ID: 1170272833

View in Genome Browser
Species Human (GRCh38)
Location 20:14547734-14547756
Sequence GCTGAGCCCAACCAAGCTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 170}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170272833_1170272836 8 Left 1170272833 20:14547734-14547756 CCTGTAGCTTGGTTGGGCTCAGC 0: 1
1: 0
2: 1
3: 19
4: 170
Right 1170272836 20:14547765-14547787 TCTCCTCGATTGTGTACCTGAGG 0: 1
1: 0
2: 0
3: 2
4: 70

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170272833 Original CRISPR GCTGAGCCCAACCAAGCTAC AGG (reversed) Intronic
902045069 1:13518062-13518084 GCTCAGACCAACCAAGCTAGCGG - Intergenic
902401940 1:16162627-16162649 GCGGAACCCGCCCAAGCTACCGG - Intergenic
903352695 1:22727472-22727494 GCTGAGGCCCAGCAAGGTACTGG - Intronic
903919336 1:26788204-26788226 GCAGAGCCCCACCAGGCCACAGG - Exonic
904347731 1:29884263-29884285 GCTGAGCCCACCCATGCTGAGGG + Intergenic
904407910 1:30305695-30305717 GCCGAGCCCACCCAAGCTGAGGG + Intergenic
905802500 1:40854194-40854216 ACTGCGCCCAGCCAAGCTTCTGG - Intergenic
905870230 1:41399348-41399370 GCTGTGCCCAGCCAAGCTGCCGG - Intergenic
906217408 1:44051402-44051424 GCTGAGCACATCCAAGCTGGGGG + Intergenic
907592112 1:55685347-55685369 CCTTAGCCCAACTAAACTACTGG - Intergenic
908942744 1:69455210-69455232 GCTGAGCCCAGAAAAGCCACAGG + Intergenic
911059930 1:93738979-93739001 CCTGACCCCACCCAAGCAACTGG + Intronic
913265415 1:117038447-117038469 GCAGAGCCCAACGGAGCTGCAGG - Intergenic
917792200 1:178506084-178506106 GAGGAGCACAACCCAGCTACTGG - Intergenic
920129935 1:203724226-203724248 ACTGCGCCCAGCCAAGCTAAGGG - Intronic
1063933443 10:11052435-11052457 TCTGAGCCCAAACAACCTACAGG - Intronic
1064904473 10:20330879-20330901 GCTGAGCCCCACAAAGCCATAGG + Intergenic
1067558973 10:47291256-47291278 GCTGGGCCCACCCAAGCTTATGG + Intergenic
1070245909 10:74731009-74731031 GCTGCGCCCAGCAAAGCCACAGG + Intergenic
1072933150 10:99685470-99685492 GCTGAGTACAAACAAGCCACAGG - Intronic
1075290735 10:121228492-121228514 GCTGAGCCCAGCGAAGTTATGGG - Intergenic
1076381731 10:130028303-130028325 GCTGAGCCCAAGCAATACACAGG - Intergenic
1077845205 11:6015575-6015597 GCTGAGCCCTCCAAAGCCACAGG + Intergenic
1078989924 11:16636196-16636218 GCTGTGCCCTGCAAAGCTACAGG + Intronic
1080164069 11:29215548-29215570 GCTGAGCTAAACAAAGCTATGGG + Intergenic
1081664914 11:44911111-44911133 GCTGAGCCCAGTCCCGCTACAGG + Intronic
1085830495 11:79895624-79895646 GCTGAGCCCAGCAAAGCTGTAGG - Intergenic
1089824871 11:121265939-121265961 GCTGAGCCCACCCATGCTGAGGG + Intergenic
1095639284 12:44468269-44468291 GCTGAACCCTACAAAGCCACAGG + Intergenic
1098941152 12:76537986-76538008 GCTGAGGACAACAAAGTTACAGG + Intronic
1099460931 12:82919846-82919868 GCTGAGCCCAGCAAAGCCATGGG - Intronic
1100707102 12:97212824-97212846 GCTGACCCCAACCAACCCAAAGG - Intergenic
