ID: 1170273383

View in Genome Browser
Species Human (GRCh38)
Location 20:14554061-14554083
Sequence GCAGCTAGCAAATATTAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 442
Summary {0: 1, 1: 0, 2: 4, 3: 141, 4: 296}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170273383 Original CRISPR GCAGCTAGCAAATATTAAGC TGG (reversed) Intronic
901903591 1:12389176-12389198 GCTGCCAGCAAATATAAAGCAGG - Intronic
902605225 1:17565382-17565404 GCAAGGAGCAAATGTTAAGCAGG - Intronic
902958581 1:19944782-19944804 GCTGCCAGCAAATATAAAGCAGG + Intergenic
903303430 1:22395085-22395107 GTAGCTAACAGTTATTAAGCAGG + Intergenic
906818104 1:48899934-48899956 GGAGCTAGGAAATATTTAACAGG + Intronic
906879980 1:49578990-49579012 GCTGCCAGCAAATATAAAGCCGG + Intronic
907597671 1:55734648-55734670 GCTGCCAGCGAATATAAAGCAGG + Intergenic
908982545 1:69976380-69976402 GCTGCCAGCGAATATAAAGCAGG - Intronic
909095359 1:71280145-71280167 GCACTTTGCAAATATTAATCAGG + Intergenic
909173056 1:72318954-72318976 GCTGCCAGCAAATATAAAGCAGG - Intergenic
909603837 1:77488746-77488768 GCTGCCAGCAAATATAAAGCAGG - Intronic
910361178 1:86414766-86414788 GCTGCCAGCGAATATAAAGCAGG + Intergenic
910561404 1:88595992-88596014 GCTGCCAGCAAATATAAAGCAGG + Intergenic
910562216 1:88602487-88602509 GCTGCCAGCAAATATAAAGCAGG + Intergenic
910776517 1:90881847-90881869 GCTGCCAGCAAATACAAAGCAGG - Intergenic
910947967 1:92614551-92614573 GCTGCCAGCGAATATAAAGCAGG + Intronic
912067314 1:105759477-105759499 GCAGCCACCAAATACAAAGCAGG + Intergenic
912599890 1:110919309-110919331 GCTGCCAGCGAATATAAAGCTGG + Intergenic
912733769 1:112132426-112132448 GCTGCCAGCAAATGTAAAGCAGG - Intergenic
912943427 1:114065360-114065382 GCTGCCAGCAAACATAAAGCAGG - Intergenic
917389512 1:174519446-174519468 GCTGCCAGCGAATATAAAGCAGG - Intronic
918756242 1:188341939-188341961 GCTGCCAGCAAAGATAAAGCAGG - Intergenic
919515523 1:198517342-198517364 GCTGCCAGAAAATATGAAGCAGG - Intergenic
921008308 1:211115480-211115502 GCTTCCAGCAAATATAAAGCAGG + Intronic
921352101 1:214246408-214246430 GCTGCCAGCAAATATAAAGCAGG - Intergenic
921410771 1:214834529-214834551 GCTGCCAGCGAATATAAAGCAGG - Intergenic
921839146 1:219809877-219809899 GCAGCTGGGGAATAATAAGCTGG - Intronic
922011280 1:221590912-221590934 GCTGCCAGCAAATATAAAGCAGG + Intergenic
922062106 1:222102782-222102804 GCAGCTACCACTTATTGAGCTGG - Intergenic
924365531 1:243289308-243289330 GCTGCCAGCGAATATAAAGCAGG - Intronic
1063788435 10:9411081-9411103 GCTGCCAGCGAATATAAAGCAGG + Intergenic
1065439888 10:25741438-25741460 GCTGCCAGCAAATATAAAGCAGG - Intergenic
1065942525 10:30577848-30577870 GCTGCCAACAAATATAAAGCAGG - Intergenic
1066957996 10:42191183-42191205 GCTGCCAGCAAATATAAAGCAGG - Intergenic
1067754029 10:48991172-48991194 GCTGCCAGAAAATATAAAGCAGG - Intergenic
