103895749-103895771 AAAAGAAAAGAAAAGAAAGGGGG - Intergenic
1122751034 14:103933310-103933332 AACACAAGGCAGAAGGAAGCTGG - Intronic
1122874049 14:104655130-104655152 AAAAGAAAAGAGAAGGGAAGGGG + Intergenic
1122878177 14:104678303-104678325 ATCAGAAAACACAGGGAAGTAGG + Intergenic
1122963110 14:105108056-105108078 AACAAAAAAACAAAGGAAGGCGG + Intergenic
1123166347 14:106328980-106329002 GACAGAAGAGAGAAGGCAGGAGG + Intergenic
1123507432 15:20958258-20958280 AACACACAAAAAAAGGAAGGAGG - Intergenic
1123564658 15:21532000-21532022 AACACACAAAAAAAGGAAGGAGG - Intergenic
1123600912 15:21969290-21969312 AACACACAAAAAAAGGAAGGAGG - Intergenic
1123885888 15:24728086-24728108 TAAAGAAAGCAGCAGGAAGGTGG - Intergenic
1123889097 15:24757535-24757557 AAAAAAAAAAGGAAGGAAGGAGG + Intergenic
1123896061 15:24831250-24831272 AACAGTAACCAGAAGAAAGCAGG - Intronic
1123901920 15:24885952-24885974 AACAGAAACCAGACGGATGCTGG - Intronic
1124085076 15:26542003-26542025 TACAGCAAACAGAAGGTGGGAGG + Intergenic
1124469930 15:29975266-29975288 AAGAGAGAAAGGAAGGAAGGAGG + Intergenic
1124479172 15:30062771-30062793 AAGAAAAGACAGAAGGAAGAAGG + Intergenic
1124972103 15:34497237-34497259 AAAAAAAAAAAAAAGGAAGGGGG - Intergenic
1124992467 15:34689489-34689511 CACAGGAAACAGCAAGAAGGTGG + Intergenic
1125145243 15:36459930-36459952 AAAAGAAAACAAAAGGAGGCTGG + Intergenic
1125245836 15:37638045-37638067 CAGAGCAAACAGAAGGGAGGAGG + Intergenic
1125441143 15:39704969-39704991 AACTGAAAAGAGAAAGAATGTGG + Intronic
1125588738 15:40841162-40841184 ACCAGAAGAGAGAAGGAGGGAGG - Intergenic
1125690165 15:41589656-41589678 AAGAGAATTCAGAAGGAAAGTGG + Intergenic
1125717743 15:41828637-41828659 AATAGAAAAAAGAAGGAAGGAGG - Intronic
1125785949 15:42318203-42318225 AACAGGGAACTGAAGAAAGGAGG - Intronic
1125869874 15:43090068-43090090 TACAGGAAACAGAAAGAGGGAGG + Intronic
1126020643 15:44397566-44397588 AAGAGAAAAAAGAAGTAATGAGG - Intronic
1126039520 15:44576650-44576672 AAAAAAAAAGAGAAAGAAGGGGG + Intronic
1126108298 15:45161427-45161449 AAAAAAAAAAAAAAGGAAGGAGG + Intronic
1126112743 15:45185262-45185284 AACAGAAAACAGGGAGAAAGCGG + Intronic
1126445241 15:48735783-48735805 TAAAGCAAACAGAAGGAAGAGGG + Intronic
1126490112 15:49227447-49227469 AACAGAAACCAAAAGCAAGCAGG - Intronic
1126522373 15:49610612-49610634 TATAGAAAACAGAAAAAAGGTGG - Intronic
1126572303 15:50165037-50165059 AAAAGAAAAAAAAAGGAAAGAGG - Intronic
1126801244 15:52299111-52299133 AAAGGAAAACAGAATGAATGAGG - Intergenic
1126946230 15:53823471-53823493 AAGAGAAAACAGAGGGAGGAAGG + Intergenic
1127181033 15:56418001-56418023 AATAGAAAACAGAAAAAAGCAGG - Intronic
1127517775 15:59713151-59713173 AAAAGCAAACACAAGGCAGGAGG - Intergenic
1127765798 15:62184865-62184887 ACTAGAAAACAGAAAGAAGGAGG - Intergenic
1127769517 15:62219638-62219660 AAAAGAAAAAAAAAGGAAAGTGG + Intergenic
1127927353 15:63559913-63559935 ATGGGAAAACAGCAGGAAGGCGG + Exonic
1127966171 15:63924401-63924423 CCCAAAAATCAGAAGGAAGGAGG + Intronic
1127984998 15:64062348-64062370 AAAAGAAAAAAGAAAGCAGGGGG + Intronic
1128056282 15:64702519-64702541 AACTGAGAACTGAAGGATGGAGG + Intronic
1128104305 15:65031762-65031784 AACAGAAAAGAGAAGCAAAGAGG + Intergenic
1128204132 15:65835688-65835710 AACAGAAAAAAGAAGTGAGGAGG + Intronic
1128396281 15:67229581-67229603 GAAAGAAAAAAGGAGGAAGGAGG + Intronic
1128859498 15:71054282-71054304 GAAAGAAAAGAGAAAGAAGGGGG + Intergenic
1128924679 15:71644131-71644153 AACAGAAAACAGTAGGACTCAGG + Intronic
1128961872 15:72014810-72014832 AAAAGAAAAGAGAAGAAAAGAGG + Intronic
1129288359 15:74543827-74543849 AACAGAAACCACAAAGAAGGAGG - Intronic
1129320097 15:74769953-74769975 AAGTGAAAGCAGAAGCAAGGGGG - Intergenic
1129353676 15:74973060-74973082 AAAGGAAAAGAGATGGAAGGAGG - Intronic
1129498080 15:76006292-76006314 TACAGAAAACAGTATGAAGTGGG + Intronic
1129568839 15:76656220-76656242 AACAGGAAACAGAAAAAAGCAGG + Intronic
1129962905 15:79704564-79704586 ACCAGAAAAAAAAAGGAAGAAGG - Intergenic
1130027719 15:80284264-80284286 AATAGAGAACAGAAGGGATGGGG - Intergenic
1130168579 15:81487715-81487737 AACAGAAAAAAAAAGAAAGACGG - Intergenic
1130234578 15:82122267-82122289 AAAAGATAAAAGAAGGGAGGGGG + Intergenic
1130328313 15:82899448-82899470 AACAGAGAACTGAAGGAAAAAGG + Intronic
1130399297 15:83534187-83534209 GGCAGAAAACAGAAGGGAGGAGG - Intronic
1130521680 15:84666417-84666439 CACACAAAAAAGAAGGAAGCAGG + Intergenic
1130657098 15:85799283-85799305 AGCAGAAACCAGAAGGAAGCGGG - Intergenic
1130711486 15:86286092-86286114 AAAAGAAAAAAGAGAGAAGGGGG - Intronic
1131007043 15:88986883-88986905 AAAACAAAACAGAAACAAGGTGG - Intergenic
1131126169 15:89859248-89859270 AAGAAAAAAAGGAAGGAAGGAGG - Intronic
1131150614 15:90045311-90045333 AACAGCAGAAAGAAGGAAGCTGG + Intronic
1131518786 15:93098021-93098043 AAAACAAAACAAAAGGCAGGGGG - Intergenic
1131520305 15:93109504-93109526 ACCAGATAACACAAGGAATGCGG - Intergenic
1131531259 15:93194395-93194417 AACAGCATAAAGAAGGAAGAAGG - Intergenic
1131531581 15:93197608-93197630 AAAAGGAAAAAGAAGGAAGATGG - Intergenic
1131532653 15:93206871-93206893 AACAGAAAACTGAAGGTGGCGGG - Intergenic
1131539055 15:93260832-93260854 AAAAAAAAACCGAAGGAAGAAGG - Intergenic
1131837154 15:96402267-96402289 AAAAGAACACAGAAAGAGGGAGG + Intergenic
1131913154 15:97231504-97231526 AAGAGAGGAAAGAAGGAAGGAGG + Intergenic
1131939747 15:97547820-97547842 AAAAGAAAACAGAAGAAAACAGG - Intergenic
1132114104 15:99123498-99123520 ACCAGGGAACAGAAGGGAGGGGG - Intronic
1132313807 15:100876690-100876712 AAGATAAAACAGAAGTCAGGTGG - Intergenic
1202973020 15_KI270727v1_random:259110-259132 AACACACAAAAAAAGGAAGGAGG - Intergenic
1132508200 16:323137-323159 AAAAGAAAAGAAAAGGAAAGAGG + Intronic
1132571033 16:644073-644095 AAAAAGAAACAGAGGGAAGGTGG - Intronic
1132817384 16:1837820-1837842 AACAGAAAACAGCATTAAAGTGG - Exonic
1132911261 16:2313562-2313584 AAAAAAAAAAAGAAGAAAGGGGG + Intronic
1133342933 16:5049039-5049061 AATGGAAACCAGAAGGAAGAAGG + Intronic
1133569621 16:7027916-7027938 AAGGGAAAAGAGAAGGAAGGAGG + Intronic
1133580719 16:7142014-7142036 AAAAGAAGAAAGAAGGAAGAAGG - Intronic
1133688300 16:8188087-8188109 AAAAGAAAACGGAAAGGAGGAGG + Intergenic
1133716961 16:8459009-8459031 AAAAAAGAACAGAAGGAAGGCGG - Intergenic
1133813326 16:9177904-9177926 AAGAGGACACAGCAGGAAGGTGG - Intergenic
1133859853 16:9584340-9584362 AGTAGATCACAGAAGGAAGGGGG - Intergenic
1134000478 16:10779063-10779085 AAAAGAAAAAAGAAAGAAGCGGG - Intronic
1134049773 16:11129425-11129447 GACAGAAAACAGAAGCAAAGAGG - Intronic
1134230514 16:12425565-12425587 AATAGAAAACAGAGGCAGGGTGG + Intronic
1134907439 16:17992797-17992819 AGAAGAAACAAGAAGGAAGGAGG + Intergenic
1134908459 16:18002538-18002560 AACAGAAAAAAGAAATAAGAGGG + Intergenic
1135112100 16:19698337-19698359 AACAGGAAAGAGGAGGAAGAAGG - Intronic
1135521511 16:23182167-23182189 AAAAAAAAAAAGAAGGAAAGAGG + Intergenic
1135521514 16:23182190-23182212 AAAAGAAAGAAGAAGGAAGGAGG + Intergenic
1135555671 16:23434416-23434438 AACAGAAAAGAGAATGAAAACGG + Intronic
1135686885 16:24504947-24504969 AACAGAAAACAGTACAAAGCTGG + Intergenic
1135731258 16:24896934-24896956 AAAAAAAAAAAAAAGGAAGGAGG - Intronic
1135888452 16:26335237-26335259 AATTGAATCCAGAAGGAAGGAGG - Intergenic
1135964250 16:27022772-27022794 AAAAAAAAAAAGAGGGAAGGAGG + Intergenic
1136122632 16:28149065-28149087 AAAAAAAAACAAAAGGAAGGTGG + Intronic
1136406906 16:30053384-30053406 AACAGGAAAGGGAAGGAGGGTGG + Intronic
1136519903 16:30788527-30788549 AAAAAAAAAAAGAAGGAGGGAGG + Intergenic
1136938466 16:34498866-34498888 AAGTGAGAAAAGAAGGAAGGAGG - Intergenic
1136948956 16:34691568-34691590 AAAAGAAAAGAAAAGGAAGAGGG + Intergenic
1136961353 16:34849691-34849713 AAGTGAGAAAAGAAGGAAGGAGG + Intergenic
1137254258 16:46761913-46761935 AAAAAAAAAAAAAAGGAAGGAGG + Intronic
1137411665 16:48233476-48233498 AAGAGAAAAGAGAGAGAAGGAGG + Intronic
1137624757 16:49900602-49900624 AACTAAAAAGACAAGGAAGGAGG - Intergenic
1137942061 16:52698079-52698101 AAAAAAAAAAAAAAGGAAGGAGG - Intergenic
1137948904 16:52763125-52763147 AACAGAAAACAGAATGGCAGAGG - Intergenic
1138195827 16:55051491-55051513 AAAAGAAAAATGAAGAAAGGAGG + Intergenic
1138243595 16:55448713-55448735 AAGAAAAAAAGGAAGGAAGGAGG + Intronic
1138291877 16:55854866-55854888 GACTGAGAACAGAAGGAAGAAGG - Intronic
1138533615 16:57648219-57648241 GACAGGAAACAGAAGGAAAGAGG + Intronic
1138645208 16:58419657-58419679 GAAAGAAAAAAAAAGGAAGGGGG + Intergenic
1138733800 16:59227516-59227538 AATAGAAAACAAAAGGCAAGAGG + Intergenic
1138755818 16:59483569-59483591 AACAGAAAACAAAAGCATGCAGG - Intergenic
1139081935 16:63532397-63532419 AACAGAATACACAAAGTAGGTGG - Intergenic
1139084557 16:63568693-63568715 AAGATGAAACAGAAGTAAGGTGG + Intergenic
1139248388 16:65470806-65470828 AAAATAAAACAGAAGGAATTGGG - Intergenic
1139272422 16:65696721-65696743 AAGAGGAAAGAGAAAGAAGGAGG + Intergenic
1139320407 16:66109696-66109718 AACAGAGAAAGAAAGGAAGGGGG + Intergenic
1139461932 16:67129334-67129356 AACAGAATACACAAGTATGGAGG + Intronic
1139490065 16:67281207-67281229 AAAAGAAAAGAAAAGGAATGAGG - Intronic
1139494374 16:67305643-67305665 GACAGAAAAAAAAAGGGAGGGGG - Intronic
1139506982 16:67403595-67403617 AACAAAAAACAAAAGAAATGAGG - Intronic
1139510437 16:67425194-67425216 AACTGAAACCAGATGGAGGGGGG - Intergenic
1139633388 16:68244212-68244234 AAAAGAAAAAAGAAAGAGGGAGG + Intergenic
1139732042 16:68954255-68954277 AAAAAAAAAAAAAAGGAAGGAGG + Intronic
1139838184 16:69856846-69856868 GACACAAAACAAAAGGAAGCTGG - Intronic
1139989550 16:70928879-70928901 GACAGAAAAGAGAAAGAAGAAGG + Intronic
1140120601 16:72080131-72080153 AAAAAAAAAAAAAAGGAAGGTGG - Intronic
1140175776 16:72658247-72658269 ACCAGAAAAGAGAAGGGAGAGGG - Intergenic
1140235908 16:73158449-73158471 AAGAGAAAAGAGAAGGGAGGGGG - Intergenic
1140582243 16:76245203-76245225 AAAGAAAAACAGAAGGAAGTGGG + Intergenic
1140777337 16:78262109-78262131 AAAAAAAAAAAGAAGGAAAGAGG + Intronic
1140828345 16:78728047-78728069 AAAAAAAAAAAAAAGGAAGGAGG - Intronic
1140896468 16:79329062-79329084 AAAAAATCACAGAAGGAAGGGGG - Intergenic
1140906998 16:79417565-79417587 GACAGACAACCGAAGGAGGGAGG + Intergenic
1141014122 16:80431855-80431877 AAGAGAAAAGAGAGGTAAGGTGG - Intergenic
1141059531 16:80853036-80853058 AGCAGAAATCAGAGGGTAGGAGG + Intergenic
1141066316 16:80916747-80916769 AAAAAAAAAAAAAAGGAAGGTGG - Intergenic
1141334987 16:83146207-83146229 AAAAGAAAAGAAAAGGAAGGAGG + Intronic
1141411661 16:83838350-83838372 AAGGGAAAAAGGAAGGAAGGAGG + Intergenic
1141540763 16:84719291-84719313 AGCAGAAAACAGGAGGATGAGGG - Intronic
1141554006 16:84825133-84825155 ACCAGTACACAGTAGGAAGGTGG + Intronic
1142251779 16:88995254-88995276 AACAGAACTCAGAGGCAAGGAGG - Intergenic
1142670794 17:1486503-1486525 AACAGAAAAAAAAAGGAGGGAGG - Intronic
1143091264 17:4450253-4450275 GAGAGAAAAGAGGAGGAAGGAGG - Intronic
1143229119 17:5336702-5336724 AACAGGAAAAAAAAGGAGGGAGG - Intronic
1143359265 17:6354650-6354672 AAAAGAAACAAGAAGGAAGAGGG + Intergenic
1143882426 17:10039909-10039931 AAGAGAAAAGACCAGGAAGGTGG - Intronic
1143966957 17:10762331-10762353 GACAGGAAACTGAAGGCAGGAGG - Intergenic
1144023214 17:11255316-11255338 AAGAGAAAAATGAAGGGAGGAGG + Intronic
1144169656 17:12647767-12647789 AAAAAAAAAAAGAAGGAAGAAGG - Intergenic
1144415872 17:15045805-15045827 AACAAAAAACAAAAAGAAGTTGG - Intergenic
1144473614 17:15565354-15565376 ATAAGAAAACAGAAGGAGGTTGG - Intergenic
1144922907 17:18779457-18779479 ATAAGAAAACAGAAGGAGGTTGG + Intergenic
1145045475 17:19611534-19611556 AACAAAAACCACAAGGAAGAGGG - Intergenic
1145173479 17:20679818-20679840 AAAAGAAAAAAGAAGGGAGAAGG - Intergenic
1145223990 17:21112579-21112601 AAGAAAAAAAAGAAGGCAGGAGG - Intergenic
1146308455 17:31748755-31748777 AAAAAAAAAAAGAAGGGAGGAGG + Intergenic
1146422253 17:32698378-32698400 AAAAAAGAAAAGAAGGAAGGAGG - Intronic
1146587969 17:34099235-34099257 AAGAGAGAAAGGAAGGAAGGAGG + Intronic
1146660252 17:34660781-34660803 AAGAGAAGCCAGAAGGAATGGGG + Intergenic
1146967846 17:37048045-37048067 ACCACAAAGCAGAAGAAAGGAGG - Intronic
1147242381 17:39099022-39099044 AACAGGAGACAGAGGGAAGGAGG + Intronic
1147794658 17:43033850-43033872 GACAGAAGACAGAAAGCAGGAGG + Intergenic
1147880686 17:43651558-43651580 AAAAGAAAAGAAAAGGAAGGGGG + Intronic
1148268213 17:46243468-46243490 AAAAGAAAAGAAAAGGAGGGAGG + Intergenic
1148319007 17:46733342-46733364 AAAAGAAAAAAAAAAGAAGGTGG - Intronic