1101719748 12:107341153-107341175 GCTGGGCCACACCAAGCTGCAGG + Intronic
1104349830 12:128035625-128035647 GCTCAGCTCAACCAGGCTCCAGG + Intergenic
1104434128 12:128742458-128742480 GCTGACCCCAACCAAGAGAGGGG + Intergenic
1107344555 13:39444955-39444977 ACTGAGCCCAGCAAAGCCACAGG + Intronic
1109337365 13:61009388-61009410 GCTGTGCCCAGGGAAGCTACAGG + Intergenic
1112051697 13:95649466-95649488 GCTGTGCCCAGCAAAGCTGCAGG - Intergenic
1112409777 13:99153009-99153031 ACTGAGCCCAGCCAACCCACAGG + Intergenic
1115650822 14:35402100-35402122 GCGGAGCTCTGCCAAGCTACCGG + Intronic
1115940858 14:38608405-38608427 GCTGAACCCAACAAAGCCATAGG - Intergenic
1116009400 14:39333299-39333321 TCTGAGCCCATCCAAGTTAATGG - Intronic
1120327508 14:83049813-83049835 GCTGAGCCTATCCAAGCTGGGGG + Intergenic
1122265052 14:100542611-100542633 GCTGAGTCCAACCCAGCTACAGG - Intronic
1123579289 15:21702369-21702391 GCTGAGCCCAGCACAGCTCCTGG - Intergenic
1123615916 15:22144880-22144902 GCTGAGCCCAGCACAGCTCCTGG - Intergenic
1123856343 15:24415931-24415953 GCTGAGCCCTGCCAAGCCAGAGG - Intergenic
1124717022 15:32073066-32073088 CCTGAGCCCAGCAAAGCTGCAGG + Intronic
1126846567 15:52765981-52766003 GTGGAGCCCAAACAACCTACTGG + Intronic
1127931136 15:63598201-63598223 GCTGAGCCAAACCAGACTCCAGG + Intronic
1128250085 15:66157792-66157814 GCTGAGCCCAGGAAATCTACAGG + Intronic
1128573773 15:68755377-68755399 GCTGAGCTCAAGCAATCTGCTGG - Intergenic
1129405133 15:75312068-75312090 CCTGAGCCCCACCATGCGACTGG - Intergenic
1129531311 15:76267315-76267337 GCTGCGCACAACAAAGCTAATGG + Intronic
1131255554 15:90859718-90859740 GCTGAGGCCAACCAGGCTCCTGG - Intergenic
1132290903 15:100703325-100703347 GCTGAACCCAAACAAGCTCTTGG + Intergenic
1202988159 15_KI270727v1_random:436614-436636 GCTGAGCCCAGCACAGCTCCTGG - Intergenic
1133562449 16:6962635-6962657 CCTGAGTTCAACCAATCTACCGG - Intronic
1133831951 16:9331462-9331484 GCTGAGACCAAGCATGCTGCTGG - Intergenic
1135831293 16:25776116-25776138 TCTGAGCCAAATCAAGGTACAGG - Intronic
1136650371 16:31664283-31664305 GCTGAGCACAACAAAGTTAATGG + Intergenic
1138232932 16:55352879-55352901 ACTGAGCTCAACAAAGCTATTGG - Intergenic
1138378765 16:56585667-56585689 GCTGAGGCCAACCATGAGACTGG + Intergenic
1141693036 16:85607162-85607184 CCTGACCCCAACCCAGATACAGG - Intergenic
1142318487 16:89365419-89365441 ACTGAGCCCAACCAGGGTGCAGG + Intronic
1142862410 17:2770749-2770771 ACTGAGCCCGACCAATCTCCAGG - Intergenic
1143210798 17:5185931-5185953 GCTGTGCCCTACAAAGCCACAGG - Intronic
1143693056 17:8587247-8587269 GCTGAGCCCAATCCAACTGCTGG + Intronic
1144620869 17:16817846-16817868 CCTGAGCCCAACCCACCCACAGG + Intergenic
1145112060 17:20172519-20172541 GCTCAGCCCAACCAAGCCCTGGG - Intronic
1146913731 17:36664950-36664972 GCTGAGCCCACCCAACTCACAGG - Intergenic