1067754853 10:48997597-48997619 GCTGCCAGCAAATATAAAGCAGG - Intergenic
1068007332 10:51407048-51407070 GCTGCCAGCGAATATAAAGCAGG - Intronic
1068007792 10:51410491-51410513 GCTGCCAGCAAATATAAAGCAGG - Intronic
1068156390 10:53205214-53205236 GCTGCCAGCAAATATAAAGCAGG + Intergenic
1068557424 10:58474643-58474665 GCTGCCAGCGAATATAAAGCAGG + Intergenic
1068836900 10:61565837-61565859 GCTGCCAGCAAATATAAAGCAGG - Intergenic
1069822528 10:71236485-71236507 CCAGCTCGTAAATATGAAGCCGG + Intronic
1071783037 10:88868265-88868287 GCCTCCAGCAAATATAAAGCAGG - Intergenic
1071926467 10:90415460-90415482 GCAGCTTGCACACATGAAGCAGG - Intergenic
1071937996 10:90551791-90551813 GCTGCCAGCAAATATAAAGCAGG + Intergenic
1072564155 10:96603456-96603478 GCTGCCAGCCAATATAAAGCAGG + Intronic
1073479657 10:103778488-103778510 GTAGCTAGGAAAGAATAAGCTGG - Intronic
1073557760 10:104468990-104469012 GCTGCCAGCAAATATAAAGCAGG - Intergenic
1073651197 10:105360335-105360357 GCTGCCAGCAAATATAAATCAGG + Intergenic
1073918170 10:108429896-108429918 GCTGCCAGCAAATATAAAGCAGG - Intergenic
1075223295 10:120602734-120602756 GCTGCCAGCAAATATAAAGCAGG + Intergenic
1075324919 10:121523605-121523627 GCACCTAGCAAATAGTAAGAAGG + Intronic
1076103328 10:127800177-127800199 GCTGCCAGCAAATATAAAGCAGG + Intergenic
1076926964 10:133496027-133496049 GCTTCCAGCAAATATAAAGCAGG - Intergenic
1078132203 11:8622060-8622082 GCTGCCAGCAAATATAAAGCAGG + Intronic
1078777647 11:14408485-14408507 GCTGCCAGCAAATATAAAGCAGG + Intergenic
1079663683 11:23075578-23075600 GCTGCCAGCAAATATAAAGCAGG + Intergenic
1080993441 11:37570322-37570344 GCAGTTAGCACATAATAAACTGG + Intergenic
1081369383 11:42280954-42280976 GCTGCCAGCAAATATGAAGCAGG - Intergenic
1081608589 11:44544250-44544272 GCCGCCAGCAAATATAAAGCAGG + Intergenic
1082612295 11:55315271-55315293 TAAGCTAGCAAATATGAAACTGG + Intergenic
1082957371 11:58884952-58884974 GCATCTGGCAATTATTCAGCAGG - Intronic
1086148108 11:83577083-83577105 GCTGCCAGCGAATATAAAGCAGG + Intronic
1087373689 11:97317697-97317719 GCTACCAGCAAATATAAAGCAGG + Intergenic
1087374342 11:97323085-97323107 GTTGCCAGCAAATATAAAGCAGG + Intergenic
1088264694 11:107977997-107978019 GCTGCGAGCAAATATAAAGCAGG + Intergenic
1088348764 11:108861133-108861155 GCTGCCAGCGAATATAAAGCAGG + Intronic
1088836492 11:113582110-113582132 GCTTCCAGCAAATATAAAGCAGG + Intergenic
1088836972 11:113585894-113585916 GCTTCCAGCAAATATAAAGCAGG + Intergenic
1089903942 11:122016138-122016160 GCTTCTAGCAAATATAAAGCAGG + Intergenic
1091317801 11:134627039-134627061 GCAGCTTGTAAATTTAAAGCTGG + Intergenic
1092040739 12:5381933-5381955 GCTTCCAGCAAATATAAAGCAGG - Intergenic
1093036661 12:14338201-14338223 GCTGCCAGCGAATATAAAGCAGG + Intergenic
