ID: 1170272830

View in Genome Browser
Species Human (GRCh38)
Location 20:14547727-14547749
Sequence CCAACCAAGCTACAGGATCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 123}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170272830_1170272836 15 Left 1170272830 20:14547727-14547749 CCATGATCCTGTAGCTTGGTTGG 0: 1
1: 0
2: 0
3: 7
4: 123
Right 1170272836 20:14547765-14547787 TCTCCTCGATTGTGTACCTGAGG 0: 1
1: 0
2: 0
3: 2
4: 70

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170272830 Original CRISPR CCAACCAAGCTACAGGATCA TGG (reversed) Intronic
901198666 1:7454414-7454436 CCAACAAACCTGCAAGATCAGGG + Intronic
901315050 1:8301373-8301395 CCCACCCAGCTACAGGATATTGG - Intergenic
905802828 1:40856329-40856351 CCAGACCAGCTACAGGATAAGGG + Intergenic
913153665 1:116071931-116071953 TCAACCTCACTACAGGATCAGGG + Intergenic
916118281 1:161506485-161506507 GCAGCCCAGCTACAGGTTCAAGG + Exonic
916128203 1:161589713-161589735 GCAGCCCAGCTACAGGTTCAAGG + Intronic
916138120 1:161671543-161671565 GCAGCCCAGCTACAGGTTCAAGG + Exonic
919699606 1:200618459-200618481 CCAATCTACCTACAGGATTAGGG + Exonic
921703640 1:218294812-218294834 CCAAGGCAGCTTCAGGATCAGGG - Intronic
922754612 1:228088747-228088769 ACAACCACGCTAGAGGACCAAGG - Intronic
923791235 1:237112877-237112899 ACAACCGAGATACAGGATTAAGG - Intronic
1063880656 10:10528363-10528385 GCAACCAGCCTACAGGGTCATGG - Intergenic
1065670528 10:28111940-28111962 CCATCCAAGCTACAGAATAGTGG + Intronic
1069595155 10:69665465-69665487 CCAATCAAACTACAGCATCCTGG - Intergenic
1071430102 10:85600731-85600753 GCAACTAAACTACAGAATCAGGG - Exonic
1072353233 10:94578641-94578663 CCAACCAAGCGGCATGATCTCGG - Intronic
1074619529 10:115105117-115105139 CAAACCAATCTACAGATTCAAGG - Intronic
1075290292 10:121223903-121223925 CCACCTTAGCTACATGATCAAGG + Intergenic
1075594516 10:123718702-123718724 CCAGCCAAGCCACAAAATCATGG - Intronic
1078496155 11:11819034-11819056 CCAACCAAGTTACCTGATCTAGG + Intergenic
1078926324 11:15878800-15878822 CTAGCCAAGCTACAGACTCAGGG - Intergenic
1079302259 11:19288431-19288453 CCAGCTAAGCTGCCGGATCAGGG - Intergenic
1079536730 11:21523983-21524005 CCAACCAAGGTATAGTAGCAGGG - Intronic
1081878930 11:46431173-46431195 TCACCCAAGAGACAGGATCAAGG - Intronic
1083483545 11:62966312-62966334 CCAACCAAGATGGAGGAACAGGG + Intronic
1085147223 11:74212372-74212394 CCACCCAAGCTAAAGGGTCCTGG + Intronic
1088537535 11:110877319-110877341 CCAACCAAGATCCAGGAAGAGGG - Intergenic
1089605363 11:119638404-119638426 CCAGCAAAGCTAAAGGCTCAGGG - Intronic
1097635194 12:62113842-62113864 CCAACCAAGCTCGAGCATCCAGG + Intronic
1097943547 12:65340002-65340024 CATACCAAAGTACAGGATCAAGG + Intronic
1098856563 12:75659285-75659307 CCAACCCAGCTAAAGAATCAAGG + Intergenic
1100029009 12:90163337-90163359 CCAAACAGGCTACAGCAGCAGGG - Intergenic
1101156047 12:101928758-101928780 ACCACCAAGCTACAAGGTCAGGG - Intronic
1103835495 12:123816682-123816704 CCAACCTGGCTACAAAATCAGGG - Intronic
1109840227 13:67909883-67909905 CCAAGCAAGATACAGGCTCTGGG - Intergenic
1111796850 13:92932422-92932444 CAAAACAAGATACAGGATGAAGG + Intergenic
1112432252 13:99360216-99360238 CCAACTAGACTACAGGATCCTGG - Intronic
1112663002 13:101534995-101535017 CAAACAAAGCTACAGAATGAAGG - Intronic