1147512325 17:41081698-41081720 GCTGAGCCCAGCAAAGCCATGGG + Intergenic
1147514498 17:41102869-41102891 GCTGAGCCCAGCAAAGCCATGGG + Intronic
1149088719 17:52751608-52751630 GCTCAGCCCAAGCAGGGTACAGG + Intergenic
1152246699 17:79188272-79188294 GCTAAGCCCAGCCCAGCTGCCGG + Intronic
1156386157 18:36606973-36606995 GCTGAGCCCAGCAAAGCCATAGG - Intronic
1163231369 19:16005337-16005359 GCCGAGCCCACCCAAGCTGAGGG + Intergenic
1166557258 19:43708876-43708898 GCTGAGCCCAGCCAACCCACAGG - Intergenic
1166765343 19:45249631-45249653 GCTCAGCCCCACCAAGTCACTGG - Intronic
1167501506 19:49851198-49851220 GCTGAGCCGTACCAAGCTCGGGG - Exonic
1168130929 19:54318086-54318108 GCTGAGCCCACCCAAGCTGGGGG + Intergenic
928515981 2:32045341-32045363 ACTGTGCCCAGCCAAGCTTCAGG + Intergenic
929037265 2:37706209-37706231 GCTGAGCCCAACAGACCCACAGG - Intronic
929552590 2:42903919-42903941 CCTCAGGCCAACCAAGCGACGGG - Intergenic
931168911 2:59781443-59781465 GCTCACCCCAACCAAGGTCCTGG - Intergenic
933185055 2:79269345-79269367 GCTGAGCCTAACCAGGCTGAAGG + Intronic
934475098 2:94588358-94588380 CCTTAGCCCAGCCAAGCAACAGG - Intergenic
935377815 2:102418054-102418076 GCTGAGCACATCAAAGCTCCAGG - Intergenic
935419687 2:102854332-102854354 GCTGTACCCTACCAAGCCACAGG - Intergenic
938186611 2:129237855-129237877 ACTGAGCCCACCAAAGCCACAGG + Intergenic
943205243 2:184886319-184886341 GCTGTACCCAACAAAGCCACAGG - Intronic
943481742 2:188427959-188427981 GCTGAGCCCTGCAAAGCCACAGG + Intronic
946444136 2:219723634-219723656 GCTGAACCCAAACAAGGTACAGG - Intergenic
948526974 2:238576857-238576879 GCTGAGCCCAATCAACCCACAGG - Intergenic
949070004 2:242018717-242018739 CCTGAGCCCAGCCACGCCACGGG + Intergenic
1170272833 20:14547734-14547756 GCTGAGCCCAACCAAGCTACAGG - Intronic
1170318682 20:15070041-15070063 GCTGCACCCTACAAAGCTACAGG + Intronic
1171300256 20:24053403-24053425 GAGGAGCCCAACCAAGCTTCTGG + Intergenic
1172428140 20:34870028-34870050 GCTGGGCACAACCAAGGTCCTGG + Intronic
1174061492 20:47836171-47836193 CCTAAGCCCAGCCAAGCCACAGG - Intergenic
1174070034 20:47893152-47893174 CCTAAGCCCAGCCAAGCCACGGG + Intergenic
1174101282 20:48128032-48128054 CCTAAGCCCAGCCAAGCCACGGG - Intergenic
1174156357 20:48518075-48518097 CCTAAGCCCAGCCAAGCCACAGG - Intergenic
1174436773 20:50513310-50513332 GCTAGGCCCAATCAAGCAACCGG - Intronic
1174685094 20:52447087-52447109 GCTGAGTCCAACCATGATAAGGG + Intergenic
1174950457 20:55036142-55036164 GCTGAGCCCACCCAAGCCAGGGG - Intergenic
1175411868 20:58775820-58775842 GCTCAGCCCAACTAGGCTGCAGG + Intergenic
1177676561 21:24308581-24308603 GCTGTGCCCAACAAAGCCATGGG - Intergenic
1181027898 22:20136129-20136151 GCTGGCTCCAGCCAAGCTACGGG - Intronic
1182537913 22:31019740-31019762 GCTGAGCCCAGCAAAGCCATAGG - Intergenic
1183047665 22:35233201-35233223 GCTGACCCTAAGCAAGCAACTGG + Intergenic