1148391577 17:47276525-47276547 CAAAGAAAACAAATGGAAGGAGG + Intronic
1148411754 17:47473253-47473275 AAAAAAAAAAAAAAGGAAGGGGG - Intergenic
1148568493 17:48647593-48647615 CACAGGGAACAGAAGAAAGGAGG - Intergenic
1149153904 17:53603309-53603331 AACAGAAAACAAAAAGAAGCAGG - Intergenic
1149414815 17:56448228-56448250 GAAAGAAAATAGAAGGAAGAAGG + Intronic
1149515207 17:57275923-57275945 CACAGAGAACTGAAGGAGGGAGG - Intronic
1149537857 17:57446281-57446303 TTCAGGGAACAGAAGGAAGGAGG + Intronic
1149595843 17:57864179-57864201 AATAGAAAAGAGAATGAAAGGGG + Intronic
1149940706 17:60862295-60862317 AACAAAAAACAGAATGAGGCTGG + Intronic
1150198860 17:63332272-63332294 AAGAAAAAACAGAAGAGAGGTGG - Intronic
1150202302 17:63370164-63370186 AAAAGAAAAAAAAAGAAAGGAGG - Intronic
1150274768 17:63889587-63889609 AACAAAAAAAAGAGGGAAGAAGG + Intergenic
1150402532 17:64870813-64870835 GAAAGAAAATAGAAGGAAGGGGG - Intronic
1150422430 17:65050191-65050213 AACACAAAATAGAGGAAAGGAGG + Intronic
1150502032 17:65660286-65660308 GAGAGAAAAGAGAAGGAGGGAGG - Intronic
1150651245 17:67011793-67011815 AAAAGGAAAGAGAAGGAAAGAGG - Intronic
1150921733 17:69491144-69491166 GTCAAAAAAAAGAAGGAAGGAGG - Intronic
1151186183 17:72365615-72365637 AAAAGAAAACCCAAGGAAGATGG - Intergenic
1151450302 17:74194668-74194690 AGAAGAAAACAGAAGAAAGAAGG + Intergenic
1151484509 17:74389927-74389949 AAGAGAGAAAGGAAGGAAGGAGG - Intergenic
1151652103 17:75476398-75476420 AAGAGGAAAGAGAAGGAGGGAGG - Intronic
1151663954 17:75534962-75534984 AACACAAACCAGAGGGAATGGGG - Intronic
1151725452 17:75881264-75881286 AAAAGAAGAAAGAAAGAAGGAGG + Intronic
1151760322 17:76098022-76098044 CACAGACAACAGAAGGAAGCAGG + Intronic
1152598345 17:81249179-81249201 AAGAGGAGACAGAAGGGAGGAGG + Intronic
1152886411 17:82853395-82853417 AACAGAAAAAAAAAAGGAGGGGG - Intronic
1153196380 18:2602525-2602547 AACAGAAATCAAAATGAAGCAGG - Intronic
1153281013 18:3414441-3414463 GCCAGAAAACTGAAGGGAGGTGG - Intronic
1153294230 18:3530414-3530436 AAAAGAAAACCAAAGAAAGGAGG + Intronic
1153305586 18:3627863-3627885 AAAAAAAAAAGGAAGGAAGGAGG - Intronic
1153373404 18:4346963-4346985 ATCAGAAAACAAAAGGCAGAAGG + Intronic
1153423502 18:4936048-4936070 AACACAAATCAGAAGGAAACTGG + Intergenic
1153435747 18:5066386-5066408 AATAGAAAATGGAAGGAAAGTGG - Intergenic
1153538126 18:6125156-6125178 AACAAAATGCGGAAGGAAGGAGG + Intronic
1153572876 18:6491115-6491137 AAAAAAAAAAAGAAAGAAGGAGG - Intergenic
1153756763 18:8291855-8291877 AAAAAAAAAAAAAAGGAAGGAGG + Intronic
1153995533 18:10438467-10438489 GACTTAAAAAAGAAGGAAGGAGG - Intergenic
1154078454 18:11229421-11229443 TAGAGAAAACAGAGAGAAGGAGG - Intergenic
1154395277 18:13981887-13981909 AAAAGAAAAAAGAAAGAAGGTGG - Intergenic
1155042085 18:22073343-22073365 AACAGAAAACAGGCAGAAGGCGG - Intergenic
1155049772 18:22136513-22136535 ATGAGAAAACAGCTGGAAGGAGG + Intergenic
1155345188 18:24850667-24850689 CACAGGAGACAGAAGGGAGGGGG - Intergenic
1155481852 18:26297510-26297532 AACAGAATAGAGAAGCCAGGGGG - Intronic
1155511088 18:26578030-26578052 AAAAGAAAAGAAAAGCAAGGTGG - Intronic
1155520052 18:26658335-26658357 AATAGCAAAGAGAAGGGAGGAGG - Intergenic
1155630476 18:27887082-27887104 AACAGAAATAAGAAATAAGGGGG + Intergenic
1155773993 18:29736168-29736190 AACAGAAAACAGAAAAAAGCAGG - Intergenic
1155797370 18:30057457-30057479 AAAAGATAAAAGAAAGAAGGAGG - Intergenic
1155868215 18:30992857-30992879 AGCAGAAAGCCGAAAGAAGGGGG + Exonic
1156028654 18:32687418-32687440 AAAAGGAAAGAGAAGGAAAGAGG - Intronic
1156049304 18:32913062-32913084 AACAGAAACTAGAAAGATGGTGG + Intergenic
1156152365 18:34257459-34257481 AACAGAAAAGAGAAGAAAAAAGG - Intergenic
1156392133 18:36660373-36660395 AACAGGAGACAGGAGGCAGGAGG + Intronic
1156433838 18:37104984-37105006 AAGAGAAGTCAGAAAGAAGGGGG - Intronic
1156550477 18:38011143-38011165 CAAAGAAGACAGAAGGAGGGAGG + Intergenic
1156632207 18:38983831-38983853 ATGAGAACACAGAAAGAAGGTGG + Intergenic
1156652513 18:39241031-39241053 CACAAAAAACAGAATGAAGCTGG + Intergenic
1156670030 18:39457531-39457553 AACAAAAAGAGGAAGGAAGGAGG + Intergenic
1156709117 18:39920247-39920269 AACAGGAAAAAAAAGGAAGTCGG + Intergenic
1156781459 18:40855514-40855536 AAAAGAAAAAAGAAAGAAAGAGG - Intergenic
1156931211 18:42646233-42646255 AAAAGAAAAGAGAGGGAAGAAGG + Intergenic
1157014380 18:43693114-43693136 AACAGAAAACAAAAGTGAGCAGG + Intergenic
1157074469 18:44449989-44450011 AACAGAAAGCAGAAGGGAGGTGG - Intergenic
1157106587 18:44779825-44779847 AACAGAAGGCAGCAGGCAGGAGG - Intronic
1157348837 18:46866708-46866730 AACAGCAAAAAGAATGGAGGGGG + Intronic
1157664539 18:49474775-49474797 AACAGAAAACAGAAGACAATGGG - Intergenic
1157698883 18:49746857-49746879 GAGAGAAAACAGAATGAATGTGG - Intergenic
1157718705 18:49907046-49907068 ACCACAGAAAAGAAGGAAGGAGG + Intronic
1157771658 18:50353040-50353062 AGAAGAAGAAAGAAGGAAGGAGG - Intergenic
1158080110 18:53579819-53579841 AACAAAACAAATAAGGAAGGTGG - Intergenic
1158226424 18:55206008-55206030 AAATGAAATCAGAAGGAAGTGGG + Intergenic
1158377087 18:56883220-56883242 AAAAAAAAAAAGCAGGAAGGTGG + Intronic
1158408182 18:57179124-57179146 AACAGAAGGCAGAAAGAAGCAGG + Intergenic
1158552101 18:58445124-58445146 AAAAGAAAAGAAAAGAAAGGAGG + Intergenic
1158696469 18:59708514-59708536 AAAAAAAAAAAGAAGAAAGGCGG - Intergenic
1159000446 18:62969988-62970010 AATAGAAAACAATAGTAAGGTGG - Intronic
1159121643 18:64178041-64178063 AAAATAAAACAGAAGCAAGATGG - Intergenic
1159122945 18:64191409-64191431 AAAAAAAAACAACAGGAAGGTGG - Intergenic
1159181631 18:64913997-64914019 AAAAGAAAACACAAAGAAGGAGG - Intergenic
1159282487 18:66304847-66304869 AACCAATAACAGAAGGAAGTTGG + Intergenic
1159350347 18:67264634-67264656 AACAGAAACTGGGAGGAAGGAGG - Intergenic
1159518308 18:69486954-69486976 AACAGAAAGAAGAAAGAAAGGGG - Intronic
1159583427 18:70260768-70260790 AAGGGAAAACAGATGGAAAGTGG + Intergenic
1159940379 18:74402482-74402504 AATAGAAAAGAGAAGAAAGAAGG + Intergenic
1159953315 18:74501458-74501480 ATCGGAAAACAAAAGGTAGGAGG + Exonic
1160443236 18:78908494-78908516 AACAGCAAACAGAAAGAAAAAGG + Intergenic
1160614304 18:80112431-80112453 AACAAAAAAAAAAAGGAGGGGGG + Intronic
1161503207 19:4629085-4629107 AAAAAAAAAAAGAAGGAAGCAGG - Intergenic
1161586352 19:5107879-5107901 AGAAGCAAACAGCAGGAAGGAGG - Intronic
1161897799 19:7095665-7095687 AAAAAAAAAAAGAAGGAAGGAGG + Intergenic
1161918771 19:7250559-7250581 TAAAGAAAAAGGAAGGAAGGAGG + Intronic
1161923064 19:7280904-7280926 AAAAGAAAAAAGAAAGAAAGAGG + Intronic
1162176821 19:8836481-8836503 AAAAGAAAAAAGAAGAAAGAAGG - Intronic
1162267968 19:9591547-9591569 AAGAGAATTCAGAAGGAAAGTGG - Intergenic
1162334098 19:10049659-10049681 GAAAGAAAGAAGAAGGAAGGAGG + Intergenic
1162397572 19:10426000-10426022 AAAAAAAAAAAAAAGGAAGGAGG + Intronic
1162826580 19:13255985-13256007 AAAAAAAAAAAAAAGGAAGGAGG - Intronic
1162996339 19:14338234-14338256 AATAAAAAAAAGAAAGAAGGAGG + Intergenic
1163135969 19:15311307-15311329 AACAAAAAACAGTAGGCAGGTGG + Intronic
1163258243 19:16170836-16170858 AAAAGAAAAAAGAAAGAAAGAGG + Intronic
1163508472 19:17721693-17721715 AACAAAAAACATCTGGAAGGTGG + Intronic
1163560424 19:18016178-18016200 AAGAGAAAAGAAAAGAAAGGGGG + Intergenic
1163606711 19:18279847-18279869 AACAGAACAAAAAAGGGAGGGGG + Exonic
1163624301 19:18380062-18380084 AACAGAAAACAAAAAGAACCCGG + Intronic
1164614832 19:29660894-29660916 AAAAGAAAACAGAAGCAGGCAGG - Intergenic
1164737226 19:30550626-30550648 GAAAGAAAAGGGAAGGAAGGGGG + Intronic
1164771941 19:30816247-30816269 AAGGGAAGAAAGAAGGAAGGAGG - Intergenic
1164791299 19:30985305-30985327 AACAGTAAACAGAAGACAGATGG - Intergenic
1164861676 19:31566706-31566728 AAAAGAAAAAAGAGGGAAGGAGG + Intergenic
1165085819 19:33346489-33346511 AATAGAAAACAGAGGTAAGCTGG - Intergenic
1165149987 19:33754498-33754520 AACCAAAAACAGAGGGAAAGGGG - Intronic
1165370187 19:35400504-35400526 GAAAGAAAAAAGAAGGAAGGAGG + Intergenic
1165379466 19:35468107-35468129 AGCAGAAAAAAGAAGAAAAGTGG + Intergenic
1165442982 19:35841490-35841512 AACAGAAAAAAGATGGAGAGGGG - Intronic
1165989417 19:39800090-39800112 AACAGCAACCACAAGGAAGCTGG - Intergenic
1166023839 19:40060199-40060221 AACAGAGAACAAAAGGCAGTGGG + Intergenic
1166289098 19:41850433-41850455 AGCAGGAAACTGAAGGAAGCAGG + Intronic
1166533649 19:43557806-43557828 AAAAAAAAAAAAAAGGAAGGAGG + Intronic
1167028616 19:46941083-46941105 AGCATAAAACAGAAAGAAAGGGG - Intronic
1167205319 19:48097569-48097591 AAAAGAAAACAGAGGAGAGGAGG - Intronic
1167395490 19:49225759-49225781 AACAGAAAACAGAAGAAACAGGG - Intergenic
1167429135 19:49444228-49444250 AAGAGAAAGAAAAAGGAAGGAGG - Intergenic
1167429146 19:49444306-49444328 AAGAGAAAGAAAAAGGAAGGAGG - Intergenic
1167608146 19:50492729-50492751 AAGAGGAAAGAGGAGGAAGGGGG + Intergenic
1168068450 19:53934242-53934264 TACAGAAAATACAAGGAAAGAGG - Intronic
1168569424 19:57453133-57453155 AAAAGAAAAGAGCAGGAGGGAGG - Intronic
925442086 2:3897277-3897299 AATGGAAAACAGAAAAAAGGAGG - Intergenic
925707853 2:6705342-6705364 AACAGAAAAGAAAAGTAAGCTGG + Intergenic
925895401 2:8467759-8467781 GACTGAAAACAGAAGCATGGTGG - Intergenic
926306577 2:11641400-11641422 AACAGAAGAGAGAAGGAGGCAGG + Exonic
926475461 2:13315488-13315510 GATAAAATACAGAAGGAAGGGGG - Intergenic
926561955 2:14427270-14427292 CACAGGAAAAAGAAGGAAGCGGG + Intergenic
926611489 2:14952499-14952521 AACAGAAAACAGAAGATCAGAGG + Intergenic
926702837 2:15815308-15815330 CTGAGGAAACAGAAGGAAGGAGG - Intergenic
926875865 2:17478020-17478042 AAAAGAAAAGAAAAGAAAGGAGG + Intergenic
926927783 2:18005126-18005148 AACAAAAACCAGTAGGAAGCTGG - Intronic
927014976 2:18950277-18950299 AACTGAAAACAGAAGAGAAGAGG + Intergenic
927149867 2:20189333-20189355 AAAAAAAAAAAAAAGGAAGGAGG - Intergenic
927175857 2:20406970-20406992 AAAAGAAAAAGGAAGGAAGGAGG - Intergenic
927302421 2:21530808-21530830 GACAGAAAAGAGAGAGAAGGAGG - Intergenic
927528170 2:23767918-23767940 AACAGAATAGAGAGGAAAGGAGG + Intronic
927616421 2:24601601-24601623 AAAAAAAAAAAGGAGGAAGGAGG - Intronic
927692628 2:25219196-25219218 AACAGAAAACTGAAGTGAAGGGG + Intergenic
927760971 2:25753417-25753439 AAAACAAAACAGAAGGAAACTGG + Intronic
927822990 2:26285509-26285531 AACAGATTACGGAAAGAAGGAGG + Exonic
928081303 2:28314966-28314988 AAAAGAGAAAAGAAGGAAGGTGG + Intronic
928278760 2:29925328-29925350 AACAGAAGACAGAAAGGTGGAGG + Intergenic
928301269 2:30127383-30127405 AAGAAAAAAAAAAAGGAAGGAGG + Intergenic
928331067 2:30358386-30358408 AACAGAAAAGATAAGGAAGAGGG - Intergenic
928484904 2:31720019-31720041 AACAGAAAACAGAAAAAGGCAGG + Intergenic
928705322 2:33943620-33943642 AAGAGAGAAAAGAAGGAAGTGGG + Intergenic
928742672 2:34373290-34373312 AAAAGAAAAAGGAAGAAAGGCGG - Intergenic
929086454 2:38172348-38172370 ATCTGAAAGAAGAAGGAAGGAGG - Intergenic
929145164 2:38700550-38700572 AACAGAAACCAAAAGCAAGCAGG - Intronic
929382288 2:41367287-41367309 AATGGAAAACAGAAGAAAGCAGG + Intergenic
929548019 2:42868759-42868781 AAAGGAAAACAGAAAGAAGGAGG - Intergenic
929913706 2:46115846-46115868 AAGAGAAAACAGAAGGCAAAGGG - Intronic
929982731 2:46697111-46697133 AGAAGAAAGCAGAAGGAAGGGGG + Intergenic
930204976 2:48578573-48578595 AAAAAAAAAAAAAAGGAAGGAGG - Intronic
930344029 2:50155430-50155452 AAAAAAAAAAAGAAGAAAGGAGG + Intronic
930412558 2:51044326-51044348 AACTCAAAACAAAATGAAGGTGG - Intergenic
930466258 2:51754233-51754255 AAAAGAATAAGGAAGGAAGGAGG + Intergenic
930657640 2:54022197-54022219 AACAAAAGAAAAAAGGAAGGAGG - Intronic
930939262 2:56995131-56995153 AATAGAAAACAGAAAAAAGTAGG - Intergenic
930997752 2:57741724-57741746 AAAAAAAAAAAAAAGGAAGGAGG + Intergenic
931058010 2:58494434-58494456 AACAGGATAGAGAAGGAAGCGGG + Intergenic
931098327 2:58967383-58967405 AGAAGAAAACACAAGGAAGATGG - Intergenic
931144066 2:59497576-59497598 AACAGAAAACAAAAAGGAGCTGG - Intergenic
931246778 2:60498678-60498700 ATCAGTAAAGAGAAGGAAGCAGG + Intronic
931362641 2:61591233-61591255 AAAAAAAAAAAAAAGGAAGGGGG + Intergenic
931501843 2:62877174-62877196 AACAGAAAACAAAAAAGAGGAGG + Intronic
931510593 2:62988175-62988197 AACATAAAATTGATGGAAGGTGG - Intronic
931529971 2:63202842-63202864 CACAGACAAGGGAAGGAAGGAGG - Intronic
931543633 2:63356095-63356117 AATAGAAAACAGAAAGAAGCAGG + Intronic
931557556 2:63521375-63521397 AATGGAAAACAGAAGAAAGCAGG + Intronic
931564771 2:63604125-63604147 ATCAGGAAACTGAAGGAAAGAGG - Intronic
931601317 2:64005905-64005927 TACAGTAAATAGAAGGAAGTAGG + Intronic
931663305 2:64590189-64590211 ATAAGAAAACAGAAGGAATGAGG - Intronic
