ID: 1170272829

View in Genome Browser
Species Human (GRCh38)
Location 20:14547726-14547748
Sequence CAACCAAGCTACAGGATCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170272829_1170272836 16 Left 1170272829 20:14547726-14547748 CCCATGATCCTGTAGCTTGGTTG No data
Right 1170272836 20:14547765-14547787 TCTCCTCGATTGTGTACCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170272829 Original CRISPR CAACCAAGCTACAGGATCAT GGG (reversed) Intronic