949657565 3:6238375-6238397 GCTGAGCCCAGCAAAGCTATAGG + Intergenic
949768413 3:7552269-7552291 GCTGTACCCTACAAAGCTACAGG - Intronic
952809518 3:37388732-37388754 GCTGAGCCCAGTCAATCCACAGG + Intronic
953845707 3:46424632-46424654 GCTGAGCCCAGCAAAGTTAAGGG + Intergenic
956360098 3:68438462-68438484 ACTGAGTCCAGCCAAGCCACAGG - Intronic
956660294 3:71590785-71590807 GCTGAGCCCTACCCATCTTCCGG - Intergenic
959973098 3:112428815-112428837 GCTGAGCCCAGCAAACCTATAGG + Intergenic
961089811 3:124101199-124101221 GCTGAGGCCAAACAACCTCCTGG - Intronic
966216472 3:177508239-177508261 GCTGAGCCCAGCAAAGCCACAGG + Intergenic
966393406 3:179476377-179476399 GCTGAGCCCAGCAAAGCCATGGG - Intergenic
967559967 3:190906008-190906030 GGTGAGCCCCACAAAGCCACAGG + Intergenic
967976861 3:195040398-195040420 GCTGAGCCCAAGCCAGCTATTGG + Intergenic
969299906 4:6291720-6291742 GCTGAGTCCACCCCAGCTACTGG + Intronic
969569385 4:7999789-7999811 GCTCAGCCAAACCAGGCTCCTGG + Intronic
969921606 4:10545479-10545501 ACTAAGCACAACCAAGCTATAGG - Intronic
972284300 4:37633506-37633528 GCTTTGTCCAAACAAGCTACAGG + Intronic
973571456 4:52243726-52243748 GCTAAGCCTACCCCAGCTACAGG - Intergenic
976842243 4:89445270-89445292 GCTGTACCCCACAAAGCTACAGG - Intergenic
977097891 4:92769313-92769335 GCTGTGCCCTGCAAAGCTACAGG - Intronic
978226290 4:106338847-106338869 GCTGTGCCCTACAAAGCCACAGG + Intronic
978306298 4:107332172-107332194 GCTGTGCACAACAAAGCTAATGG + Intergenic
978526922 4:109677029-109677051 GCTGAGCCCAGCAAAGCCATGGG + Intronic
979456146 4:120927935-120927957 GCTGAGCCCAGCAAAGCTGTGGG + Intergenic
983723782 4:170893244-170893266 GCTGAACCCTACAAAGCCACAGG - Intergenic
986360757 5:6975803-6975825 GCTGAACCCCACCAAGTCACAGG + Intergenic
986667459 5:10115843-10115865 GCTGAGCCCACCAAGGGTACAGG + Intergenic
987428750 5:17805032-17805054 ACTGTGCCCAACCAACCCACAGG + Intergenic
993587373 5:89747244-89747266 GCTTAAGCCAACCAAGTTACTGG - Intergenic
994344491 5:98668720-98668742 GATGACCACAACCAAGCCACTGG + Intergenic
994905962 5:105841073-105841095 GCTGAACCCAACCAGGCTGAGGG + Intergenic
995883861 5:116871125-116871147 GCTGTGCCCAGCAAAGCCACAGG + Intergenic
998163066 5:139824248-139824270 GCTAAGGCCCACCAAGCTGCGGG - Intronic
998677427 5:144425333-144425355 GATGAGCCCAACAAGGCTATAGG - Intronic
1001560783 5:172667680-172667702 GCTGGGGCCAGCAAAGCTACTGG - Intronic
1002042044 5:176521553-176521575 GCAGAGGCCAACCAAGCCAGGGG + Intergenic
1003403111 6:5807112-5807134 GCTGAACCCAGCAAAGCCACAGG + Intergenic
1003439298 6:6124275-6124297 GCTGCACCCAACAAAGCTACAGG + Intergenic
1006129096 6:31858241-31858263 GCTGAGCTCAAGCAATCTGCCGG - Intronic
1006141857 6:31934048-31934070 GCTGAGCCCACCAAGGCTCCTGG - Intronic
1007866141 6:44972418-44972440 GCTGTGCCCTACAAAGCCACAGG - Intronic