1118721825 14:68599909-68599931 CCAACCACTCTGCAGGACCAGGG - Intronic
1119009032 14:70964427-70964449 CCAACAAAAAAACAGGATCAAGG - Intronic
1119062046 14:71485049-71485071 CCAAAATAGCTAAAGGATCATGG - Intronic
1119682683 14:76604723-76604745 CCAAACCAGCTGCAGGACCATGG - Intergenic
1123449848 15:20352678-20352700 CCCACCAAGCTCCAGCATCCTGG - Intergenic
1130157854 15:81368608-81368630 CCAGCCAAGCACCAGAATCAGGG - Intronic
1140622437 16:76751692-76751714 CCATCCAGGCTACTGCATCAGGG + Intergenic
1141812186 16:86383063-86383085 CAGACCAAGCTACAGAAGCATGG - Intergenic
1145846516 17:28042726-28042748 CCAAACAAGTTAGAGGATCTTGG - Exonic
1146397450 17:32480071-32480093 CCAACAAAGCTACTGTGTCAGGG + Intronic
1146688156 17:34855644-34855666 TCACCCAAGCCAAAGGATCAAGG + Intergenic
1147916543 17:43890935-43890957 CCAACCAACCCACAAAATCAGGG + Intronic
1151898691 17:76997398-76997420 CCAAGCAAGCCAGAGGAACAAGG + Intergenic
1152338791 17:79713212-79713234 CCCACCAAGCTCCAGCATCCTGG + Intergenic
1157145958 18:45162774-45162796 CCAGCTGTGCTACAGGATCAGGG + Intergenic
1157743246 18:50112282-50112304 CCAACAAAGCAACTGCATCACGG + Intronic
1162228968 19:9249259-9249281 CCAAGCAAGATACAGGCTCTGGG - Intergenic
1164588131 19:29490399-29490421 CCAAGGAGGCTACAGGACCAGGG - Intergenic
1165180487 19:33963255-33963277 CCAACCAAGCTCAGGGGTCAAGG + Intergenic
1167513101 19:49907213-49907235 CCACCCAAGGTACAGGCTCAGGG + Intronic
1168042774 19:53771293-53771315 CCAAGCAAGATACAGGCTCTGGG + Intergenic
1168700398 19:58435386-58435408 CCAGCCAAGCAACAGAATAAGGG + Intronic
931457785 2:62425720-62425742 CCCTCCAACCCACAGGATCATGG - Intergenic
934726914 2:96627813-96627835 CCAAACAGGCTACAGATTCAGGG + Intronic
934899822 2:98150585-98150607 ACCACCAAGCCACAGAATCAAGG - Intronic
943126739 2:183803793-183803815 CCAACCTAGATACAGGCTCTAGG - Intergenic
947000121 2:225444753-225444775 CCAACCAGGCTAAAATATCATGG + Intronic
947080198 2:226387568-226387590 CCAAACAAGCCACATGGTCAAGG - Intergenic
948268609 2:236656906-236656928 CCAACCCTCCCACAGGATCAGGG - Intergenic
1170272830 20:14547727-14547749 CCAACCAAGCTACAGGATCATGG - Intronic
1170318688 20:15070048-15070070 CCTACAAAGCTACAGGGGCAGGG + Intronic
1170416477 20:16148151-16148173 CCAGCCAAGCCACAGAATTATGG + Intergenic
1173065377 20:39705611-39705633 CCATCCAATCTACAGGATGTAGG + Intergenic
1181075180 22:20371273-20371295 CCAACCTAGCTCCAGGTTTATGG - Intronic
1181560563 22:23697277-23697299 CCTCCCAAGCTTCAGGATCTTGG - Intronic
950965300 3:17141806-17141828 ACTACCAAGCTGCAGGGTCATGG - Intergenic
953571726 3:44076576-44076598 GCAACCAAGCTGCAGGGTGAGGG + Intergenic
954776770 3:53026547-53026569 CCTACCAAGCTGCATGTTCATGG + Intronic
957117783 3:76049046-76049068 CCACACAAGATACAGGATAATGG + Intronic
957650149 3:82991153-82991175 CCAACTAGGCTTCAGGATAAAGG - Intergenic
961489213 3:127240898-127240920 CCTACATAGCTTCAGGATCAGGG - Intergenic
962854551 3:139332019-139332041 CCAACCAAGATAGAGGAACAGGG + Intronic
963795089 3:149623931-149623953 CCAGCCAGGCTACAGGGTTAAGG + Intronic
964110918 3:153086693-153086715 CCACCCAAGCCACAGAATGAGGG - Intergenic
972035794 4:34518920-34518942 CCAACCAAGTTATAAGTTCATGG + Intergenic
977335488 4:95693296-95693318 CCAATCAAACCACAGAATCATGG + Intergenic
981286150 4:143021128-143021150 AGAACCAAGCTACAGGAAAAAGG + Intergenic