931738770 2:65222945-65222967 AAAAGAAAAAAAAAGGAAAGAGG - Intergenic
931853108 2:66273786-66273808 AACAGAGAACAGCAGGGAAGGGG + Intergenic
931970843 2:67584088-67584110 AACAGAAAACAAAAACAAGTAGG + Intergenic
932208153 2:69902248-69902270 AGGAGAAGAAAGAAGGAAGGAGG - Intronic
932285359 2:70526844-70526866 TACAGAAAGAAGAATGAAGGTGG + Intronic
933077583 2:77949164-77949186 AAGATAAAATAGAAGGGAGGAGG + Intergenic
933176972 2:79185410-79185432 AACAGAAAAAAAAAGGAATTTGG + Intronic
933360907 2:81282628-81282650 AAGAGAGAAAGGAAGGAAGGAGG - Intergenic
933389626 2:81653448-81653470 AAGAGAATTCAGAAGGAAAGTGG - Intergenic
933428802 2:82148244-82148266 AACAGAATTCAGAATGAGGGTGG - Intergenic
933451739 2:82461899-82461921 AACAAAAAACTGAAAGAATGAGG - Intergenic
933634984 2:84699023-84699045 AAAAGAGCACAGAGGGAAGGAGG + Intronic
933671266 2:85009662-85009684 AACAGAAAAAAGAAAGAAGAGGG - Intronic
933700118 2:85249002-85249024 AAAAAAAAACAGGAGGAAGTAGG + Intronic
933771700 2:85748790-85748812 AACAAAAAACAGGAGGAGGCTGG - Intergenic
933884659 2:86706893-86706915 AAATGAAAACAGAAAAAAGGGGG + Intronic
934111156 2:88744814-88744836 AACAGAAACCAAAAGCAAGCAGG - Intronic
934743456 2:96742573-96742595 AACAAAAAAAAGAAGAAATGGGG + Intergenic
934865343 2:97804630-97804652 AAAAAAAAAAAAAAGGAAGGAGG + Intronic
934904199 2:98184802-98184824 ACCAGAAAACAGGAGCAAGGAGG - Intronic
935025105 2:99269293-99269315 ACCAGAAAACTGAATGAATGTGG + Intronic
935133903 2:100281801-100281823 AACAGAAAAGAGGCAGAAGGGGG + Exonic
935140688 2:100350421-100350443 TACAGAAGACAGAAGCCAGGTGG - Intergenic
935167340 2:100580872-100580894 GTCAGAAAGTAGAAGGAAGGGGG - Intergenic
935256870 2:101317663-101317685 AACAGAAAACAAAAAAAAGCAGG + Intergenic
935269887 2:101425035-101425057 AACAGAAAAAAAAAAGAAGATGG + Intronic
935379359 2:102435306-102435328 AAGTGGAAACAGAAAGAAGGTGG + Intronic
935449526 2:103192635-103192657 AATATAAAACAGAATGAAGAAGG + Intergenic
935491769 2:103729852-103729874 AAAAGAAAACAAAAGAAAGAAGG + Intergenic
935598779 2:104900981-104901003 CACAGAAAACAGAGGTAAAGTGG - Intergenic
935900960 2:107792774-107792796 AACAGAAAATAGAATGGAGGTGG + Intergenic
935903566 2:107818365-107818387 AGAAGAAAGGAGAAGGAAGGAGG - Intergenic
936040650 2:109146795-109146817 AGAGGAAAACAGAAGGAATGGGG - Intronic
936127235 2:109799242-109799264 AAAAAAAAAAAAAAGGAAGGGGG + Intronic
936217462 2:110572243-110572265 AAAAAAAAAAAAAAGGAAGGGGG - Intronic
936426603 2:112426819-112426841 AAAAAAAAAAAAAAGGAAGGGGG - Intronic
936483186 2:112904913-112904935 AACAAGAAACAGTAGGAAAGTGG - Intergenic
936527977 2:113255083-113255105 GAAGGAAAAAAGAAGGAAGGAGG + Intronic
936763805 2:115819512-115819534 AACAAAAAAAAGAGGGATGGAGG - Intronic
936830118 2:116633789-116633811 AAAAGCATACAAAAGGAAGGTGG - Intergenic
937059206 2:118969133-118969155 AACACAAGCCAGGAGGAAGGAGG - Intronic
937112904 2:119380396-119380418 AAGAGAAAATAGAAGGAGGAAGG + Intergenic
937302230 2:120850101-120850123 AACAGAAAACAGACGGGAGAAGG + Intronic
937425917 2:121798226-121798248 GAAGGAAAAGAGAAGGAAGGGGG + Intergenic
938045278 2:128113581-128113603 AAGAGAAAACAGAAGAAAAAAGG - Intronic
938290673 2:130148249-130148271 AAAAGAAAAATGAAGGCAGGAGG + Intergenic
938380433 2:130833457-130833479 AAAAGAAAAGAAAAGGAGGGAGG + Intergenic
938465871 2:131524704-131524726 AAAAGAAAAATGAAGGCAGGAGG - Intergenic
938563328 2:132494397-132494419 ATGAGAAAACAGAAGGAACAAGG - Intronic
938581705 2:132652323-132652345 AAAAGACGACAGAAGGAAAGGGG + Intronic
938888415 2:135677960-135677982 AAAAACAAAGAGAAGGAAGGAGG - Intronic
939046457 2:137256022-137256044 AAAAAAAAACAGGAAGAAGGGGG - Intronic
939240495 2:139552588-139552610 AACGGAAAGCAGAAGGAACTGGG + Intergenic
939241115 2:139560766-139560788 AACAGGGAACAGCAGGAATGCGG + Intergenic
939379346 2:141414250-141414272 AAAAGAAAAAGGAAGGAAGGAGG + Intronic
939833187 2:147097091-147097113 AAAAGAAAAAAAAAGGAAGGGGG - Intergenic
939970585 2:148654727-148654749 GCCAGAAAACAGAAGGAAGGAGG - Intronic
940524966 2:154801477-154801499 AAAAGAAAAGAAAAGAAAGGAGG - Intronic
940602483 2:155879608-155879630 AACAGAAAACAAAAGTGAGGAGG + Intergenic
940708126 2:157128965-157128987 AATGGAAAACACAAAGAAGGAGG + Intergenic
940965525 2:159833121-159833143 AAAAAAAAAAAAAAGGAAGGGGG - Intronic
941098105 2:161264348-161264370 AGAAGAAAACAGAAGGTAGCTGG - Intergenic
941127945 2:161609442-161609464 AAAAAAAAAAACAAGGAAGGGGG - Intronic
941223048 2:162808831-162808853 AATAGAAAACAAAAGGGAGAAGG + Intronic
941342559 2:164326418-164326440 AACAGAAAACAAAAGCAAACAGG - Intergenic
941438382 2:165500989-165501011 AACAGCAAACAGCAGAAAGTTGG - Intronic
941452760 2:165679207-165679229 AACAAAGAACTGAAGGAAGAGGG - Exonic
941510015 2:166395805-166395827 AAAAGAAAAATGAAGGAAAGAGG - Intergenic
941770378 2:169338419-169338441 AAAAGAAAAAAGGAGGAAGACGG + Intronic
941868353 2:170357542-170357564 AACAGAAAAATGAAGCAAAGGGG - Intronic
942032585 2:171977761-171977783 AAAGGAATACAGAAGGAAGAAGG - Intronic
942175440 2:173329145-173329167 AAAAAAAAAAGGAAGGAAGGAGG - Intergenic
942184848 2:173415267-173415289 AAGAAAAAAAGGAAGGAAGGAGG - Intergenic
942533511 2:176938192-176938214 AGCAGAAGTCAGAAGGAAGTGGG + Intergenic
942541625 2:177021042-177021064 ACCAGCAAACGGAGGGAAGGGGG - Intergenic
942677168 2:178439577-178439599 AAGAGAAAACAGTACGAAGTTGG - Intronic
942739065 2:179152888-179152910 CAAAGAAAATAGAAGAAAGGAGG + Intronic
942935262 2:181548300-181548322 AAAAGAGAACGGAAGGAGGGAGG + Intronic
943073588 2:183170318-183170340 AACAGTAAACAGAAAAAAGCAGG - Intergenic
943204905 2:184882109-184882131 AAGAGAAAACAGAAAAAAGCAGG + Intronic
943551624 2:189347357-189347379 AACAGAAAGCAGAAAGAGGGAGG + Intergenic
943976915 2:194493655-194493677 CAGAGAAAAGAGAAGGAAGCTGG + Intergenic
944349406 2:198709188-198709210 GAGAGAAAAAAGAAGGGAGGAGG - Intergenic
944520382 2:200560079-200560101 AACAGACAACAGAAGCAGGAAGG - Intronic
944788212 2:203095746-203095768 AACAAAAAACAAATGAAAGGTGG - Intronic
944805607 2:203277914-203277936 GACAGAATTTAGAAGGAAGGTGG + Intronic
945411357 2:209512474-209512496 AACAGAAAATAAAATGAATGAGG + Intronic
945492158 2:210468879-210468901 AAAAGAAAACAGAAGTATAGTGG - Intronic
945503638 2:210610300-210610322 AACAAAAAATAAAAGGTAGGGGG + Intronic
945535040 2:211005963-211005985 AGCAGAAGACACAAAGAAGGAGG + Intergenic
945744075 2:213699214-213699236 AACAGAAAAAATAAAGAATGTGG - Intronic
946649030 2:221871050-221871072 AATAGAAAACAGAAAAAAGCAGG + Intergenic
946730777 2:222707382-222707404 AAAAGAAAAGAGAAAGAGGGAGG + Intronic
946828733 2:223705926-223705948 AACAGAGCAGAGGAGGAAGGAGG - Intergenic
946921563 2:224585613-224585635 AACAGGGAACTGAAGGAAGTGGG + Intergenic
947389486 2:229624268-229624290 AAGAGAAAAAAGCAGGAAGATGG + Intronic
947618724 2:231575182-231575204 AACACACAACACAGGGAAGGTGG - Intergenic
947635162 2:231676709-231676731 GACAGAAGACAGAAGGCAGGCGG - Intergenic
947671129 2:231936098-231936120 AACAAAAGAAGGAAGGAAGGAGG - Intergenic
947871001 2:233437971-233437993 AAGAGAAGACAGCAGAAAGGTGG + Intronic
947965387 2:234276383-234276405 AACAAAAAACAGAGGAAAAGTGG - Intergenic
948157311 2:235793647-235793669 AGCAGCAAAAAGGAGGAAGGGGG + Intronic
948250221 2:236521865-236521887 AAAAGAGAAAGGAAGGAAGGTGG + Intergenic
948542093 2:238698399-238698421 AACAGAAAACAAAAAGCAAGAGG - Intergenic
949030173 2:241791978-241792000 AAAAGAAAACAGAAAAATGGGGG - Intronic
1168862450 20:1055505-1055527 AACAGAAATAAATAGGAAGGGGG + Intergenic
1169165158 20:3416280-3416302 ATAAGAAAACAGAAGCCAGGCGG - Intergenic
1169896968 20:10514368-10514390 AACAGAACAGAGAAAGAAGTTGG - Intronic
1170132680 20:13038622-13038644 AATAGATAACAGAAATAAGGTGG - Intronic
1170209972 20:13838564-13838586 GAAAGAAAAGAAAAGGAAGGTGG - Intergenic
1170271919 20:14537064-14537086 AACAGAAAACAGAAGGAAGGGGG - Intronic
1170370664 20:15644467-15644489 GTAAGAAAACAGAAGGAAAGAGG - Intronic
1170378460 20:15729712-15729734 AATGGAAAACAGAAAAAAGGAGG - Intronic
1170399248 20:15961892-15961914 GAAAGAAATCAGAAGGATGGAGG + Intronic
1170476676 20:16721837-16721859 AACACAAAACATAAGGAAAAGGG - Intergenic
1170757321 20:19215573-19215595 AAGGGCCAACAGAAGGAAGGAGG - Intronic
1170963661 20:21047692-21047714 AACATAAATCCCAAGGAAGGAGG + Intergenic
1171053208 20:21881096-21881118 AATAGAAAACAGAAAAAAGCAGG - Intergenic
1171060566 20:21954860-21954882 AACAGAAATGAAAAGCAAGGAGG - Intergenic
1171081706 20:22193163-22193185 AATGGAAAACAGAAGAAAGCAGG + Intergenic
1171239953 20:23558494-23558516 AACAGAAATCAGAAGAAAGGAGG - Intergenic
1171293465 20:23995751-23995773 CAAAGAAAACAGAAGCATGGAGG - Intergenic
1171370857 20:24661284-24661306 AGCAGAAGAAAGAAGGAGGGAGG + Intronic
1171905053 20:30893704-30893726 AGGAGAGAACAGAGGGAAGGAGG - Intergenic
1172142039 20:32729617-32729639 AAAAAAAAAAAAAAGGAAGGAGG + Intronic
1172171674 20:32939073-32939095 AAAAGAAAAAAGAAAGAAGTTGG - Intronic
1172351499 20:34246245-34246267 AAGAAAAAACAGAAGAGAGGTGG - Intronic
1172664392 20:36589159-36589181 AACAGAAACAAGAATAAAGGGGG - Intronic
1172879244 20:38187953-38187975 AACAGAAAACAGAACCAATAGGG - Intergenic
1173186008 20:40840801-40840823 AAGGAAAAACAGAAGGAAGGAGG + Intergenic
1173393032 20:42652078-42652100 AACAAAAAAAAAAAGGAAGATGG + Intronic
1173464555 20:43270709-43270731 AAGAGAAAAAGGAAGGAAGAAGG + Intergenic
1173474995 20:43352771-43352793 AAAAGAAAGCAAAAGGAAAGAGG - Intergenic
1173507319 20:43598257-43598279 GACAGAAAATAGAAGGGTGGTGG + Intronic
1173706889 20:45116401-45116423 AAAAGAAAAAAGAAAGAAAGAGG - Intergenic
1173718669 20:45234241-45234263 AACAGAAACCAAAAGCAAGAAGG - Intergenic
1174016179 20:47490161-47490183 AAAATAAAATAAAAGGAAGGAGG + Intergenic
1174084945 20:48000593-48000615 AAAAGAAAATAGAAAGAGGGAGG - Intergenic
1174108642 20:48181951-48181973 AAAAAAAAACAGAAGGAAATTGG + Intergenic
1174207041 20:48847805-48847827 TATAGAAATCAGAAGGATGGGGG - Intergenic
1174293152 20:49523497-49523519 AACAAAAAACAAAAAGAAGCTGG + Intronic
1174308333 20:49631196-49631218 AAAACCAAACAGAAGGAACGAGG - Intergenic
1174402930 20:50285570-50285592 AACAGAAAACAAAAACAAGCTGG - Intergenic
1174434545 20:50496710-50496732 AAAAGGAAAAAGAAGGAAGGAGG - Intergenic
1174507776 20:51027814-51027836 AAAAGAAAAAAAAAGTAAGGAGG - Intergenic
1174638543 20:52023020-52023042 CAAAGAAAGCAGAAGGAAGAAGG - Intergenic
1174755119 20:53150676-53150698 AAAGGAAAAAGGAAGGAAGGAGG + Intronic
1175116395 20:56685633-56685655 AAAAGAAAAAAGAAGGAAAAAGG + Intergenic
1175438523 20:58973124-58973146 AATAGAAAACAAAAGCCAGGGGG + Intergenic
1176871853 21:14089662-14089684 AACAGAAACCAAAAGCAAGCAGG - Intergenic
1176891406 21:14324151-14324173 AAAAGAAAAGAGTAGAAAGGAGG + Intergenic
1177017141 21:15805998-15806020 AACAAAAAGCACAAGGAAGATGG - Intronic
1177034478 21:16025064-16025086 AACAAAAAACAAGAGAAAGGAGG - Intergenic
1177040698 21:16106764-16106786 AACAGAAAAGAAAGGGAAGATGG + Intergenic
1177041798 21:16121758-16121780 AAAAGAAAAGAAAAGAAAGGGGG - Intergenic
1177222418 21:18211187-18211209 AACAAAATACAGCAGGAATGCGG - Intronic
1177401877 21:20614942-20614964 AGCAGGAAAAAGAATGAAGGAGG - Intergenic
1177509331 21:22063511-22063533 AACAGAAAACCCAATGAAAGTGG + Intergenic
1177933378 21:27313916-27313938 AACAGAAAACAAAAGTGAGCAGG - Intergenic
1178327339 21:31656645-31656667 AAGAGAAAGAAGAAGGAAGGAGG - Intergenic
1178387629 21:32166489-32166511 CTCAAAAAACAGAAGGATGGAGG + Intergenic
1178471001 21:32892805-32892827 AAAGGAAGAAAGAAGGAAGGAGG - Intergenic
1178478708 21:32960062-32960084 ATCAGAAAATAGAGGGAAGGTGG - Intergenic
1178598346 21:33974757-33974779 AAGGGAAAAAAGAAGGAAAGAGG - Intergenic
1178763838 21:35430475-35430497 AAAAGAAAAAGGAAGGAAGGAGG - Intronic
1178913678 21:36695388-36695410 AACAGCAAACAGAACGAATTAGG + Intergenic
1178935500 21:36858439-36858461 TACAGAAAACAGAAGATTGGGGG + Intronic
1178940703 21:36902648-36902670 AAGAGAGAAAAGAAGGAAGGAGG + Intronic
1179083488 21:38195481-38195503 GACAGGACACAGATGGAAGGTGG - Intronic
1179268341 21:39825900-39825922 AACAGAAGCCAGAATGAAGCTGG - Intergenic
1179663817 21:42895668-42895690 AAAAGAAAAAAGAAGAAACGTGG + Intronic
1179676881 21:42989071-42989093 AACAGAAAAAGGAAGGGATGAGG - Intronic
1179814524 21:43896799-43896821 AACAGTAAACAAAAGGCAGCTGG - Intronic
1180824521 22:18853467-18853489 CAAAGAAAACAGAAGCATGGAGG - Intronic
1180836620 22:18932918-18932940 ATCAGAAAACAACAGGAGGGAGG + Intronic