1008504888 6:52220065-52220087 GCTGAGCCCAAGAAAGCTAAGGG + Intergenic
1009723424 6:67506056-67506078 GCTGTACCCAACAAAGCCACAGG - Intergenic
1010062986 6:71646259-71646281 GCTGAGCCCAGCAAAGCCATGGG - Intergenic
1012788134 6:103658140-103658162 GCTGTGCCCTGCAAAGCTACAGG - Intergenic
1014934089 6:127365991-127366013 GCTGAGCCCACTCAAGCTGGGGG - Intergenic
1015439640 6:133233238-133233260 GCTGAGCCCAGCAAAGTCACAGG - Intergenic
1018855331 6:167670440-167670462 GCTGAGACCACCCATGCTTCTGG - Intergenic
1023599138 7:41864544-41864566 GCTGAGCCCAGCAAAGCCATGGG - Intergenic
1024069633 7:45775170-45775192 GCTGAGCCCAAGCCAGGGACAGG - Intergenic
1025232949 7:57214903-57214925 CCTAAGCCCAGCCAAGCCACGGG + Intergenic
1029195234 7:98801204-98801226 GCTGAGCCCAGCCAACCCACAGG + Intergenic
1030533339 7:110736516-110736538 GCTGTGCCCAGCAAAGCTAGGGG + Intronic
1034007074 7:147484664-147484686 ACTGAGCCAAGCCCAGCTACAGG + Intronic
1038386402 8:27151844-27151866 GCTGAACTCAACCAAACTCCTGG - Intergenic
1042266082 8:66910401-66910423 GCTGTGCCCTACAAAGCCACGGG + Intronic
1044565389 8:93656875-93656897 TCTGAGCCCAACAGAACTACTGG - Intergenic
1046098946 8:109592576-109592598 GCTGAGCCAGCCCAAGGTACAGG - Intronic
1049487185 8:142872252-142872274 GCTGCACCCAGCCAAGCTGCAGG + Intronic
1050508555 9:6371232-6371254 GCTGTGCCCTGCAAAGCTACAGG + Intergenic
1050674471 9:8036560-8036582 GCTGAGCCCTGCAAAGCCACAGG - Intergenic
1051361508 9:16285468-16285490 GCTGAGCACAGCCAAGCACCAGG - Intergenic
1053125229 9:35575713-35575735 GCTGAGCCCACCCAAGCTGGGGG + Intergenic
1053604153 9:39640079-39640101 GCTGTGCCCAGCAAAGCTATGGG - Intergenic
1053861968 9:42396130-42396152 GCTGTGCCCAGCAAAGCTATGGG - Intergenic
1054249387 9:62702335-62702357 GCTGTGCCCAGCAAAGCTATGGG + Intergenic
1054563498 9:66736867-66736889 GCTGTGCCCAGCAAAGCTATGGG + Intergenic
1057514610 9:95710747-95710769 GCAGAGACCACCCAAGCTCCAGG - Intergenic
1059320390 9:113464053-113464075 GCTCAGTCCAAGCAAGCTGCTGG + Intronic
1059402395 9:114078397-114078419 GCTGACCCCAGCCAGGCTACAGG - Exonic
1062213242 9:135375869-135375891 TCTAATCCCAACCCAGCTACTGG - Intergenic
1185472719 X:394287-394309 CCTGAGCTCAAGCAATCTACTGG + Intergenic
1189079800 X:37958991-37959013 GCTGAGCACAGCAAAGCCACAGG - Intronic
1189733022 X:44041422-44041444 GCTGAGCCCAGCTGAGTTACAGG - Intergenic
1189966795 X:46381995-46382017 CCTGAGGGCAACCAGGCTACTGG - Intergenic
1193325182 X:80172174-80172196 GCTTAGCCAACCCAAGCTAAGGG + Intergenic
1194211972 X:91081491-91081513 GCTGAGCCCTGCAAAGCCACAGG - Intergenic
1194878379 X:99219057-99219079 GCTGAGCCTAGCAAAGCCACGGG - Intergenic
1198588592 X:138150174-138150196 GCTGAGCCCTGCAAAGCCACAGG + Intergenic
1199421610 X:147650702-147650724 GCTGAACCCTGCAAAGCTACAGG + Intergenic
1199993573 X:153004449-153004471 GCTGAGCCCTGCAAAGCCACAGG - Intergenic