1093049346 12:14488470-14488492 GCTGCCAACAAATATAAAGCAGG - Intronic
1093050155 12:14495124-14495146 GCTGCCAGAAAATATAAAGCAGG - Intronic
1094389480 12:29933713-29933735 GCTGCCAGCTAATATAAAGCAGG - Intergenic
1095355353 12:41266491-41266513 GTAGGAAGCAAATATGAAGCAGG + Intronic
1098039608 12:66340821-66340843 GCTGCCAGCAAATATAAAGCAGG - Exonic
1099859839 12:88212213-88212235 GCTGCCAGCAAATACAAAGCAGG - Intergenic
1099936127 12:89128036-89128058 GCATCTAGGAAATATCAAGAGGG + Intergenic
1100083627 12:90880752-90880774 GCTGCCAGCAAATATAAAGCAGG + Intergenic
1100241617 12:92715265-92715287 GCTGCCAGCAAATCTAAAGCAGG - Intergenic
1101543379 12:105685120-105685142 GCTGCCAGGAAATATAAAGCAGG + Intergenic
1101769296 12:107733688-107733710 GCAGCTAGTAAGTTTAAAGCAGG - Exonic
1103481804 12:121254970-121254992 GCTGCCAGCGAATATAAAGCAGG + Intronic
1105591136 13:21794078-21794100 GCTGCCAGCGAATATAAAGCAGG - Intergenic
1105607756 13:21941369-21941391 TAAGCTAGCAAATTTTAAGAAGG - Intergenic
1105739971 13:23313887-23313909 GCTGCCAGCGAATATAAAGCAGG + Intronic
1106595818 13:31135470-31135492 GCAGCTAGAAATTATAAAGTAGG + Exonic
1107587156 13:41863136-41863158 GCTGCCAGCCAATATAAAGCAGG + Intronic
1108927755 13:55774314-55774336 GCAGCCAGCAAACATAAAGCAGG + Intergenic
1109515855 13:63441742-63441764 GCTGCCAGCAAATATAAAGATGG + Intergenic
1109951457 13:69505775-69505797 GCTGCCAGCAAATATAAAGCAGG - Intergenic
1110016178 13:70407182-70407204 GCCGCCAGCAAATATAAAGCAGG + Intergenic
1110645899 13:77883847-77883869 GCAGGTAGAAAATACCAAGCAGG + Intergenic
1111057477 13:82970508-82970530 GCTGCCAGCAAATATAAAGCAGG - Intergenic
1113554573 13:111222019-111222041 GCTTCCAGCAAATATAAAGCAGG - Intronic
1114035172 14:18618123-18618145 GCAGCAAGGAAATAATTAGCTGG - Intergenic
1114720013 14:24871589-24871611 GCAGGTAGTAAATATTCAGCTGG - Intronic
1114758695 14:25287257-25287279 GCTGCCAGCAAATATAAAGCAGG - Intergenic
1116218814 14:42055045-42055067 GCTGCCAGCAAATATAAAGCAGG + Intergenic
1116597949 14:46877216-46877238 AGAAATAGCAAATATTAAGCAGG + Intronic
1118107079 14:62671886-62671908 GCTGCCAGCTAATATAAAGCAGG + Intergenic
1118581396 14:67302997-67303019 GCAGCTAGTGATTATTATGCCGG - Intronic
1120082461 14:80231075-80231097 GCTGCCAGCAAATATAAAGCAGG - Intronic
1121654137 14:95582954-95582976 GCTGCTGGCAGATATAAAGCAGG - Intergenic
1122014303 14:98780800-98780822 GCTGCCAGCAAATATAAAGCAGG + Intergenic
1202935118 14_KI270725v1_random:80712-80734 GCTGCCAGCAAATATAAATCAGG + Intergenic
1124430945 15:29608075-29608097 GCTGCCAGCAAATATAAAGCAGG - Intergenic
1125278118 15:38015093-38015115 GCTGCCAGCAAATATAAAGCAGG - Intergenic
1126408516 15:48347936-48347958 GCTTCCAGCAAATATAAAGCAGG - Intergenic
1128207604 15:65867165-65867187 GCTGCCAGCGAATATAAAGCAGG - Intronic