1181016043 22:20069486-20069508 AAAAAAAAAAGGAAGGAAGGAGG + Intergenic
1181124943 22:20696622-20696644 CAAAGAAAACAGAAGCATGGAGG - Intergenic
1181188214 22:21121081-21121103 CAAAGAAAACAGAAGCATGGAGG + Intergenic
1181210982 22:21289412-21289434 CAAAGAAAACAGAAGCATGGAGG - Intergenic
1181398518 22:22637476-22637498 CAAAGAAAACAGAAGCATGGAGG + Intergenic
1181452886 22:23035755-23035777 AACAGAAAGCAGCAGGAGAGAGG + Intergenic
1181506459 22:23361582-23361604 GACTGAGAACAGAAGGAAGAAGG - Intergenic
1181650897 22:24258584-24258606 CAAAGAAAACAGAAGCATGGAGG - Intergenic
1181706484 22:24652155-24652177 CAAAGAAAACAGAAGCATGGAGG + Intergenic
1181785932 22:25227177-25227199 AGCAGAAAATAGAAGGAAGAAGG - Intronic
1181818123 22:25455036-25455058 AGCAGAAAATAGAAGAAAGAAGG - Intergenic
1182004466 22:26948259-26948281 TACACAAACAAGAAGGAAGGAGG + Intergenic
1182043237 22:27254647-27254669 ATAAGAAAACATAAGGGAGGAGG + Intergenic
1182262141 22:29081142-29081164 AACAGTAAAAAGAAGGACGGGGG - Intronic
1182879830 22:33723877-33723899 AACAGGAAAGAGAATGAAGGAGG + Intronic
1182915869 22:34029938-34029960 CACAGAAAAAAGAAGGTAGATGG - Intergenic
1183004037 22:34885423-34885445 AAAAAAAAACACAAGGAAGAGGG - Intergenic
1183032327 22:35115470-35115492 AAGAAAAAAGAAAAGGAAGGTGG + Intergenic
1183134687 22:35875248-35875270 AACAGAAAAGTAAAGGAAAGAGG + Intronic
1183156306 22:36078101-36078123 AAAAGAAAAAAGAAGTTAGGAGG + Intergenic
1183295971 22:37029765-37029787 AAAATAAAACAGAAAGGAGGCGG - Exonic
1183405324 22:37627720-37627742 AGAGGAAAACAGAAGGAAGCTGG - Intronic
1183419726 22:37704440-37704462 TACAGAAAACAGGGAGAAGGAGG + Intronic
1183692148 22:39396499-39396521 CCCAGATAAGAGAAGGAAGGAGG - Intergenic
1183791154 22:40071115-40071137 AGCAGAAAAAAAAAGGAAAGTGG - Intronic
1183834786 22:40443471-40443493 AGCAGAAAAAAAAAGGGAGGGGG - Intronic
1184191526 22:42898264-42898286 AAAAAAAAAGAAAAGGAAGGAGG - Intronic
1184313493 22:43664500-43664522 AACAGGAAACAAGATGAAGGAGG + Intronic
1184451848 22:44587143-44587165 AAGAGAAGGGAGAAGGAAGGGGG + Intergenic
1184958200 22:47906944-47906966 AATAGAAAATAGAAGAATGGGGG + Intergenic
1184999376 22:48235014-48235036 AAAAGAAAAGAAAAGAAAGGAGG - Intergenic
1185417256 22:50717010-50717032 ATGAGAAAACTGAAGCAAGGAGG + Intergenic
1203215964 22_KI270731v1_random:6018-6040 CAAAGAAAACAGAAGCATGGAGG + Intergenic
1203274659 22_KI270734v1_random:79372-79394 CAAAGAAAACAGAAGCATGGAGG - Intergenic
1203286712 22_KI270734v1_random:158217-158239 ATCAGAAAACAACAGGAGGGAGG + Intergenic
949369741 3:3321874-3321896 AACAGAAAATTTTAGGAAGGAGG - Intergenic
949525845 3:4902440-4902462 AGCAGAAAACAGCGAGAAGGAGG + Intergenic
949540909 3:5031378-5031400 ATCAAAAAAAGGAAGGAAGGAGG + Intergenic
949542934 3:5048282-5048304 GGCAGAAAACAGAAGGAACCTGG - Intergenic
949794904 3:7838718-7838740 AAAACAAAACAGAAGGAAAAAGG + Intergenic
950012985 3:9736454-9736476 AACAGAAAAGAGAAAGACTGTGG - Intronic
950233287 3:11295301-11295323 AAAAGCAAACAGAAGGAATGAGG - Intronic
950299661 3:11865804-11865826 AATGGAAAACAAAAAGAAGGAGG - Intergenic
950398895 3:12755098-12755120 AAAAGAAAAAAGAAAAAAGGAGG - Intronic
950403878 3:12792452-12792474 AAAAGAAAAAAGAATGAGGGTGG - Intergenic
950715806 3:14846983-14847005 ATCACAAAACAGAGGGATGGAGG - Intronic
950846305 3:16019131-16019153 AAGAGAATTCAGAAGGAAAGTGG - Intergenic
951117992 3:18887736-18887758 AACAGAGAACAGGAGGGAGTGGG + Intergenic
951273613 3:20658081-20658103 ATCAGAAAGTAGAAGGAAGCAGG - Intergenic
951283613 3:20782032-20782054 AACGGAAAACAGAAATAAGCAGG + Intergenic
951367920 3:21807045-21807067 ACCAGAAGAGAGAAAGAAGGAGG + Intronic
951464132 3:22983748-22983770 AAAAGAAACCAGAAGGTTGGAGG + Intergenic
951486340 3:23215701-23215723 AACAGCAAAGAGAAGGGTGGTGG - Intronic
951499076 3:23363466-23363488 AATGGAAAACAGAAAAAAGGAGG + Intronic
951823533 3:26841821-26841843 AGGAGAAATCAGAAGGAATGAGG - Intergenic
951947765 3:28160841-28160863 AACACAAACCAGAAGCAAGTAGG + Intergenic
952077613 3:29716451-29716473 ATTAGAAAAAAGAAGAAAGGAGG + Intronic
952185493 3:30963501-30963523 AACAAAAGAAAGAAGGAAGGAGG - Intergenic
952238854 3:31509184-31509206 AAGAAATAAAAGAAGGAAGGAGG + Intergenic
952370173 3:32714841-32714863 GACAGAAAACGGAAGTAAGAAGG - Intronic
952442029 3:33340589-33340611 AAAAAAAAAAAGAAGGAAGTAGG + Intronic
952477207 3:33722636-33722658 AAAAGAAAAAAGAAAGGAGGTGG + Intergenic
952536692 3:34318500-34318522 AAAAGCAAACAGAAATAAGGAGG - Intergenic
952649557 3:35708943-35708965 AACAGAAAAAAGAAATCAGGAGG - Intronic
952729952 3:36628177-36628199 AAAAGAAAAGAAAAGGAAGAAGG + Intergenic
952839523 3:37632508-37632530 ATAAGAAAAGAGAAAGAAGGGGG + Intronic
952841740 3:37652318-37652340 AGAAGAAAACAGGAGGAAGTGGG - Intronic
953225589 3:41016565-41016587 AACAGAGAAATGAGGGAAGGAGG + Intergenic
953237628 3:41120211-41120233 AAACAGAAACAGAAGGAAGGAGG - Intergenic
953439314 3:42904392-42904414 AAAAGAGAAGAGAAGGAAAGAGG - Intronic
953583847 3:44181701-44181723 CACAGGAAAGAGAAGGCAGGGGG + Intergenic
953713080 3:45291577-45291599 ACCAAAGGACAGAAGGAAGGAGG + Intergenic
953806203 3:46070589-46070611 AACAGAAACCAAAAGGAAGCAGG - Intergenic
953950357 3:47184795-47184817 AAAAGAAAAGAAAAGAAAGGGGG - Intergenic
954437108 3:50502275-50502297 GACAGATAACAGAAGCAAGGTGG + Intronic
954970484 3:54647614-54647636 AAGGGAAAGCAGAAGGAAGTTGG + Intronic
955697258 3:61649172-61649194 AATAGAAAAAGGAAGGAAGGAGG - Intronic
955806638 3:62742838-62742860 AACAGAAAACCGACAGAATGGGG + Intronic
955848123 3:63190260-63190282 AACAGAAACCAAAAGCAAGCAGG - Intergenic
956111636 3:65875955-65875977 GACAGAAAACAGTAAGAGGGAGG + Intronic
956164815 3:66388672-66388694 CACAGAGAACAGAAGGCAGTAGG + Intronic
956631630 3:71322566-71322588 GACAGAAAACAGGAGCCAGGTGG + Intronic
956839960 3:73129789-73129811 AAAAAAAAAAAGAAGGAAGAAGG - Intergenic
957220168 3:77372137-77372159 AAAGGGAAAGAGAAGGAAGGAGG + Intronic
957293892 3:78311414-78311436 AGCAGAAGAGAGAATGAAGGTGG + Intergenic
957467853 3:80618730-80618752 AAAAGAAAAACAAAGGAAGGAGG - Intergenic
957471666 3:80667030-80667052 CACAGAAATGAGAAGGAATGAGG + Intergenic
958117167 3:89234980-89235002 AAGAGAAAAAAGAAAGGAGGAGG - Intronic
958536862 3:95414986-95415008 GAAAGAAAACAGAAGGAAGGAGG + Intergenic
958871300 3:99562228-99562250 AGGAGAGAACAGAAGAAAGGAGG - Intergenic
958990883 3:100843436-100843458 GACAGAAGAGAGAAGGGAGGAGG + Intronic
959027917 3:101262874-101262896 AACAGAAACCAAAAGCAAGTGGG + Intronic
959133907 3:102392576-102392598 AGAAGAAGAAAGAAGGAAGGGGG - Intronic
959242220 3:103810461-103810483 AACAGAAAACAGAAAAAAGCAGG + Intergenic
959392509 3:105793488-105793510 AAAAAAAAAAAAAAGGAAGGGGG + Intronic
959884804 3:111487508-111487530 AACAGAAAACTGAGGAAAGAGGG + Intronic
959938322 3:112053872-112053894 AATACAAAAAAGAAGGGAGGTGG - Intronic
960026719 3:113019150-113019172 TACAGGAAAAAGAAGGAAAGGGG + Intronic
960033038 3:113073926-113073948 AAAAGAAAACCTAAGCAAGGAGG - Intergenic
960239954 3:115329234-115329256 AAAAGAAAAGAAAAGGAAGAAGG - Intergenic
960254811 3:115500738-115500760 CACAGAAAATAGAAAGAAAGAGG + Intergenic
960601783 3:119466089-119466111 AAAAGAAAAGAAAAGAAAGGAGG + Intronic
960891345 3:122451939-122451961 AAAAGAAAAAAAAAGGAAGAAGG + Intronic
961004559 3:123396157-123396179 AAAAGAAAAGAGAAGAAGGGAGG + Intronic
961260227 3:125595833-125595855 AAAAAAAAAAAAAAGGAAGGCGG - Intergenic
961690988 3:128669388-128669410 AAAAGAAAAGAAAAGAAAGGAGG + Intronic
961737083 3:129009155-129009177 AACAGAGGAGAGAAGAAAGGTGG - Intronic
961815895 3:129549956-129549978 AACAAAACACAAAAAGAAGGTGG + Intronic
962200162 3:133394423-133394445 AAGAGAAAACAGGGAGAAGGAGG - Intronic
962261378 3:133910668-133910690 AAATGAAAACAAAAGGAATGTGG - Intergenic
962397040 3:135025150-135025172 AAAAAAAGAAAGAAGGAAGGAGG - Intronic
962615254 3:137120099-137120121 AACAGAAACCAAAAGCAAGTAGG - Intergenic
963110189 3:141682256-141682278 AACAGAAGAGAGAAAGAAAGAGG + Intergenic
963265860 3:143239360-143239382 AACGGAAGAAGGAAGGAAGGAGG + Intergenic
963322377 3:143822816-143822838 AACAGAAAACAGAGAGAGAGTGG - Intronic
963615074 3:147526715-147526737 AACAGAAAACAGAAAAAAGCAGG - Intergenic
963632688 3:147752763-147752785 AAGAGGAAACAGAAGGAAAGGGG + Intergenic
963899813 3:150723463-150723485 AAAAGAAAAGAAAAGGAAGCAGG - Intergenic
963925564 3:150947225-150947247 AACAGAAAACAGAAAAAAGCAGG + Intronic
964251220 3:154719656-154719678 AAAAAAGAAAAGAAGGAAGGAGG + Intergenic
964431109 3:156606537-156606559 AGCAGCAAACAGCAGGAAAGCGG - Intergenic
964704890 3:159607643-159607665 GTCAGAAAACAGGAGGAAAGAGG + Intronic
964960848 3:162423266-162423288 TACAGAAAGCAGAAAGAAGGTGG - Intergenic
965117368 3:164508486-164508508 GAGAGAAAACAGAAGAAAGAAGG - Intergenic
965147547 3:164926084-164926106 AACAGAAAAGAGAAAAAAGCAGG - Intergenic
965382606 3:168008537-168008559 TACAGAAAACAGAAGCAGGTGGG + Intergenic
965417638 3:168416954-168416976 AAAAGAAAAGAAAAGAAAGGAGG - Intergenic
965503530 3:169484278-169484300 AAGAGAAAAAAGAAAGAAAGAGG + Intronic
965757147 3:172039134-172039156 AACAAAAAACAAAAAGAAAGAGG + Intergenic
965764526 3:172115937-172115959 AACAGAAATCAGAAGGAGGAGGG - Intronic
965975464 3:174614776-174614798 AACAAAAAGCTGAAGCAAGGGGG - Intronic
966019963 3:175196566-175196588 AACTTAAAGCAAAAGGAAGGTGG - Intronic
966141538 3:176762619-176762641 AAGAGAAAACAGAAAAAAAGGGG + Intergenic
966391107 3:179453123-179453145 AACAAAAAAAAGAAAGAATGTGG - Intergenic
966402313 3:179561001-179561023 AAAAGAAAACAAAAGAAAGAAGG - Intergenic
966513663 3:180793099-180793121 AACAGAAAGGAGATGCAAGGAGG + Intronic
966945178 3:184772817-184772839 AGAAGAGAAAAGAAGGAAGGAGG + Intergenic
967210230 3:187162040-187162062 AAGGGAAGACGGAAGGAAGGAGG - Intronic
967456467 3:189692315-189692337 AATAGAGAACAGAGGGAAAGAGG - Intronic
967457355 3:189703518-189703540 AAAAGAAAAGAAAAGGCAGGTGG + Intronic
967502851 3:190220437-190220459 AATGGAAAACAGAAAGAAGCAGG - Intergenic
967607324 3:191462980-191463002 AAAAGAAAAAAGAGGGAGGGAGG - Intergenic
967662765 3:192133289-192133311 GACAGAAAAGTGGAGGAAGGAGG - Intergenic
968294711 3:197567062-197567084 AAGAGAAAACAGGGGGAAGAAGG - Intronic
968414757 4:421329-421351 AACAGAAAACAGCAGTAATAGGG - Intergenic
968430506 4:555727-555749 AACAGAAACCAGCAGGAATGAGG - Intergenic
969436105 4:7190505-7190527 GACAGAAAAGAGAAAGAAAGAGG - Intergenic
969929115 4:10613151-10613173 AACAGTAAACAGAATGAATCAGG + Intronic
970110110 4:12628301-12628323 AAAAGAAAACAGGAGGGAGCAGG - Intergenic
970146579 4:13042381-13042403 AACGGGAAAGAGAAGGCAGGGGG + Intergenic
970159341 4:13173304-13173326 AAAAGAGGAAAGAAGGAAGGAGG + Intergenic
970430217 4:15982358-15982380 AACAGAACATAGAGGGAAGGGGG - Intronic
970488727 4:16550188-16550210 AACAGAATTCAGAATGAAGAGGG - Intronic
970782771 4:19758810-19758832 GACAGAAAACAAAGGGAAAGTGG - Intergenic
971153831 4:24061781-24061803 AACAGAAGCCAGGAGAAAGGAGG + Intergenic
971156462 4:24088366-24088388 AAAAGAAAGAAGAAGGAAGAAGG + Intergenic
971192607 4:24441675-24441697 AGGAAGAAACAGAAGGAAGGAGG + Intergenic
971229541 4:24789890-24789912 TAGAGAAAACAGAGGGAATGCGG - Intronic
971317507 4:25579842-25579864 AAGAAAAGAAAGAAGGAAGGAGG - Intergenic
971596838 4:28540298-28540320 AAAAGAAAGCAGAAAGAAAGGGG - Intergenic
971932386 4:33101806-33101828 GAAGGAAAAAAGAAGGAAGGAGG - Intergenic
972185860 4:36527464-36527486 AACAGAAACCAAAAGGAAGCAGG - Intergenic
972211499 4:36843314-36843336 GAAAGAAAAAGGAAGGAAGGGGG - Intergenic
972240545 4:37187341-37187363 ATCAGCCAACAGAAGGATGGAGG - Intergenic
972244557 4:37231160-37231182 AAGATAAAACAAAAGGAATGTGG - Intergenic
972342219 4:38162380-38162402 AGCAGCAAACAAAGGGAAGGAGG - Intergenic
972400325 4:38695928-38695950 AAGAGAAAAGGGAAGGAAAGTGG + Intronic
972640245 4:40918737-40918759 CAGAGAAAAAATAAGGAAGGAGG - Intronic
972696476 4:41451485-41451507 AACAGAATATAGCAGGACGGGGG - Intronic
972776097 4:42242020-42242042 AACAAAAGGCAGAAGGAGGGAGG + Intergenic
972790228 4:42364734-42364756 AAGAGAGAAAGGAAGGAAGGAGG - Intergenic
972790239 4:42364860-42364882 AAGAGAAAGAGGAAGGAAGGAGG - Intergenic
973047679 4:45554732-45554754 AAAAGAGAACAGAATGAAAGAGG - Intergenic
973104016 4:46309248-46309270 AAAAGAAAACGGAAGAATGGTGG - Intronic
973149476 4:46869193-46869215 AACAGAAAACAGAAAAAATCAGG - Intronic
973334562 4:48942916-48942938 AAAAAAAAAAGGAAGGAAGGAGG - Intergenic
973365801 4:49208352-49208374 AACGGAAAACAGAAAAAAGCAGG - Intergenic
973394796 4:49584099-49584121 AACGGAAAACAGAAAAAAGCAGG + Intergenic
