ID: 1170272836

View in Genome Browser
Species Human (GRCh38)
Location 20:14547765-14547787
Sequence TCTCCTCGATTGTGTACCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 73
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 70}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170272829_1170272836 16 Left 1170272829 20:14547726-14547748 CCCATGATCCTGTAGCTTGGTTG 0: 1
1: 0
2: 0
3: 5
4: 83
Right 1170272836 20:14547765-14547787 TCTCCTCGATTGTGTACCTGAGG 0: 1
1: 0
2: 0
3: 2
4: 70
1170272830_1170272836 15 Left 1170272830 20:14547727-14547749 CCATGATCCTGTAGCTTGGTTGG 0: 1
1: 0
2: 0
3: 7
4: 123
Right 1170272836 20:14547765-14547787 TCTCCTCGATTGTGTACCTGAGG 0: 1
1: 0
2: 0
3: 2
4: 70
1170272833_1170272836 8 Left 1170272833 20:14547734-14547756 CCTGTAGCTTGGTTGGGCTCAGC 0: 1
1: 0
2: 1
3: 19
4: 170
Right 1170272836 20:14547765-14547787 TCTCCTCGATTGTGTACCTGAGG 0: 1
1: 0
2: 0
3: 2
4: 70

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170272836 Original CRISPR TCTCCTCGATTGTGTACCTG AGG Intronic
904046016 1:27608881-27608903 TGTCTTCGATACTGTACCTGGGG + Intergenic
904046024 1:27608965-27608987 TGTCTTCGATACTGTACCTGGGG + Intergenic
907669997 1:56466087-56466109 GTTCCTCGTTTGGGTACCTGGGG - Intergenic
910373400 1:86542882-86542904 TCTGCTGGAATGTCTACCTGAGG + Intergenic
911213064 1:95163340-95163362 TCAGCTCCATTGGGTACCTGAGG + Intronic
917087316 1:171316916-171316938 TCTCTTAGATTTTGTGCCTGGGG + Intronic
919572433 1:199265584-199265606 TCTCCCTGCTTGTGTACCCGTGG - Intergenic
1064300589 10:14119380-14119402 TCTCCTCGTTCAGGTACCTGGGG - Intronic
1064323595 10:14328807-14328829 TATCCTCCATCGTCTACCTGTGG - Intronic
1077618330 11:3695885-3695907 TTTCCTCCATTTTGTAGCTGAGG - Intronic
1078435676 11:11323286-11323308 TCTCTTCGAATGTGAGCCTGTGG + Intronic
1083027073 11:59559976-59559998 TCTCTCCGATTGGGTGCCTGAGG - Intergenic
1083059364 11:59853305-59853327 GCTCCTCCATTGTGAAACTGTGG + Exonic
1086010784 11:82100920-82100942 TTTCCTCTATTTTGCACCTGTGG - Intergenic
1091552451 12:1546804-1546826 TCTCCTTGGCTGTGTCCCTGGGG + Intronic
1091637317 12:2207097-2207119 GCTCCTCGAATGTGGTCCTGGGG - Intronic
1098014147 12:66086597-66086619 TCTCCTCTTATGTGTACCTCTGG + Intergenic
1101919797 12:108923173-108923195 TCCCCTTGATTGTGTAGATGGGG + Intronic
1102818586 12:115888611-115888633 TCTCCTCAGCTGTCTACCTGAGG + Intergenic
1104345497 12:127993086-127993108 TCTCCTCCACTGTGTCCATGTGG - Intergenic
1106735601 13:32585803-32585825 CCTCCTGGAATGTGTCCCTGTGG + Intergenic
1113191854 13:107758102-107758124 TCTCCTCTATTCTGTTACTGAGG + Intronic
1120015785 14:79471758-79471780 TGTCCTAGATTGAGTAACTGGGG + Intronic
1128547453 15:68578027-68578049 TCTCCGCGGTTCTGTATCTGCGG + Intergenic
1130870210 15:87965568-87965590 CCTCCACAATTGTGTACCTCAGG + Intronic
1132100095 15:99016664-99016686 TCTCCTCTATTTTGTAGATGAGG - Intergenic
1136081790 16:27857015-27857037 TCTCTTCGATTGGGCACCAGAGG + Intronic
1142587961 17:986422-986444 TCACCTCAATTGTGGACTTGTGG + Intergenic
1143251779 17:5528186-5528208 TCTTCTTGATAGAGTACCTGGGG + Intronic