984606893 4:181796122-181796144 GCAACCAAGGTACAGAATCAAGG + Intergenic
986293016 5:6415501-6415523 GCAACAAAGCTACAGGATAGTGG + Intergenic
988635501 5:32978996-32979018 CCCACAAAGCTACAGCAACAGGG + Intergenic
999142785 5:149373722-149373744 GCAACCAAGCTACATTAACATGG + Intronic
1001435519 5:171696289-171696311 GCAACCAGTCTACAGGAGCAAGG - Intergenic
1003202720 6:3977031-3977053 CAAGCCAAGCTTCAGGATGATGG + Intergenic
1004638447 6:17490838-17490860 CCAACCACTATAAAGGATCATGG + Intronic
1005256817 6:24012108-24012130 CCACCAAATCAACAGGATCATGG + Intergenic
1005445244 6:25915957-25915979 CCAAACAACCCACAGTATCATGG - Intronic
1006067183 6:31470542-31470564 ACAACAAAGCAACAGGATCCTGG + Intergenic
1006106140 6:31718093-31718115 TCAACCCAGCAACAGGATCCAGG - Intergenic
1008051086 6:46901146-46901168 ACAAAAAAGCTACAGGATGAAGG - Intronic
1011497067 6:87947371-87947393 CCAACTAATCTACAGGAACCAGG + Intergenic
1012681092 6:102181276-102181298 GCAACCAAGCAACAGGATTTAGG + Intergenic
1012752709 6:103183948-103183970 CCAACCTTGGTACAAGATCAGGG - Intergenic
1021167013 7:17354293-17354315 CCAACCAAGCTCAAGCATCCTGG + Intergenic
1021568511 7:22038949-22038971 CCAGGCAACCTACAGAATCAGGG + Intergenic
1021745448 7:23736453-23736475 TCATCCAAGATACAGCATCATGG - Intronic
1027455329 7:78384159-78384181 CAAACCAATCTACAGATTCAGGG - Intronic
1027817905 7:83001623-83001645 CCAGCTAACCTACAGGGTCATGG - Intronic
1033364372 7:140660218-140660240 TGACTCAAGCTACAGGATCATGG + Intronic
1038211577 8:25523332-25523354 CCCACCAAGCTACAGCATCCCGG - Intergenic
1040968806 8:53112332-53112354 CCAACCAAGCTCAAGCATCCCGG + Intergenic
1046062313 8:109154146-109154168 CCAACCAAGCTACAGGAGTGGGG - Intergenic
1046902278 8:119536284-119536306 CCCACTAAGCTACAGTAACATGG - Intergenic
1050018910 9:1263710-1263732 CCCACCAACCTACAGAACCAGGG - Intergenic
1054791789 9:69263565-69263587 CCAACCAAGTTACAGAACTAAGG - Intergenic
1055587717 9:77772637-77772659 CCAACCAAACTCCTGGTTCAAGG + Intronic
1057969930 9:99545183-99545205 CCAGCAAAGCTACAGGGGCAGGG - Intergenic
1061759122 9:132837744-132837766 CCAACCACGCCTCAGCATCAGGG + Intronic
1062239976 9:135531848-135531870 CCCACCAAGATACAGAATCAGGG + Intergenic
1062239981 9:135531881-135531903 CCCACCAAGATACAAAATCAGGG + Intergenic
1062240026 9:135532229-135532251 CCCACCAAGATACATAATCAGGG + Intergenic
1062240073 9:135532574-135532596 CCCACCAAGATACACAATCAGGG + Intergenic
1062240094 9:135532733-135532755 CCCACCAAGATACATAATCAGGG + Intergenic
1062240112 9:135532856-135532878 CCCACCAAGATACATAATCAGGG + Intergenic
1062240129 9:135532982-135533004 CCCACCAAGATACATAATCAGGG + Intergenic
1188634503 X:32412104-32412126 CAAACAAAACTATAGGATCAGGG + Intronic
1191072026 X:56410874-56410896 CCTACCAAGCTAGAGCATCCAGG + Intergenic
1192189304 X:68981047-68981069 CCACCCAAACTCCAGGAGCAGGG + Intergenic
1192934648 X:75846967-75846989 CAAACTAAGCTACAAAATCAAGG - Intergenic
1194189862 X:90821708-90821730 CCAACGAAGCTAAGGGAGCAGGG + Intergenic
1196937204 X:120741862-120741884 CCAACAAAGCTACTGGAGCCAGG + Intergenic
1198606953 X:138350961-138350983 CCAACCAACCCACGGAATCATGG - Intergenic
1198741953 X:139851666-139851688 CCAACAAAGCCATAGGAGCAAGG + Intronic
1200536466 Y:4403820-4403842 CCAACGAAGCTAAGGGAGCAGGG + Intergenic