973563344 4:52159094-52159116 AAGAGAAAAGAAAAGAAAGGAGG - Intergenic
973636521 4:52866203-52866225 AAGAGAAAAAAGAAAAAAGGGGG - Exonic
974006798 4:56566118-56566140 AACAGAAAACAACAGCAAGTTGG - Intronic
974557874 4:63475329-63475351 AACAGAAAACAGGAGAGAGATGG - Intergenic
974745773 4:66073817-66073839 AAGAGAAAAGAGAAGAAAGCAGG - Intergenic
974980813 4:68955203-68955225 AACAGGACACAGCAGTAAGGTGG + Intergenic
975021736 4:69499685-69499707 AATAGAAAGCAGAAAGAAGCAGG - Intronic
975256332 4:72240057-72240079 AAGATTAAACAAAAGGAAGGAGG + Intergenic
975403464 4:73963540-73963562 AACAGAAAACAGAAAAAAGCAGG - Intergenic
975406886 4:73999899-73999921 CACAGATAACAGAAGGAGAGAGG - Intergenic
975631323 4:76405661-76405683 AACTAAAAACGGAAGGAAGAGGG + Intronic
975883861 4:78941385-78941407 AACAGGAAAAGGAAGAAAGGAGG + Intergenic
975899629 4:79136855-79136877 AACAGAAAACAGAAAAGAGAAGG - Intergenic
975940513 4:79638984-79639006 AACAGAAACTTGAAAGAAGGGGG - Intergenic
975990766 4:80257761-80257783 AACAGAAAAGAAAAAGAAAGAGG + Intergenic
976398349 4:84582110-84582132 AAGAGAAAAAAGAAAAAAGGCGG - Intergenic
976424993 4:84892919-84892941 AACAGAAACCTGAATGAATGAGG + Intronic
976426949 4:84915136-84915158 GACAGAAAACAGAATAGAGGTGG + Intronic
976466674 4:85377325-85377347 TACTGAAAATAGATGGAAGGGGG - Intergenic
976781295 4:88761544-88761566 CACATCACACAGAAGGAAGGAGG + Intronic
976817487 4:89166095-89166117 AACAGAAGCCATAAGAAAGGGGG + Intergenic
976831859 4:89324172-89324194 AACAGAAAATAGAAGTTATGAGG - Intergenic
976885540 4:89979463-89979485 AAAAGAAAAAAGAAGGAAGAAGG - Intergenic
977004463 4:91547530-91547552 AAAAGTAAACAGAAGGAAGAAGG - Intronic
977334065 4:95673850-95673872 AAGAGAATACTGAAGGAAAGTGG - Intergenic
977519124 4:98058378-98058400 AATGGAAAACAGAAGAAAGCAGG + Intronic
977613558 4:99062137-99062159 AACAGAAAAGGGAAGAAAGGGGG - Exonic
977803143 4:101262916-101262938 GACAGAAAAACAAAGGAAGGAGG + Intronic
977841884 4:101716826-101716848 AACAGAAACCAAAAGCAAGCAGG + Intronic
977895726 4:102362800-102362822 GAAGGAAAACAGAAGCAAGGTGG + Intronic
978061154 4:104341209-104341231 AACACAACAAAGAAGAAAGGAGG - Intergenic
978077203 4:104546588-104546610 AAAACAAAAAAAAAGGAAGGAGG + Intergenic
978254595 4:106679280-106679302 AGCAGCAATAAGAAGGAAGGAGG - Intergenic
978264929 4:106812383-106812405 AAAAGAATACAGAAGGAAAGAGG - Intergenic
978407153 4:108392339-108392361 ATCAGAGAACATGAGGAAGGTGG - Intergenic
978414003 4:108456696-108456718 AATAGAAAAAATAGGGAAGGGGG - Intergenic
978444016 4:108763298-108763320 AAAAGAAACCAGAAAGAACGTGG - Intergenic
978719092 4:111884964-111884986 AAGAGAAGAGAGAAGGAAGAAGG - Intergenic
979192998 4:117886095-117886117 AACAGAGAACAGAAGAAACAGGG + Intergenic
979243679 4:118473556-118473578 AACAGAAAGAAGAAGAAAGAAGG - Intergenic
979469883 4:121082971-121082993 AACAGAAAGCTGAAGCAGGGTGG + Intergenic
979588420 4:122448828-122448850 GGCAGAAAACAGCAGGTAGGAGG - Intergenic
979677357 4:123424533-123424555 AAAAGAAAAGAGAAGGCAAGTGG - Intergenic
980269681 4:130567912-130567934 AAGAGAAAATAGGAGGAAGAAGG + Intergenic
980287779 4:130803533-130803555 AACAGAAAACAAAGGCAAGCAGG - Intergenic
980512730 4:133814394-133814416 AATGGAAAACAGAAAAAAGGAGG + Intergenic
980562147 4:134491218-134491240 AACAGAAACCAAAAGCAAGCTGG + Intergenic
980709141 4:136541647-136541669 AACAGAAAAAACAAGTAAGCGGG + Intergenic
980758224 4:137192828-137192850 AAAAGAAAAGAAAAGGAAAGAGG + Intergenic
980810539 4:137872869-137872891 AACAAAGAAGAGAGGGAAGGGGG + Intergenic
980903216 4:138924626-138924648 AAAAGAAAAAAGAAGGAGGTGGG + Intergenic
981014265 4:139957149-139957171 AACAGAAAACGGAAGGAAAATGG + Intronic
981091452 4:140736658-140736680 AACAGAGAACAGGAAGAAAGAGG + Intronic
981717009 4:147761688-147761710 AACAGCAAACAGAATGAATTGGG + Intronic
981813047 4:148797146-148797168 AGTAGAGAACAGAATGAAGGAGG + Intergenic
981898072 4:149828263-149828285 AAGAGTAAACAGAAGGCAGATGG - Intergenic
981952582 4:150427568-150427590 GGCAAAAAACAGAAGGAAGGAGG + Intronic
982132322 4:152240983-152241005 AAGAGAAAAAAAAATGAAGGGGG + Intergenic
982183917 4:152777542-152777564 AAGAAAAAAAGGAAGGAAGGAGG + Intronic
982185735 4:152796410-152796432 AACAGGAAAGAGAAAGAAGAAGG - Intronic
982489406 4:156010504-156010526 AAGAGAAAACAAAAGGAAATTGG + Intergenic
982793206 4:159616224-159616246 AAAAAAAAAAAAAAGGAAGGGGG - Intergenic
982832318 4:160078115-160078137 AACAGAGAACAGAATGGTGGGGG + Intergenic
982837161 4:160133467-160133489 AACAGAAAACAAAAGCAATCAGG + Intergenic
982925235 4:161328627-161328649 AACAGACAACAGAAGGATTCTGG - Intergenic
983008506 4:162516075-162516097 AAAAAAAAACAGAAGGTAAGTGG + Intergenic
983066606 4:163217417-163217439 AAGAGGAAACTGAAGAAAGGAGG - Intergenic
983139255 4:164127909-164127931 AAAAGAAAAAAAAATGAAGGGGG + Intronic
983271340 4:165565739-165565761 AACAGAAAAATGGAGGCAGGTGG + Intergenic
983588153 4:169378144-169378166 AACAGAAAACAAAAGTGAGCAGG + Intergenic
983953950 4:173675333-173675355 AAAAGAAAAGAAAAGGAGGGAGG - Intergenic
984071139 4:175114452-175114474 AATAGAAAACAGAAAAAAGCAGG + Intergenic
984171573 4:176366323-176366345 AACAGAAAACAAAAGAAAGCAGG - Intergenic
984172134 4:176372281-176372303 AACAGAAACCAAAAGCAAGCAGG - Intergenic
984552009 4:181171664-181171686 AAAAGAAAGAAGAGGGAAGGTGG - Intergenic
984765350 4:183396575-183396597 AACAGAAACAGGAAGGAAGTGGG - Intergenic
984839363 4:184053580-184053602 AACAGACAACAGACTGAGGGAGG - Intergenic
984945843 4:184968111-184968133 AACAAACAAAAGAAGGAAAGAGG + Intergenic
985121279 4:186645032-186645054 CACAGAAAACAGGAAGCAGGAGG + Intronic
985172024 4:187160712-187160734 AACATAAAACAGAAGGAATTTGG + Intergenic
985295076 4:188428291-188428313 AACAGAAAACAAAAGAACTGAGG - Intergenic
985876995 5:2607483-2607505 AACAGAAAGCAGAGGCAAGGTGG + Intergenic
986109231 5:4694860-4694882 AACAGAAGACAAAATAAAGGAGG + Intergenic
986170774 5:5312756-5312778 AGAAGAAAACAAAAGGAAGGGGG - Intronic
986190535 5:5492915-5492937 GAAAGGAAAGAGAAGGAAGGAGG + Intergenic
986403913 5:7406570-7406592 CACATAAAACAGAAGAAAAGGGG - Intronic
986515637 5:8560387-8560409 TTCAGAAAATAGAAGAAAGGGGG - Intergenic
986654951 5:10001858-10001880 AATGGAAAACAGAAGAAAGCAGG + Intergenic
986796533 5:11218063-11218085 AAGAGGAAAAGGAAGGAAGGAGG - Intronic
987480656 5:18453070-18453092 AAGAGAAAAATGAAGCAAGGAGG + Intergenic
987612350 5:20222559-20222581 AACATAAACCAGAAGGACAGAGG + Intronic
988095395 5:26601970-26601992 GAGAGAAAAAAGAAGGAAGTGGG - Intergenic
988185746 5:27859359-27859381 AAGAGAAAATAGAAGGAGGAAGG + Intergenic
988225031 5:28402783-28402805 AAAAGAAAGCACAGGGAAGGAGG + Intergenic
988371506 5:30374950-30374972 AACAGAAAAAGGGAGAAAGGTGG + Intergenic
988404622 5:30808223-30808245 AAAAGAGAAGAGAAGGAAGTAGG + Intergenic
988657966 5:33233444-33233466 AGAGGAAAACAGAAGGCAGGTGG + Intergenic
988780599 5:34517946-34517968 CACACATAAAAGAAGGAAGGTGG + Intergenic
988799107 5:34679698-34679720 AGCAGTAATGAGAAGGAAGGGGG + Intronic
988849935 5:35171019-35171041 AACAGCAAACAGAAACAAGCCGG - Intronic
988914653 5:35880399-35880421 AACAAGAAAAAGTAGGAAGGGGG - Intergenic
988967091 5:36430306-36430328 AATAAAAAACAGAAAGAAGCAGG - Intergenic
989078026 5:37585810-37585832 AACAGATAACACTAGTAAGGGGG - Intronic
989079707 5:37605009-37605031 AAAAAAAAAAAGAAGGAGGGGGG - Intronic
989349259 5:40466522-40466544 AACAGCAAACACAAGAAAGCTGG + Intergenic
989400390 5:41001735-41001757 AAAAGAAAACAAGAGAAAGGTGG + Intronic
989408269 5:41086725-41086747 AAGAGAAACCAGAAGGAGGCTGG - Intergenic
989414874 5:41162272-41162294 AACATAAATCAGAAGCAGGGCGG - Intronic
989494620 5:42098064-42098086 AGCAGTAAAAAGAAGGAAGTTGG - Intergenic
989613694 5:43318783-43318805 AAGAGAATTCAGAAGGAAAGTGG - Intergenic
990534612 5:56707985-56708007 AACAGAAAACAAAAAGGAGGAGG + Intergenic
990597420 5:57325507-57325529 AGCATAAAACTGAAGGAAGTCGG + Intergenic
990658748 5:57988232-57988254 AAAAAAAAAAAGAAGGAAGAAGG - Intergenic
990676229 5:58189016-58189038 ATCAGAAAAAAGAAAGAAAGTGG + Intergenic
990951833 5:61305961-61305983 ATGAGAAAACAGAGGGATGGGGG - Intergenic
991158443 5:63466470-63466492 AGAAGAAATCAGATGGAAGGAGG + Intergenic
991216212 5:64159656-64159678 AACAGAAAAAGGAAAGAAGAAGG - Intergenic
991942135 5:71863230-71863252 AAGAAACAACAGAGGGAAGGAGG - Intergenic
992130304 5:73685467-73685489 GTCTGAAATCAGAAGGAAGGAGG - Intronic
992241100 5:74770699-74770721 AACAGGAAAGAGAAAGAAGAAGG + Exonic
992284296 5:75217579-75217601 AATAGAAAACAGAAAAAAGCAGG - Intronic
992466556 5:77011889-77011911 ATCAGGAGAGAGAAGGAAGGAGG - Intergenic
992501297 5:77346796-77346818 AACTTAAAACAAGAGGAAGGAGG + Intronic
992623447 5:78616035-78616057 AACAGAGGGCAGAAGGAAGGAGG - Intronic
992741255 5:79775519-79775541 AAGAGAAAACAGGAGAGAGGGGG + Intronic
992927859 5:81609002-81609024 AAGAGAAAATAGAAGGAATTTGG + Intronic
993046697 5:82874364-82874386 CAAAGAATACAGAAGGCAGGTGG + Intergenic
993081484 5:83306877-83306899 AACAGAAAGCAGAAAGAAAAGGG + Intronic
993262087 5:85670658-85670680 CACAGAAAAATGAAGCAAGGGGG + Intergenic
993407652 5:87531538-87531560 CACAAAAGAGAGAAGGAAGGAGG - Intergenic
993439375 5:87936904-87936926 AAAAGAAAAGAAAAGGAAGAGGG - Intergenic
993482207 5:88437994-88438016 AAAATAAAACAGAAGGAAAAGGG - Intergenic
993876837 5:93317355-93317377 AACAGAAAAAAAAAAGAATGAGG + Intergenic
994155832 5:96503472-96503494 AAAAGAAAAGAGAAGAAAGGGGG + Intergenic
994632463 5:102302831-102302853 ATCAGAAAACGGGAGGAAGATGG - Intergenic
994672274 5:102776949-102776971 ATCAGAAAATACAAGGAAGCAGG - Intronic
994784446 5:104138530-104138552 AGGAAAAAACAGAAGGAAAGAGG + Intergenic
994940733 5:106320733-106320755 AAAAAAAAAAAGAAAGAAGGGGG + Intergenic
995274756 5:110265528-110265550 GACAGAAAGAAGAAGGCAGGAGG - Intergenic
995377073 5:111486550-111486572 AAGAGCAAAGAGAGGGAAGGGGG + Exonic
995428817 5:112051693-112051715 AATGGAAAACAGAAGAAAGCAGG + Intergenic
995499219 5:112785066-112785088 AAAAGAAAACAGAAATAATGAGG + Intronic
995545740 5:113228557-113228579 AGCAAAAACAAGAAGGAAGGTGG + Intronic
995731008 5:115241935-115241957 AACAGAAAACAGAAGCCCAGAGG + Intronic
996105448 5:119496726-119496748 AAAAGAAAAGAGAAAGAAGTAGG - Intronic
996141126 5:119911093-119911115 AATAGAAACCAAAAGGAAGCAGG - Intergenic
996199800 5:120657817-120657839 AACAAAAAGCAGAAGGTGGGAGG - Intronic
996245668 5:121261462-121261484 AACAGAAAACAGAAAAAAGTAGG - Intergenic
996251669 5:121342723-121342745 AACAGAGAACAGAAAGATGATGG + Intergenic
996304857 5:122035453-122035475 GACAGAGCACAGAAGGAAGATGG - Intronic
996337822 5:122403948-122403970 AAAAGAAAACTGAAAGCAGGGGG - Intronic
996471139 5:123862096-123862118 AAAAGAAAAAGGAAGGAAGAAGG - Intergenic
996506381 5:124272177-124272199 AAGAGAAAATAGAAGAAAGGAGG + Intergenic
996521349 5:124429599-124429621 AACAGAAACCAAAAGGAAGCAGG + Intergenic
996529458 5:124512387-124512409 ATCAGAAGACAGAAGGAGAGAGG - Intergenic
996698776 5:126427746-126427768 AACAGAACACAGATTGAAGTTGG + Intronic
996758220 5:126958181-126958203 AACAGAAAGCAGAGAAAAGGAGG - Intronic
996902094 5:128554046-128554068 AATAGAAAACAGAACAAAGCAGG + Intronic
997006503 5:129822872-129822894 AGGATAAAACACAAGGAAGGTGG - Intergenic
997051487 5:130386242-130386264 AACAGAAAGCAGAAGGCCTGAGG + Intergenic
997259209 5:132453132-132453154 AAAAGAAAGCAGAAGGAAAAAGG - Intronic
997593070 5:135087352-135087374 AAGAGCAAGCAGAAGCAAGGAGG + Intronic
997665552 5:135627202-135627224 GACAGAAATCAGAGGCAAGGGGG - Intergenic
998019743 5:138759474-138759496 AAGAGAAAAATGAAGGAAGTAGG + Intronic
998120417 5:139571806-139571828 AAAGGAAAAAGGAAGGAAGGAGG - Intronic
998192150 5:140035115-140035137 AACAAAAAACAAAATGAAAGGGG - Intronic
998243168 5:140469131-140469153 AAAAGGAAGAAGAAGGAAGGAGG - Intronic
998333170 5:141347111-141347133 AACAGAGGAAGGAAGGAAGGAGG - Intronic
998715430 5:144878659-144878681 AAAAAAAAAAAAAAGGAAGGTGG - Intergenic
998731025 5:145077331-145077353 AGCAGACAACAGGAGGAAGGGGG - Intergenic
999066281 5:148689291-148689313 AACAGAAAACACAAACAAGCAGG + Intergenic
999237856 5:150110015-150110037 TACTGAAACCAGAAGCAAGGGGG - Intronic
999543355 5:152598798-152598820 AACATAAATCAGAAGAAGGGTGG + Intergenic
999878756 5:155837605-155837627 AACAGAACAGGGAAGGAAGGAGG - Intergenic
999908203 5:156166998-156167020 AGGAGAAATCAGAAGGAAGTAGG - Intronic
999966563 5:156816517-156816539 AAGAGGTGACAGAAGGAAGGGGG + Intergenic
1000048762 5:157544114-157544136 AACAGAAAGGCGAAGGAAGGGGG + Intronic