1146235386 17:31155382-31155404 TCCCTTCAATTGTGTAGCTGAGG + Intronic
1146680814 17:34806701-34806723 TTTCCTCAACTGTGAACCTGGGG - Intergenic
1151356379 17:73561035-73561057 TCTCCTCTTTCCTGTACCTGTGG - Intronic
1152100312 17:78297638-78297660 CCTCCTGGACTTTGTACCTGGGG + Intergenic
1155175532 18:23298245-23298267 TCACCTCCCATGTGTACCTGAGG - Intronic
1155776288 18:29766222-29766244 TCTCCTCATCTGTGGACCTGTGG + Intergenic
1160034091 18:75285440-75285462 TCTCCTAGCTTATGTTCCTGAGG + Exonic
1163516026 19:17764369-17764391 TCTCCTCGATGGTGGCCCTGGGG - Exonic
932713892 2:74087835-74087857 TCTCCTCCAGCGTGTGCCTGCGG - Exonic
933264466 2:80167578-80167600 TGTCCTTGAATGTGGACCTGAGG + Intronic
934726489 2:96623635-96623657 TCTCCTGGATCCTGTAACTGTGG - Intronic
942682633 2:178494144-178494166 TCTTCTCGATTGTGTCTGTGTGG + Intronic
946410839 2:219514466-219514488 TCTCCTCGATCGTCTCCTTGTGG - Exonic
948687466 2:239677945-239677967 TCTCCTGGCCTGGGTACCTGAGG + Intergenic
1170272836 20:14547765-14547787 TCTCCTCGATTGTGTACCTGAGG + Intronic
1170916905 20:20635117-20635139 TCTCCTCACTTGAGTACCAGTGG - Intronic
1173228846 20:41178561-41178583 TTTCCTAGATTTTGTATCTGTGG - Exonic
1176519634 21:7814903-7814925 TGTCCTCGAGTGTGGTCCTGGGG - Intergenic
1178319676 21:31595917-31595939 TCTCCCTGCTTGTGTTCCTGAGG + Intergenic
1178653662 21:34444916-34444938 TGTCCTCGAGTGTGGTCCTGGGG - Intergenic
1178745685 21:35248160-35248182 TAGGCTCAATTGTGTACCTGTGG + Intronic
1181457217 22:23066695-23066717 TTTCCCCGATTGTTTCCCTGGGG - Intronic
957133398 3:76252064-76252086 TCTGCTCAAATGTCTACCTGTGG - Intronic
960312463 3:116133173-116133195 TTTCCTAGGTTGTGCACCTGAGG - Intronic
968668545 4:1834910-1834932 TCTCCTCGATGGTGTCCTGGAGG + Exonic
971971434 4:33625845-33625867 TCTCATCTATTCTGTGCCTGAGG + Intergenic
979947548 4:126852277-126852299 TCTCCTCAATTGAGTACTTGGGG + Intergenic
983630920 4:169848442-169848464 TCTCCTTGTTTATGTTCCTGTGG + Intergenic
988807318 5:34752508-34752530 TCTACTCCATTGCGTCCCTGGGG - Intronic
993142206 5:84049341-84049363 TCTGGTGGATTGTGTACCTCAGG - Intronic
1003097272 6:3152355-3152377 TCTCCTCGATAGTGGTCATGGGG + Intronic
1011209228 6:84936712-84936734 CCTCCTCAAGTGTGTCCCTGAGG + Intergenic
1024026220 7:45412209-45412231 TCTCCTTGATTTTGTTCATGTGG + Intergenic
1026911763 7:74095208-74095230 TCTCCTAGATTGTGGCCCTTTGG + Intronic
1027967144 7:85026486-85026508 TCTTCCCATTTGTGTACCTGAGG - Intronic
1037692597 8:21194879-21194901 TCTCCCCGGTTGTTTACCCGAGG - Intergenic
1039843597 8:41310148-41310170 TCTCCTCGGTTCTCTAGCTGCGG + Intergenic
1043989041 8:86729982-86730004 TTCCCTGGAATGTGTACCTGTGG + Intronic
1045173548 8:99696647-99696669 TCTCCTCGATGGTGTCCTGGAGG - Intronic
1049206873 8:141367615-141367637 TCTCCTGGATGGTGCAGCTGAGG - Intergenic
1056045772 9:82714036-82714058 TCTGCCCAATTGTGTGCCTGAGG - Intergenic
1186405843 X:9301589-9301611 TCTCCTCGAACGTCTTCCTGAGG - Intergenic
1199232704 X:145456758-145456780 TATCCTCTATTGTGTACTTTCGG + Intergenic
1200420440 Y:2959762-2959784 ACTCGGTGATTGTGTACCTGTGG - Intronic