ID: 1170272836

View in Genome Browser
Species Human (GRCh38)
Location 20:14547765-14547787
Sequence TCTCCTCGATTGTGTACCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170272829_1170272836 16 Left 1170272829 20:14547726-14547748 CCCATGATCCTGTAGCTTGGTTG No data
Right 1170272836 20:14547765-14547787 TCTCCTCGATTGTGTACCTGAGG No data
1170272833_1170272836 8 Left 1170272833 20:14547734-14547756 CCTGTAGCTTGGTTGGGCTCAGC No data
Right 1170272836 20:14547765-14547787 TCTCCTCGATTGTGTACCTGAGG No data
1170272830_1170272836 15 Left 1170272830 20:14547727-14547749 CCATGATCCTGTAGCTTGGTTGG No data
Right 1170272836 20:14547765-14547787 TCTCCTCGATTGTGTACCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170272836 Original CRISPR TCTCCTCGATTGTGTACCTG AGG Intronic