1000425157 5:161081475-161081497 AACAGAAAATGGGAGGAAAGTGG + Intergenic
1000680657 5:164179720-164179742 AACAGAAGACAAAAGAAATGTGG - Intergenic
1000693231 5:164348441-164348463 CACAGAAACCAGAAGAAAAGTGG - Intergenic
1000829654 5:166086934-166086956 AAAAGAACACAGAGAGAAGGGGG - Intergenic
1001215120 5:169848805-169848827 AAAAGAAAAAAGAAGGAAATTGG + Intronic
1001234250 5:170015935-170015957 GAAAGAAACAAGAAGGAAGGAGG - Intronic
1001330185 5:170756501-170756523 AAAAGAAAAAGGAAGGAAGGAGG + Intergenic
1001365312 5:171132280-171132302 AGGAGAGAAAAGAAGGAAGGAGG + Intronic
1001582105 5:172805964-172805986 AAGAGAAAGGAGAAGCAAGGCGG - Intergenic
1001649169 5:173303080-173303102 AAAAGAAAAAGGATGGAAGGAGG - Intergenic
1002159812 5:177308358-177308380 AACAAAAAACAAAAGAAACGGGG - Intronic
1002207720 5:177575197-177575219 AACCGGACACAGCAGGAAGGTGG - Intergenic
1002682295 5:180976168-180976190 AGGAGGAAACACAAGGAAGGTGG - Intergenic
1002794372 6:459605-459627 AAAAGCAAATAGAAGAAAGGAGG + Intergenic
1002794376 6:459612-459634 AATAGAAGAAAGGAGGAAGGGGG + Intergenic
1003000802 6:2330981-2331003 AAAAGAAAACAGAGGCATGGTGG - Intergenic
1003020685 6:2506374-2506396 AACAGAAAAAGTAAGAAAGGAGG - Intergenic
1003162297 6:3646546-3646568 AAAAAAAAAAAGAAGGAATGTGG + Intergenic
1003376236 6:5580298-5580320 AAAAAAAAAGAGAAGGAGGGAGG + Intronic
1003466140 6:6381948-6381970 AGGAGATAAAAGAAGGAAGGAGG + Intergenic
1003519907 6:6849656-6849678 GGCAAAAAACAGAAAGAAGGGGG + Intergenic
1003672921 6:8176477-8176499 AAGAAAGAAAAGAAGGAAGGGGG - Intergenic
1003954546 6:11149678-11149700 CCCAGGAAACAGAAGAAAGGTGG - Intergenic
1004049139 6:12057551-12057573 AACAGAAAACAGAACAATGGAGG - Intronic
1004302654 6:14472589-14472611 AACACAGAAGAAAAGGAAGGAGG + Intergenic
1004337754 6:14779909-14779931 TCCATCAAACAGAAGGAAGGAGG + Intergenic
1004423552 6:15492491-15492513 AAAAGGAAACAGAAGAATGGAGG - Intronic
1004595355 6:17094349-17094371 GAGAGAAGACAGAGGGAAGGAGG + Intergenic
1004759687 6:18652815-18652837 AACGAAAAACAAATGGAAGGAGG + Intergenic
1004862880 6:19823529-19823551 ACAAAAGAACAGAAGGAAGGAGG - Intergenic
1004953358 6:20700161-20700183 AGAATAAAACAGAAGCAAGGTGG - Intronic
1005062087 6:21786051-21786073 TACAGGAAAGAGAATGAAGGAGG - Intergenic
1005072225 6:21872306-21872328 AGCAGAAAAGAGGAGGAAAGAGG - Intergenic
1005247098 6:23899325-23899347 TCCAGAAAATAGAAGGAATGAGG - Intergenic
1005275511 6:24212409-24212431 GAAAGAAAACAAAAGGCAGGAGG - Intronic
1005619905 6:27610360-27610382 AAAAGAAAAAAGAAAGAAAGAGG + Intergenic
1005636678 6:27759469-27759491 AAAAGAAAAAAAAAGGAATGAGG - Intergenic
1005714102 6:28530751-28530773 AACAGATAACAGAAGGACATAGG + Intronic
1005893033 6:30155256-30155278 CACAGATGACAGAAGGAGGGCGG - Intronic
1006019273 6:31108117-31108139 AAAAGAAAAGAAAAGAAAGGCGG - Intergenic
1006213166 6:32414587-32414609 GAAAGAAAAGAGAAGAAAGGAGG + Intergenic
1006277044 6:33013333-33013355 AAAACAAAACAGAAAGATGGAGG - Intergenic
1006308801 6:33242595-33242617 AAGAGAAGAAAGAAGAAAGGAGG + Intergenic
1006748146 6:36359474-36359496 AAAAGAAAAAAGAAAGAAAGGGG + Intronic
1006761041 6:36460933-36460955 ATAAGAAAACTGAAGGAAGAAGG - Intronic
1006893090 6:37446601-37446623 AATGGAAAACAGAAGGCTGGGGG + Intronic
1007013344 6:38438816-38438838 AAAACAAAACAGAAGGAAGATGG + Intronic
1007025685 6:38570567-38570589 ATCAGAAAACAGAAGAAAAGAGG - Intronic
1007119126 6:39365900-39365922 AACAGACAGCAGAAGGTAGGGGG + Intronic
1007128069 6:39444231-39444253 AAAAGAAAAAAAAAGAAAGGTGG - Intronic
1007261622 6:40568056-40568078 GAGAGAGAAGAGAAGGAAGGGGG - Intronic
1007514305 6:42399218-42399240 AACAAAAATCAGAAGGAAGTAGG + Intronic
1007611324 6:43151200-43151222 AAAAAAAAAAAGAAGGCAGGTGG - Intronic
1007797705 6:44363703-44363725 AAAGGAAAAAGGAAGGAAGGAGG - Intronic
1008142884 6:47852413-47852435 AAATAAAAATAGAAGGAAGGTGG + Intergenic
1008424307 6:51339055-51339077 AACAGAAAACAGAGAGAATGAGG - Intergenic
1008516483 6:52324057-52324079 AAAAGAAGACAGAAAAAAGGGGG + Intergenic
1008988792 6:57578653-57578675 AAAAAACAAAAGAAGGAAGGAGG - Intronic
1009195514 6:60679699-60679721 AACATAAAATGGCAGGAAGGTGG - Intergenic
1009195930 6:60684371-60684393 AAGAGAAGAGAGAAGGAGGGAGG + Intergenic
1009332713 6:62443863-62443885 AATGGAAAACAGAAGAAAGAAGG - Intergenic
1009553992 6:65138538-65138560 AACAGAAAACTGAAAGTTGGAGG + Intronic
1009990601 6:70838718-70838740 AACAGAGGAGACAAGGAAGGAGG + Intronic
1010352671 6:74893449-74893471 AATAAAAAAAGGAAGGAAGGAGG + Intergenic
1010380241 6:75215675-75215697 AACAGAAAACAGAAATAACAGGG + Intergenic
1010399432 6:75431457-75431479 AACAGAAAACAAGGGGAAGAAGG - Intronic
1010721169 6:79284658-79284680 AAAAAAAAAAAAAAGGAAGGTGG + Intergenic
1010909989 6:81542148-81542170 AACATAAAAAAGAAGGAAATTGG + Intronic
1011014364 6:82738416-82738438 AACAGAAATAGGAAGAAAGGAGG - Intergenic
1011043614 6:83058005-83058027 ACCAGAGAACCGAAAGAAGGAGG - Exonic
1011108534 6:83810913-83810935 ACCAGAAAACAAAAGGAAGGAGG - Intergenic
1011198297 6:84805330-84805352 GAAAGAAAACATTAGGAAGGTGG - Intergenic
1011349583 6:86407811-86407833 AAAAGAAAAGAAAAGAAAGGAGG - Intergenic
1011852077 6:91641363-91641385 AACAGCAAACCCTAGGAAGGGGG + Intergenic
1011930816 6:92709983-92710005 AATAAAAAACATCAGGAAGGAGG + Intergenic
1012029125 6:94036349-94036371 ATCAGAAGACAGAAAGATGGAGG + Intergenic
1012153457 6:95785459-95785481 GACAGAAAACAGAAGTGAGGTGG - Intergenic
1012382880 6:98641129-98641151 AAAAAAAAAAAGATGGAAGGTGG + Intergenic
1012519879 6:100108795-100108817 AATACAAAAAAGAAGGGAGGAGG + Intergenic
1012523504 6:100149426-100149448 AATAGAAAGCAGGAGAAAGGGGG + Intergenic
1012565198 6:100640137-100640159 AAAATAATAGAGAAGGAAGGAGG + Intronic
1012586648 6:100931481-100931503 AATAGAAAACAGAAAAAAGCAGG - Intergenic
1012602266 6:101113131-101113153 AGCAGGAACCAGAATGAAGGGGG + Intergenic
1012614156 6:101254965-101254987 AAAAGAAAACAGAACAGAGGGGG + Intergenic
1012781399 6:103562882-103562904 AATAGAAAAAAGAAGACAGGTGG - Intergenic
1013017241 6:106170999-106171021 CTCAGAAAACAAAAGGAAGGGGG + Intergenic
1013357249 6:109356904-109356926 AACAGAACACAGATGGAACTTGG + Intergenic
1013456462 6:110334094-110334116 GAGAGAAAACAGAGGAAAGGGGG + Intronic
1013821097 6:114154338-114154360 AACCCAAAAGAGAAGCAAGGTGG + Intronic
1013923481 6:115439458-115439480 AAAAAAAAAAAGAAGGAAAGGGG + Intergenic
1014157624 6:118129489-118129511 AATAGAGAACAGATTGAAGGGGG + Intronic
1014199213 6:118590139-118590161 AACAGGAAACAGAGTGAGGGGGG - Intronic
1014224350 6:118831032-118831054 AAATGAACACAGAAAGAAGGTGG + Intronic
1014291121 6:119559988-119560010 AACCTAAAAAAGAATGAAGGCGG - Intergenic
1014332753 6:120090903-120090925 AACAGAAAAAAAAAGTAAGAAGG - Intergenic
1014464287 6:121736849-121736871 AATGGAAAACAGAAAGAAGCAGG - Intergenic
1014666559 6:124244718-124244740 AACAGAAAACAAAAGTAAGAAGG - Intronic
1014676652 6:124375755-124375777 TACAGAACTCAGAAAGAAGGGGG + Intronic
1014728486 6:125002676-125002698 ATCAGAAAGCAGAAAGGAGGAGG - Intronic
1015401883 6:132796541-132796563 AAAAAAAAAAAAAAGGAAGGGGG + Intronic
1015468356 6:133573784-133573806 AAAAAAAAAAAAAAGGAAGGAGG + Intergenic
1015544532 6:134347885-134347907 AACAGAAGACAGGAGGTGGGAGG + Intergenic
1015678057 6:135772474-135772496 AAGAGTAAACATAAGGAAGGTGG - Intergenic
1015882554 6:137883608-137883630 AAGAGAAAACAAGAGGGAGGAGG + Intergenic
1016422244 6:143897604-143897626 AACAGAAAAGGGAAAGAAGGAGG - Intronic
1016521935 6:144955406-144955428 AAAAGAGGAAAGAAGGAAGGAGG - Intergenic
1016546473 6:145229613-145229635 AAGAAAAGAAAGAAGGAAGGAGG - Intergenic
1016780155 6:147948979-147949001 AACAGGAGACAGAAAGATGGAGG + Intergenic
1017041134 6:150309327-150309349 AAGGAAAGACAGAAGGAAGGAGG + Intergenic
1017042237 6:150316932-150316954 AACAAAATGCAGAAGAAAGGGGG + Intergenic
1017681198 6:156865811-156865833 AAAAGGAAAAAGGAGGAAGGTGG - Intronic
1017726366 6:157278746-157278768 AAAAAAAAAAAAAAGGAAGGAGG - Intergenic
1017921565 6:158877462-158877484 GAAAGAAAAAGGAAGGAAGGAGG - Intronic
1017926238 6:158913852-158913874 AACAGCAAAAAGAAGGGAGCTGG - Intergenic
1017926723 6:158917136-158917158 AAAAAAAAAAGGAAGGAAGGAGG - Intergenic
1018631258 6:165825165-165825187 AAAAGAAAAAAAAAGAAAGGGGG + Intronic
1018801630 6:167227210-167227232 ACCAGTCAGCAGAAGGAAGGAGG - Intergenic
1018825147 6:167403317-167403339 AAAGGAAAGAAGAAGGAAGGAGG + Intergenic
1018843900 6:167540756-167540778 AAAAGAAAAGAGAGGGAAAGAGG + Intergenic
1018896494 6:168022381-168022403 AACACAAAACATAAGGAAAATGG - Intronic
1019151280 6:170007597-170007619 AACAGTAATCAGTGGGAAGGAGG - Intergenic
1019325084 7:434012-434034 AAAGGAAAAAGGAAGGAAGGGGG + Intergenic
1019351938 7:558334-558356 AAAAAAAAAAAAAAGGAAGGAGG + Intronic
1019797635 7:3063518-3063540 AGCAGAAGAAAGAAGGAAGAAGG - Intergenic
1019916819 7:4138767-4138789 GAAAGAAAGAAGAAGGAAGGAGG + Intronic
1020073327 7:5241595-5241617 AAAAAAAAAAGGAAGGAAGGAGG - Intergenic
1020073378 7:5241906-5241928 AAAAGAAAAAAGAAAGAATGAGG - Intergenic
1020087273 7:5317247-5317269 ACCAGCAAGCAGAAGGAGGGGGG + Intronic
1020103803 7:5411232-5411254 AAGAAAAAAGAAAAGGAAGGGGG + Intronic
1020152025 7:5689949-5689971 AACAGAAAAGAGAAGAGAAGAGG + Intronic
1020240406 7:6390042-6390064 AAAAGAAAGGAGAAGGAAGGAGG - Intronic
1020460375 7:8423552-8423574 AACTGAATAAAGATGGAAGGAGG - Intergenic
1020702874 7:11505476-11505498 AACAGAAGACAAAAGAAAGAAGG + Intronic
1020800554 7:12727345-12727367 AACACAAAACGCAAGGAATGTGG + Intergenic
1021622440 7:22562184-22562206 AAAAGAGAACAGAAGGGAAGAGG - Intronic
1022381198 7:29861488-29861510 AAGAGAAAACAAAGGAAAGGAGG - Intronic
1022487849 7:30794218-30794240 AACAAAAAACAAGGGGAAGGGGG - Intronic
1022560344 7:31341937-31341959 AAGAGAAAACAGGAGGAAGGTGG - Intergenic
1022715740 7:32896267-32896289 AAAAAAAAAAAGAAGGAATGAGG + Intergenic
1023204171 7:37730158-37730180 AAGAGAGAAGAGAAAGAAGGGGG - Intronic
1023280248 7:38561829-38561851 AAGAGAACACAGCAAGAAGGTGG + Intronic
1023283036 7:38591260-38591282 AAAAGAAAAGAAAAGAAAGGAGG - Intronic
1023408820 7:39865628-39865650 AAAAGAAAAGAAAAGGAATGCGG + Intergenic
1023668755 7:42554289-42554311 AAAAAATAACAGTAGGAAGGGGG + Intergenic
1023809665 7:43902099-43902121 GACAGAACAGAGAAGGGAGGAGG + Intronic
1024515661 7:50252670-50252692 AACAGAAGATAGAAGGAAGAGGG - Intergenic
1024624828 7:51197836-51197858 AATGGAAAACAGAAGAAAGCAGG - Intronic
1025044124 7:55678396-55678418 AAAAGAAAAGAAAAGGAATGTGG - Intergenic
1025137046 7:56426918-56426940 AAAAGAAAAGAAAAGGAATGTGG - Intergenic
1025207036 7:56999923-56999945 ACCAGCAAACAGAAGGAGGGGGG - Intergenic
1025481393 7:60988141-60988163 AAAAGAAAAAAGGAGGAGGGGGG - Intergenic
1025605060 7:63033798-63033820 AAGAGAGAAAGGAAGGAAGGAGG + Intergenic
1025664903 7:63576979-63577001 ACCAGCAAACAGAAGGAGGGGGG + Intergenic
1025770488 7:64500779-64500801 AGCCAAAAACAGGAGGAAGGAGG - Intergenic
1025943962 7:66092464-66092486 AAAAAAAAAAAAAAGGAAGGGGG + Intronic
1026104700 7:67411505-67411527 AAAAAAAAAAAGAAGGAAAGTGG + Intergenic
1026227749 7:68457576-68457598 AAAAAAAAAAAGATGGAAGGTGG + Intergenic
1026358494 7:69581024-69581046 AACAAAAAAGTGAAGGAAGGGGG + Intergenic
1026638877 7:72106891-72106913 GAAAGAAAAAGGAAGGAAGGAGG + Intronic
1026652488 7:72227555-72227577 AAAAGAAAAAAGAAAAAAGGTGG + Intronic
1027194430 7:76019936-76019958 AAAAAAAAAAAGAAAGAAGGGGG + Intronic
1027279458 7:76595587-76595609 AACACAAAACAGAAAAAAGCAGG + Intergenic
1027450321 7:78324238-78324260 AAAAAAAAACAGAAGGCTGGTGG + Intronic
1027482347 7:78714474-78714496 AATAGGAATCAGATGGAAGGTGG - Intronic
1027656481 7:80936452-80936474 AACAAAATACAGTAGGGAGGAGG - Intergenic
1027701001 7:81470097-81470119 AATAGAATCCAGGAGGAAGGAGG + Intergenic
1027865513 7:83640906-83640928 AACACAAGACAGATAGAAGGAGG + Intronic
1028014200 7:85686395-85686417 AGAAGAAGACAGGAGGAAGGGGG + Intergenic
1028569716 7:92273613-92273635 AAGGGAAAACAGATGGAAGATGG + Intronic
1028607812 7:92674076-92674098 AAAAAAAAAAAGAAGAAAGGGGG - Intronic
1028780666 7:94732220-94732242 AATAGAAAACAGAAAAAAGCAGG + Intergenic
1029006989 7:97221180-97221202 TACAGAAAACAATAGGAATGGGG - Intergenic
1029063736 7:97826783-97826805 AACAGAAAAACAAAGCAAGGGGG + Intergenic
1029109089 7:98203097-98203119 AACAGAGAAAAGAAGAAAGCTGG + Intronic
1029372582 7:100158714-100158736 AACAGGAAGCGGAAGGGAGGGGG + Intronic
1029584867 7:101463841-101463863 AAGAGAAAAAAGAGGGAGGGAGG - Intronic
1029633768 7:101770104-101770126 AAGAAAGAAAAGAAGGAAGGAGG - Intergenic
1029635168 7:101778708-101778730 AAAAGAAAGAGGAAGGAAGGTGG - Intergenic
1029887790 7:103891097-103891119 AACAAAAAACAAAAAGAAAGTGG + Intronic
1029923170 7:104287615-104287637 AAAAGAAAAGAGAAGAAGGGAGG - Intergenic
1030183109 7:106731347-106731369 AACAGACAATAGAAGGAAGGTGG + Intergenic
1030241672 7:107332836-107332858 AACACTGAAAAGAAGGAAGGAGG + Intronic
1030551370 7:110964771-110964793 AATAGAAAGAGGAAGGAAGGAGG - Intronic
1030822085 7:114106354-114106376 AACAGAAAAAAAAAAAAAGGAGG - Intronic
1030987498 7:116259796-116259818 AAAAAAAAAAAAAAGGAAGGAGG - Intergenic
1030988959 7:116276989-116277011 AACAGAAAACAGAAAAAAGGAGG - Intergenic
1030989014 7:116277707-116277729 AACAGTAAACAGAAAAAAGGAGG - Intergenic
1031302429 7:120079206-120079228 AAGAAAAGAAAGAAGGAAGGAGG - Intergenic
1031428208 7:121633795-121633817 AACAGAAATCAGGAGGAAAAGGG - Intergenic
1031448093 7:121879786-121879808 AAGGAAAAATAGAAGGAAGGAGG - Intronic
1031689879 7:124774322-124774344 AGCACAAAACAGAAGGTGGGAGG + Intergenic
1031773544 7:125877365-125877387 GAAAGAAAACAGAAGAAAGCAGG + Intergenic
1031843285 7:126773020-126773042 AACAGAAAATAGAAAGCAGTAGG + Intronic
1031868344 7:127064442-127064464 AATAGAAAACAGAAAAAAGCAGG - Intronic
1031965121 7:128022217-128022239 AAAAAAAAAAAGAAGGTAGGAGG + Intronic
1032131642 7:129233996-129234018 AAAAGAAAGGAGGAGGAAGGGGG - Intronic
1032256127 7:130298364-130298386 TACAGAAAACAGATACAAGGGGG + Intronic
1032374767 7:131401569-131401591 AACAGAAAAAAGAAAGAAGCAGG - Intronic
1032509155 7:132458172-132458194 ACCAGAAAATAGCAGGAATGGGG - Intronic
1032673734 7:134109142-134109164 AACAGAAAGCAGCAGAAATGGGG - Intergenic
1032760268 7:134933998-134934020 AACAGAAAATAGAAGGGAAATGG + Exonic
1032970532 7:137158179-137158201 AACAGTAAACAAAATAAAGGAGG - Intergenic
1033095485 7:138426950-138426972 AAAAAAAAAAAGAAGCAAGGAGG - Intergenic
1033124745 7:138697810-138697832 AAGAGAGAAGAGAAGGAAGAAGG + Intronic
1033179359 7:139160245-139160267 AATAGAAAAGGGAAGAAAGGAGG + Intronic
1033324682 7:140367812-140367834 AAAAAAAAAAAAAAGGAAGGTGG - Intronic
1033606880 7:142933926-142933948 AAAAGAAAAGGGATGGAAGGTGG + Intergenic
1033641364 7:143265230-143265252 AAGAGAAGACAGCAGGAAGGCGG - Exonic
1033716251 7:144005657-144005679 AAAAGAAAAGAGAAGTAATGAGG - Intergenic
1033889586 7:145994842-145994864 AAAAGAAGAAAGAAGGAAGAAGG - Intergenic
1034044294 7:147911633-147911655 GACAGAAAATAGAACGATGGTGG - Intronic
1034047510 7:147945829-147945851 AAAAGAAAAGAGAAGTAAGTGGG - Intronic
1034328708 7:150263086-150263108 TAGAGAAAACAGTAGGAAGTCGG + Intronic
1034366488 7:150553466-150553488 AATAGAAAACAGAAAAAAGGAGG + Intergenic
1034406944 7:150910782-150910804 AGCAGAAACCAGAAGGGATGAGG + Intergenic
1034534272 7:151717257-151717279 AAAAAAAAAAAGAAGGAAAGAGG + Intronic
1034652721 7:152704636-152704658 TACTGAAACTAGAAGGAAGGGGG - Intergenic
1034764508 7:153706299-153706321 TAGAGAAAACAGTAGGAAGTCGG - Intergenic
1035114705 7:156514953-156514975 AAAAGCACACTGAAGGAAGGAGG - Intergenic
1035123322 7:156587967-156587989 AACAGAATACCAAAGGAAGCAGG - Intergenic
1035689965 8:1553568-1553590 AAAAGAACACAGAGGGGAGGGGG + Intronic
1035939835 8:3886786-3886808 CAAAGATTACAGAAGGAAGGAGG + Intronic
1036062125 8:5335183-5335205 CACAGAAAACAGAAGATACGAGG - Intergenic
1036138193 8:6181327-6181349 AACAGGACACAGAAAGAAAGCGG + Intergenic
1036282771 8:7415781-7415803 AACAGTATAATGAAGGAAGGCGG - Intronic
1036338695 8:7895746-7895768 AACAGTATAATGAAGGAAGGCGG + Intronic
1036469764 8:9042179-9042201 CACAGAAAAGAGAAGGAACTTGG + Intronic
1036761992 8:11515588-11515610 TAAAGAAAATGGAAGGAAGGGGG - Intronic
1036792680 8:11732485-11732507 AAAACAAAACAGAAGGAGAGAGG + Intronic
1037134774 8:15446896-15446918 AACAGAAAAAAAAACAAAGGAGG + Intronic
1037323148 8:17662854-17662876 AAAAGAAAAAGGAAGAAAGGAGG + Intronic
1037380466 8:18280064-18280086 AACATCAAACAGAAGAAAGTAGG + Intergenic
1037458573 8:19086360-19086382 AAAGGAAGAAAGAAGGAAGGAGG + Intergenic
1037774376 8:21823273-21823295 GAAAGAAGAGAGAAGGAAGGAGG - Intergenic
1038390012 8:27188375-27188397 TATAGAAAACAGTAGTAAGGAGG + Intergenic
1038672482 8:29593391-29593413 AAAAGAATACAGAAGAAAAGAGG - Intergenic
1038738261 8:30192323-30192345 AAAAAAAAAAAAAAGGAAGGTGG - Intergenic
1038820893 8:30951100-30951122 AAAAGAAAGAGGAAGGAAGGAGG - Intergenic
1038957727 8:32485412-32485434 AGCAGAAAAGTGAAGAAAGGAGG - Intronic
1039255573 8:35715161-35715183 AACAAAAAAAAGAATGAAGTAGG + Intronic
1039557310 8:38485674-38485696 AACAGAAATCAGGAGGGTGGAGG + Intergenic
1039578307 8:38643476-38643498 AAAAGAAGAAGGAAGGAAGGAGG + Intergenic
1039588577 8:38728037-38728059 AACAAAAAACAGAGGGATGTGGG + Intergenic
1039867910 8:41521764-41521786 AATTGTAAAAAGAAGGAAGGAGG + Intergenic
1039931000 8:41989031-41989053 AATAGAAAACAGGAGGAAAGTGG + Intronic
1039963064 8:42264484-42264506 AACAGAAAACAGCAGAGAGATGG + Intergenic
1040013605 8:42682451-42682473 AAAAAAAAAAAAAAGGAAGGAGG + Intergenic
1040371987 8:46786118-46786140 AATAGAAAACAGAAAAAAGCAGG - Intergenic
1040413509 8:47178587-47178609 AAAAGAAAAGAGAGGGAAAGGGG - Intergenic
1040532070 8:48274279-48274301 ACCAGCACACAGCAGGAAGGAGG - Intergenic
1040627864 8:49172579-49172601 AAAAGGAAGCAGAAGGAAGCTGG - Intergenic
1040687157 8:49888111-49888133 AACAGTAAACAGAAGAGAGCTGG - Intergenic
1040720018 8:50308574-50308596 AAAAGAAAACAGAAGGAAGATGG - Intronic
1040740732 8:50571328-50571350 AAGAGAACACAGCAGGAATGTGG + Intronic
1040743540 8:50611366-50611388 GACAGAGAACAGAGGGTAGGAGG + Intronic
1040769073 8:50951023-50951045 GACAGAAAACAGAAGGAGGCAGG + Intergenic
1041337284 8:56800538-56800560 CATAGAATACAGAAGGAAAGGGG + Intergenic
1041360944 8:57053440-57053462 AAGAGAAACCAGAATGAAGAAGG - Intergenic
1041453371 8:58031841-58031863 GAGAGAAGAAAGAAGGAAGGAGG - Intronic
1041730619 8:61058723-61058745 AACAGAAAACAGATCAAAGAAGG - Intronic
1041732951 8:61081246-61081268 AAGAGAGAGCAGAAGGAATGAGG + Intronic
1041854921 8:62440672-62440694 AAGAAGAAAAAGAAGGAAGGAGG - Intronic
1042019131 8:64351407-64351429 AACAGATACCAGAAGGAATCAGG + Intergenic
1042068770 8:64907308-64907330 AAAAAAAAAAAAAAGGAAGGGGG - Intergenic
1042239045 8:66644200-66644222 ACCAAAAAACAGAAGAAAAGAGG + Intronic
1042349575 8:67763430-67763452 AAAAGAAAAAAGAAGGACAGAGG - Intergenic
1042563992 8:70094834-70094856 AAAAGAAAAAGGAAGGAAGGAGG + Intergenic
1042601735 8:70505667-70505689 AAGAAAAGAAAGAAGGAAGGAGG - Intergenic
1042770613 8:72376771-72376793 AAAAGAAAACAAAAGTAAGCAGG + Intergenic
1042832319 8:73044727-73044749 AACAGAAAGTAGAATGATGGTGG - Intronic
1043623207 8:82223743-82223765 AAAAGAAAAGAGAAAGGAGGAGG + Intergenic
1043657131 8:82682240-82682262 AACAGAAAACAGAAACAAACAGG - Intergenic
1043674080 8:82927449-82927471 AAAGAAAAACAGAAGGAAGGAGG + Intergenic
1044099760 8:88120187-88120209 AAAAGAAAACAGAAGGAAGGAGG + Intronic
1044815094 8:96103677-96103699 AAGAGCAAACAGAATGAATGAGG + Intergenic
1044867377 8:96585520-96585542 AAGAGAAATGAGAAGGATGGGGG + Intronic
1044905940 8:97003085-97003107 AATAGGAAACAGAAAGAAGCAGG - Intronic
1044983710 8:97740121-97740143 AAAAGAAAAAAAAAGGCAGGGGG - Intergenic
1045176740 8:99733251-99733273 AACAGCAAACAGAAGGAAAGAGG + Intronic
1045221222 8:100202264-100202286 AACAGAAAACAAAACTAAGTTGG - Intronic
1045316664 8:101049305-101049327 AAAAAGAAAGAGAAGGAAGGAGG - Intergenic
1045466539 8:102475710-102475732 AAAAAAAAAAGGAAGGAAGGAGG - Intergenic
1045522958 8:102919363-102919385 GAAACAAATCAGAAGGAAGGGGG - Intronic
1045533505 8:103005822-103005844 ATCAGGAAAAAGAAGGAATGGGG + Intergenic
1045695308 8:104802416-104802438 AACAGAGAACAGTAGGTTGGCGG + Intronic
1045813217 8:106248494-106248516 AACAGTAAAGAGAAGAAAGCTGG + Intergenic
1046129658 8:109951491-109951513 ACTAGAGAGCAGAAGGAAGGAGG - Intergenic
1046326354 8:112652315-112652337 AATTGAAACCTGAAGGAAGGGGG - Intronic
1046412944 8:113872416-113872438 AAAAGAAAAGAGAAGGAGTGGGG - Intergenic
1046420613 8:113979093-113979115 GAAAGTAAACAGAAGGAAGTAGG - Intergenic
1046475268 8:114733985-114734007 AACAGAAAACAGAAAAAAGAAGG + Intergenic
1046476106 8:114745904-114745926 AACAGAGGAAGGAAGGAAGGAGG + Intergenic
1046579347 8:116072353-116072375 AAAAGAAAAAAGAAAAAAGGGGG + Intergenic
1046723332 8:117647412-117647434 AACAGAAAAGAGAAAAAAAGTGG - Intergenic
1046857372 8:119048660-119048682 AACAGAAAACAGAAAAGAGCAGG - Intronic
1047050643 8:121107970-121107992 TACAGAGATCAGAAGGAAGGGGG - Intergenic
1047294769 8:123560919-123560941 AACAGAAAACATAAAACAGGTGG - Intergenic
1047696295 8:127406584-127406606 AACAGAAGACTGAAGGGAGTAGG - Intergenic
1047894111 8:129345811-129345833 AAAAGAAAACAGAATTAAGGGGG + Intergenic
1048407552 8:134138728-134138750 AATGGGAAACTGAAGGAAGGAGG - Intergenic
1048438317 8:134438958-134438980 AACAGGAAGGAGAAGGAAGTGGG - Intergenic
1048706778 8:137162501-137162523 CACTGAAAACTGAAGGAAAGTGG + Intergenic
1048780692 8:137996792-137996814 AACAGAAAACAAAAAAAAGCAGG - Intergenic
1049429581 8:142553915-142553937 AACACAAAGAAGAAGGAAGGAGG - Intergenic
1050162854 9:2736075-2736097 AAAAGAAAAAAAAAAGAAGGAGG - Intronic
1050401849 9:5264365-5264387 AACAGAAACCAAAAGCAAGCAGG - Intergenic
1050425081 9:5504329-5504351 AATAGAAAACAGAAAAAAGCAGG + Intergenic
1050429559 9:5548803-5548825 CAAAGAAAACAGAGGAAAGGAGG + Intronic
1050474494 9:6025899-6025921 AACCTAAAACAGACGGAAGACGG - Intergenic
1050722945 9:8611751-8611773 AAGAGAAAAGAAAAGAAAGGAGG + Intronic
1050891383 9:10828937-10828959 AATAGAAAACATAAAGAAGCAGG - Intergenic
1050911249 9:11074141-11074163 AACTGAAACCACAAGGAAAGGGG + Intergenic
1050957443 9:11682443-11682465 GAAAGAAAAAAGAAGGAAGGAGG + Intergenic
1050963213 9:11764895-11764917 AATAGAGAGCAGAAGGATGGAGG + Intergenic
1050984711 9:12067620-12067642 CACAGAAAAGAGAAAGAAGATGG + Intergenic
1051066014 9:13103995-13104017 AAGAGAAAATGGAAGGAGGGAGG - Intergenic
1051381410 9:16462792-16462814 AACAAAGAACAGAAAGAGGGAGG - Intronic
1051555552 9:18378659-18378681 GCCAGAAAAGAGAAGGAAGAAGG - Intergenic
1051745827 9:20293745-20293767 AACAGAAAATAGAAGGGTTGGGG - Intergenic
1051847071 9:21463962-21463984 AACAGAAAACAGAAAAAAGCAGG - Intergenic
1052216985 9:25978691-25978713 AAGAGAAAAGAGAAAGAATGGGG - Intergenic
1052285746 9:26783414-26783436 AACGGAAAACAGAAACAAGTTGG - Intergenic
1052299687 9:26939721-26939743 AACAGCAAACAAAAGAAAGCAGG + Intronic
1052330505 9:27262589-27262611 ATGAGAAAACAGAGGGTAGGAGG + Intergenic
1052448323 9:28592247-28592269 AACACATAAAAGAAGGAAGCTGG + Intronic
1052551115 9:29950693-29950715 AACAGAAAACAGAAAAAAAGAGG - Intergenic
1052703223 9:31962477-31962499 AATAGAAAACAGAAAAAAGTAGG + Intergenic
1053480879 9:38415403-38415425 GACAGAAGGCAGGAGGAAGGAGG + Intronic
1053570509 9:39300501-39300523 AACAGAAGAGAGAAAGAAGGAGG + Intergenic
1053946356 9:43312877-43312899 AAGTGAGAAAAGAAGGAAGGAGG + Intergenic
1054092129 9:60859518-60859540 AACAGAAGAGAGAAAGAAGGAGG + Intergenic
1054113542 9:61135111-61135133 AACAGAAGAGAGAAAGAAGGAGG + Intergenic
1054704230 9:68446484-68446506 AACAGAACACAGAAAGAAATAGG - Intronic
1054980710 9:71202544-71202566 AACATAAACCAAAAGGCAGGAGG - Intronic
1055018560 9:71645126-71645148 AAAAGGAAAATGAAGGAAGGAGG - Intergenic
1055274092 9:74594797-74594819 AAGAGAAAAAGGAAGGAAAGAGG + Intronic
1055285574 9:74724928-74724950 AACAGCATAGGGAAGGAAGGGGG - Intronic
1055304315 9:74913081-74913103 AACAGAAACCAAAAGCAAGCAGG + Intergenic
1055356994 9:75447940-75447962 AGCAGAGAAGAGAAGGAGGGAGG - Intergenic
1055372355 9:75613621-75613643 AAAAGAAAACAGAAGGAAAATGG - Intergenic
1055405044 9:75965526-75965548 AACAAAAAGCAGAAGAAGGGAGG - Intronic
1055542433 9:77325548-77325570 AAGAGAAAACAAAGGGAAGATGG - Intronic
1055657384 9:78464917-78464939 AGCAGAGGACAGAAGTAAGGAGG - Intergenic
1055810931 9:80146880-80146902 TTCAGAAGGCAGAAGGAAGGGGG + Intergenic
1055997687 9:82179254-82179276 AAAAAAAAAAAGAAAGAAGGAGG - Intergenic
1056094611 9:83240005-83240027 GCCAAAAAACAGAAGGGAGGGGG - Intergenic
1056241751 9:84654741-84654763 AAGAGGAAACAGAAGGCAGGAGG + Intergenic
1056485225 9:87049870-87049892 ACCAGAAAGCAGAGGGAGGGAGG - Intergenic
1056695849 9:88851389-88851411 AAGAGAACACAGCAAGAAGGTGG + Intergenic
1056818313 9:89817661-89817683 ATGTGGAAACAGAAGGAAGGAGG + Intergenic
1056912164 9:90711377-90711399 AAAAAAAAAAAAAAGGAAGGAGG + Intergenic
1057043302 9:91863535-91863557 AACAAAAAACAAAAGAAACGTGG + Intronic
1057353825 9:94319728-94319750 ACCTGGAAACAGAAGGAAGAAGG + Exonic
1057506821 9:95641024-95641046 AACAGAAAATTCAAAGAAGGGGG + Intergenic
1057653926 9:96937864-96937886 ACCTGGAAACAGAAGGAAGAAGG - Exonic
1057778519 9:98030164-98030186 AAAAGGAAAAAGAAGAAAGGTGG + Intergenic
1058007908 9:99939154-99939176 AATAGAAAAGAGAGGGAATGAGG + Intronic
1058067606 9:100566689-100566711 AAAAGAAAAAAGAAAAAAGGCGG - Intronic
1058180578 9:101793221-101793243 AACAGAAAAGAGAATAAATGTGG + Intergenic
1058215684 9:102230694-102230716 GACAGAAACTGGAAGGAAGGTGG - Intergenic
1058244004 9:102602497-102602519 AATAGAAAACAGAAAAAAGCAGG - Intergenic
1058317123 9:103581983-103582005 AAAAGAAAACAGAAAGATGTGGG - Intergenic
1058461308 9:105186540-105186562 AACAGAAAACAGAAAAAGGCAGG - Intergenic
1058655416 9:107216174-107216196 AAAAAAAAAAAAAAGGAAGGGGG + Intergenic
1058826610 9:108781126-108781148 AAAAGACAACAGAAGGCAAGAGG + Intergenic
1058894439 9:109387355-109387377 AACAGATAACAAGAGCAAGGGGG + Intronic
1058914854 9:109555838-109555860 AAGGGATAAAAGAAGGAAGGGGG + Intergenic
1059096955 9:111427181-111427203 AAAAGAAAACAGACTGAATGTGG + Intronic
1059098024 9:111439894-111439916 CACAGCAAGGAGAAGGAAGGAGG + Intronic
1059138118 9:111826814-111826836 AACAGAAAACACAAATTAGGTGG + Intergenic
1059265475 9:113024775-113024797 GACAGAAAACTCAGGGAAGGAGG + Intergenic
1059312082 9:113395559-113395581 GACACAAGACAGAAGGAAGCTGG + Intronic
1059684763 9:116624491-116624513 ATGAGAATACAGAAGGAAGGGGG + Intronic
1059909175 9:119023408-119023430 AACAAAAAACAAAAAAAAGGTGG - Intergenic
1060746859 9:126142340-126142362 AATTGAACACAGAAGGAAAGAGG - Intergenic
1061297779 9:129686341-129686363 AAAACAAAACAAAAGTAAGGAGG - Intronic
1061578877 9:131524535-131524557 AACAGAAAACAGAAAACATGAGG + Exonic
1061739098 9:132686458-132686480 AGCAGAAAACACAAAGGAGGAGG - Intronic
1062050604 9:134444634-134444656 AAGAGAAGAGGGAAGGAAGGAGG - Intergenic
1062585640 9:137248245-137248267 ACCATAAAAATGAAGGAAGGCGG + Intergenic
1203589486 Un_KI270747v1:41435-41457 AAGTGAGAAAAGAAGGAAGGAGG + Intergenic
1185524953 X:770422-770444 AAAAGAAGAAAGAAGAAAGGAGG + Intergenic
1185545400 X:939789-939811 AAGAGAAAAGAGGAGGAGGGGGG - Intergenic
1185610977 X:1393365-1393387 AAAGGAAAAGAGAGGGAAGGAGG - Intergenic
1185634828 X:1543934-1543956 AAAAAAAAAGAAAAGGAAGGAGG + Intergenic
1185726529 X:2426387-2426409 AAGGAAAAAGAGAAGGAAGGAGG - Intronic
1185766839 X:2732498-2732520 AAGAGAGAAAAGAAGGAGGGAGG - Intronic
1185943571 X:4348774-4348796 AAGGGAAAAGAGAAGGGAGGTGG - Intergenic
1186019128 X:5234809-5234831 AACAAAGAAAGGAAGGAAGGAGG - Intergenic
1186025433 X:5305787-5305809 AACAGATTACGGAAGGAAGGAGG - Intergenic
1186095250 X:6094300-6094322 AACAGAAAGTAGAAGGAAGAAGG + Intronic
1186155727 X:6724509-6724531 AAAAAAAAAAAAAAGGAAGGAGG + Intergenic
1186323419 X:8453566-8453588 AAAAAAAAAGAGAAGGAAGAAGG + Intergenic
1186349630 X:8729379-8729401 AAAAAAAAAAGGAAGGAAGGTGG - Intronic
1186643782 X:11484502-11484524 AAGAGAAAAAAGGAAGAAGGAGG + Intronic
1186679728 X:11859711-11859733 AACAAAAAACAGAAGCAGGATGG - Intergenic
1186707576 X:12158006-12158028 AATAAAAATCAGAAGAAAGGAGG + Intronic
1186732510 X:12425208-12425230 AAGACTAAACAGGAGGAAGGTGG - Intronic
1186948829 X:14599245-14599267 AACAAAAATCAAAAGGAAGAGGG + Intronic
1187046461 X:15651858-15651880 AACAGAAAAGAGAGGCAGGGAGG + Intronic
1187179508 X:16930386-16930408 AAAAGAAAATAGATGGAACGTGG + Intergenic
1187370883 X:18705103-18705125 AAAAGAAGAGAGAGGGAAGGAGG - Intronic
1187488761 X:19729757-19729779 AACAGAGGAAAGAAGGAAGAAGG + Intronic
1187587873 X:20683986-20684008 ATAAGAAAAAAGAAAGAAGGAGG - Intergenic
1187718902 X:22131531-22131553 AACAAACAGCAGATGGAAGGGGG - Intronic
1187722590 X:22166803-22166825 AACAGAGTACAGTAGGATGGTGG - Intronic
1187818379 X:23257880-23257902 AATAGAAAACAGAAAAAAGCAGG + Intergenic
1187912104 X:24120559-24120581 AAGGAAAAAAAGAAGGAAGGAGG - Intergenic
1188220047 X:27530360-27530382 TATAGAAAACAGAAGAATGGCGG - Intergenic
1188371666 X:29377178-29377200 AACAGAAAACAAAAGACAGTGGG - Intronic
1188483984 X:30662491-30662513 CACAGAAAACAGAAGGATTTTGG - Intronic
1188708038 X:33359475-33359497 AATAGAAAACAGAAAAAAGCAGG + Intergenic
1188839190 X:34994209-34994231 AAAAGAAAGGAGAAAGAAGGTGG - Intergenic
1188843102 X:35039608-35039630 AACAGAAAACAGAAAAAAGGAGG + Intergenic
1188896276 X:35672275-35672297 AAGATAAAGAAGAAGGAAGGTGG - Intergenic
1188921322 X:35981470-35981492 AACAGGAAACATAAGAAAGCTGG + Intronic
1188938772 X:36211404-36211426 AACAGAAAAAAGGCCGAAGGAGG - Intergenic
1188971039 X:36615420-36615442 AACAGAAAACAAAAGAAAACAGG + Intergenic
1189021342 X:37344896-37344918 AAAAAAGAACAAAAGGAAGGAGG - Intergenic
1189115531 X:38338578-38338600 AACAAACAAAAAAAGGAAGGGGG - Intronic
1189262023 X:39686180-39686202 AAGAAAAAAAAGAAGGAAGGAGG + Intergenic
1189564413 X:42226238-42226260 AACAGAAACCAAAAGCAAGCAGG - Intergenic
1189774109 X:44454972-44454994 AAAAGAAAACAGAAAAAAGCTGG - Intergenic
1189906416 X:45764836-45764858 AAATGAAAACAGTAGGAAGTAGG + Intergenic
1190172184 X:48120595-48120617 AACAGGAAACAGAGTGAGGGGGG - Intergenic
1190180340 X:48186289-48186311 AACAGGAAACAGAGTGAGGGGGG + Exonic
1190183802 X:48217919-48217941 AACAGGAAACAGAGTGAGGGGGG - Intronic
1190189719 X:48267352-48267374 AACAGGAAACAGAGTGAGGGGGG - Exonic
1190193346 X:48295519-48295541 AACAGGAAACAGAGTGAGGGGGG + Intergenic
1190204644 X:48393251-48393273 AACAGGAAACAGAGTGAGGGGGG - Exonic
1190205892 X:48402152-48402174 AACAGGAAACAGAGTGAGGGGGG + Exonic
1190210479 X:48442884-48442906 AACAGGAAACAGAGTGAGGGGGG - Intergenic
1190241947 X:48663783-48663805 AAAAAAAAAAAGAAGGAAGGAGG - Intergenic
1190325311 X:49203744-49203766 TGCTGAAAACAGAAGGGAGGGGG - Intergenic
1190446568 X:50531402-50531424 AAAAGAGAAGAGAAGGAAAGAGG - Intergenic
1190584334 X:51922899-51922921 AACATGAAAGAGGAGGAAGGAGG + Intergenic
1190658476 X:52633856-52633878 AACAGGAAACAGAGTGAGGGGGG - Intergenic
1190659849 X:52644130-52644152 AACAGGAAACAAATTGAAGGGGG + Exonic
1190676880 X:52790214-52790236 AACAGGAAACAAATTGAAGGGGG - Intronic
1190962665 X:55267726-55267748 AATAGAAAAGATAAGAAAGGGGG - Intronic
1191101220 X:56730533-56730555 AAAAAAAAAAAAAAGGAAGGAGG + Intergenic
1191104196 X:56762261-56762283 AAAAGAAAAGAGAAAGAAAGAGG - Intergenic
1191131705 X:57020283-57020305 AACAGAAAACAGAAATAAGTCGG - Intergenic
1191137862 X:57085035-57085057 AATGGAAAACAGAAAGAAGCAGG + Intergenic
1191224525 X:58029402-58029424 AATGGAAAACAGAAAAAAGGAGG - Intergenic
1191612674 X:63133818-63133840 AAGAAAAAACAGGAGGAAGAAGG + Intergenic
1191623623 X:63245108-63245130 AAGAAAAAACAGGAGGAAGAAGG - Intergenic
1192474600 X:71429277-71429299 AAAAAAAAGCAGAAGGAAGCAGG + Intronic
1192531936 X:71895587-71895609 AAGAGAAAAGAAAAGGAAAGAGG + Intergenic
1192864334 X:75115381-75115403 GACAGAAACCAGAAAGAAAGGGG - Intronic
1192871921 X:75192783-75192805 AACAGAAAACAGAAGAAAGAAGG - Intergenic
1192898602 X:75471007-75471029 AACAGAAAACAGATGGATTTTGG + Intronic
1193035778 X:76949922-76949944 AACAGAACACAGAAAGCAGTAGG - Intergenic
1193085271 X:77443314-77443336 CAAAGAAAACAGAAGGAGAGAGG + Intergenic
1193173753 X:78367816-78367838 GACACAAAATAGAAGGAAGGCGG - Intergenic
1193425273 X:81334976-81334998 AACGGAAAACAGAAAAAAGAAGG - Intergenic
1193575440 X:83189987-83190009 AACAGAAAACAAAAGGGAGCAGG - Intergenic
1193647427 X:84086977-84086999 AATAGAAAACAGAAAAAAGCAGG - Intronic
1193789994 X:85806166-85806188 AATAGAAAACAGAAAAAAGCAGG - Intergenic
1193800213 X:85926211-85926233 AACACAATATGGAAGGAAGGGGG - Intronic
1193883607 X:86958322-86958344 AACAGAAAACAGAAAAAAGCAGG - Intergenic
1194026757 X:88762680-88762702 AACAGAAAACAGAAAAAAGCAGG - Intergenic
1194031531 X:88822631-88822653 AATAGAAAACAGAAAAAAGCAGG - Intergenic
1194668625 X:96703918-96703940 AAAAGAAAAGAAAAGGAGGGAGG - Intronic
1194838052 X:98706419-98706441 AACAGAAAACAAAATTAAGCAGG - Intergenic
1194970055 X:100333024-100333046 AAAAGAAAAGAAAAGAAAGGAGG + Intronic
1195029345 X:100911119-100911141 AACAGGAAAGAGAAAGAAGAAGG + Intergenic
1195142448 X:101976369-101976391 AACAGAAAACAAAAAAGAGGGGG - Intergenic
1195403705 X:104489813-104489835 AACAGAGAACAGGATGAAGAAGG + Intergenic
1195493604 X:105503457-105503479 AAGAGAAAAAAGAAGGAAGCTGG + Intronic
1195545765 X:106110741-106110763 AACAGAAAAAAGAGGAAAAGAGG - Intergenic
1195549781 X:106154385-106154407 AACAGTAATCAAAAGGAAGCTGG + Intergenic
1195678774 X:107527940-107527962 ATCAGAAATCAGAGGAAAGGGGG + Intronic
1195831304 X:109061773-109061795 AATAGAAAACAGAAAAAAGCAGG + Intergenic
1195834207 X:109094456-109094478 AACGGAAAACAGAACAAAGCAGG - Intergenic
1195977793 X:110546454-110546476 AAGAGGACACAGAAAGAAGGTGG + Intergenic
1196078119 X:111599883-111599905 AACAAAAAACAAAAAAAAGGGGG + Intergenic
1196123711 X:112077849-112077871 AATAGAAAAGATAAGGCAGGTGG - Intronic
1196176701 X:112646307-112646329 AACAGGCAATGGAAGGAAGGAGG + Intronic
1196234117 X:113259732-113259754 AACAGAAAACAGAGAAAAGCAGG - Intergenic
1196258628 X:113552310-113552332 AACAAAAAAAACAAGCAAGGTGG - Intergenic
1196279655 X:113809034-113809056 AACATAAAATTGAATGAAGGAGG - Intergenic
1196351086 X:114730740-114730762 AGCTGATAACAGAATGAAGGGGG - Intronic
1196623116 X:117846976-117846998 AAAAAAAAACAGAATGAATGAGG + Intergenic
1196818166 X:119681713-119681735 AACAGAAAACAGAAGTTATAGGG + Intronic
1196834495 X:119801932-119801954 GAAAGAAAAAAGAAAGAAGGAGG - Intergenic
1196991091 X:121329695-121329717 AACAAAAAAAAAAAGTAAGGGGG - Intergenic
1197094501 X:122576639-122576661 AACAGAAAACAAAAAAAAGCAGG + Intergenic
1197189570 X:123630903-123630925 AACAGAAAACTAAATGAAAGTGG - Intronic
1197209438 X:123816792-123816814 AAAAAAAAAAAGAAGGAAGTTGG + Intergenic
1197215722 X:123864980-123865002 AAAAAAAAAAAGAAGAAAGGCGG - Intronic
1197368620 X:125598959-125598981 AACAGAAAACATACAGAATGAGG - Intergenic
1197453851 X:126652446-126652468 AAAGGATAACATAAGGAAGGAGG - Intergenic
1197464465 X:126785564-126785586 AAAAAAAAATAGAAGGATGGTGG + Intergenic
1197685082 X:129430462-129430484 GGCAAGAAACAGAAGGAAGGGGG - Intergenic
1197848509 X:130831057-130831079 CACACAAAACAGAGGGAATGGGG + Intronic
1197950238 X:131887299-131887321 ATCAGAAAACAGTAGAAAGCTGG + Intergenic
1197979899 X:132206178-132206200 AAAAGAAAAGAGAAGAAAGAGGG + Intronic
1198021430 X:132662237-132662259 AACAGATGAGGGAAGGAAGGAGG + Intronic
1198080132 X:133231865-133231887 AAAAAAAAAGAGAAGGAGGGAGG + Intergenic
1198254017 X:134909268-134909290 AAAAGAAAAAAGAAAGAAAGAGG + Intronic
1198269472 X:135041701-135041723 AAGTGAGAAAAGAAGGAAGGAGG + Intergenic
1198314804 X:135454675-135454697 AAAAGAAAACAGAAAGTAGGGGG + Intergenic
1198537396 X:137600216-137600238 AACAAAACACAGAGGGAATGTGG + Intergenic
1198616648 X:138465175-138465197 AACAGACACCAAAAGCAAGGAGG + Intergenic
1198747872 X:139908282-139908304 AGCAGATAACTGAAGGAATGAGG - Intronic
1198759228 X:140013799-140013821 AATAGAAAACAAAAAGAAAGTGG + Intergenic
1198779511 X:140219778-140219800 AATAGAAAACAAAAAGAAAGTGG - Intergenic
1198864282 X:141105038-141105060 AAAAGAAAAAAGAAGGGAGGAGG - Intergenic
1198898407 X:141482378-141482400 AAAAGAAAAAAGAAGGGAGGAGG + Intergenic
1199403459 X:147427700-147427722 AAAAAAAAATAGAAGGAAAGAGG + Intergenic
1199418228 X:147611796-147611818 CACAGTAAGCAGAAAGAAGGTGG + Intergenic
1199639936 X:149850044-149850066 AACAGAAAAAAAAAGAAAGCAGG - Intergenic
1199881586 X:151977562-151977584 AACAGAATAATGAAGGCAGGAGG + Intergenic
1200053781 X:153447923-153447945 AAAAGAAACCAAAAGGATGGTGG + Intronic
1200129870 X:153835727-153835749 AACAGAAAATAAAACGAAAGAGG - Intergenic
1200179062 X:154139349-154139371 AACAGAAAAAGGAAGACAGGAGG - Intergenic
1200837976 Y:7751564-7751586 AACAAAAAACAGGATGAGGGAGG + Intergenic
1200867272 Y:8058354-8058376 AAAAGAAAACAGTACAAAGGTGG + Intergenic
1200882810 Y:8237040-8237062 AAAAAAAAAAATAAGGAAGGTGG + Intergenic
1201416704 Y:13754421-13754443 AAAAAAAAAAAGAAGGAAGATGG + Intergenic
1201772737 Y:17632326-17632348 AACAGTAAACTGATGTAAGGTGG - Intergenic
1201828818 Y:18273661-18273683 AACAGTAAACTGATGTAAGGTGG + Intergenic
1201933815 Y:19384587-19384609 AACGGAAAACAGAAGAAAGCGGG - Intergenic
1201934874 Y:19398634-19398656 AATAGAAAACAGAAAAAAGCAGG + Intergenic
1201956350 Y:19627965-19627987 AACGGAAAACAGAAAAAAGCAGG - Intergenic
1202097171 Y:21263810-21263832 AACATATAACAGAAGAAATGTGG - Intergenic