1130021992 15:80239455-80239477 GCTGCCAGCGAATATGAAGCAGG + Intergenic
1130272086 15:82457111-82457133 GCTGCTAGCGAATATAAAGCAGG + Intergenic
1130464438 15:84184500-84184522 GCTGCTAGCGAATATAAAGCAGG + Intergenic
1130488249 15:84410322-84410344 GCTGCTAGCGAATATAAAGCAGG - Intergenic
1130499829 15:84489037-84489059 GCTGCTAGCGAATATAAAGCAGG - Intergenic
1130586730 15:85189133-85189155 GCTGCTAGCGAATATAAAGCAGG + Intergenic
1132217936 15:100081129-100081151 GCTGCCAGCAAATACAAAGCAGG + Intronic
1137245657 16:46701881-46701903 GCTGCCAGCAAATATAAAGCAGG + Intergenic
1137666103 16:50250007-50250029 ACAGCTACCAAACATTGAGCTGG - Intronic
1137854008 16:51775049-51775071 GCTGCCAGCGAATATAAAGCAGG - Intergenic
1138806596 16:60097350-60097372 GCCTCCAGCAAATATAAAGCAGG - Intergenic
1139021444 16:62754667-62754689 GAGGCTCGGAAATATTAAGCAGG + Intergenic
1140090434 16:71834052-71834074 GCTGCCAGCGAATATAAAGCAGG + Intergenic
1140597862 16:76437195-76437217 GCTGCCAGCAAATATAAAGCAGG - Intronic
1147622606 17:41877720-41877742 GCTTCCAGCAAATATAAAGCAGG + Intronic
1149261534 17:54885268-54885290 GCTGCCAGCCAATATAAAGCAGG + Intergenic
1149453669 17:56770128-56770150 GCAGCTGGAAAATTTTAATCAGG - Intergenic
1149669672 17:58395166-58395188 AAAACTAGCAAATATTAAACAGG + Intronic
1153115462 18:1649600-1649622 GCTGCCAGCAAATATAAAGCAGG + Intergenic
1155940850 18:31800517-31800539 GCTGCCAACAAATATAAAGCAGG + Intergenic
1157340911 18:46777686-46777708 GCTGCCAGCAACTATAAAGCAGG + Intergenic
1157341532 18:46782479-46782501 GCTGCCGGCAAATATAAAGCAGG + Intergenic
1157823794 18:50793988-50794010 GCAGTTTGCAAATGTTAACCAGG - Intergenic
1159136591 18:64343896-64343918 GCTTCCAGCAAATATAAAGCAGG - Intergenic
1159584389 18:70269750-70269772 ACTTCTAGCAAATATGAAGCAGG + Intergenic
1159716914 18:71835451-71835473 GCTTCTAGCAAATGTAAAGCAGG + Intergenic
1160191422 18:76717279-76717301 GCTGCTAGCAAATATAAAGCAGG - Intergenic
1161372465 19:3920896-3920918 GCTGCCAGCAAATATAAAGCAGG + Intronic
1162688114 19:12404996-12405018 GCTGCCAGCGAATATAAAGCAGG + Intronic
1164516408 19:28940244-28940266 CCAGCTACCAATAATTAAGCAGG - Intergenic
1167023015 19:46892729-46892751 GCAGCTAACAATTATTTAGGTGG - Intergenic
925105224 2:1285181-1285203 GCTGCCAGCAAATATAAACCAGG - Intronic
925280280 2:2679388-2679410 GCTTCCAGCAAATATAAAGCAGG + Intergenic
925655354 2:6141866-6141888 GCCACCAGCAAATATAAAGCAGG - Intergenic
926670649 2:15574304-15574326 GCTGCCAGCGAATATGAAGCAGG - Intergenic
928280131 2:29938710-29938732 GCTGCCAGCGAATATAAAGCAGG + Intergenic
929614026 2:43294236-43294258 GCTCCTAGCACATAGTAAGCAGG - Intronic
930061653 2:47294564-47294586 GCAGCCAGAGAATATAAAGCAGG + Intergenic
930153977 2:48086618-48086640 GCTGTCAGCAAATATAAAGCAGG + Intergenic
932267772 2:70383143-70383165 GCTGCCAGCAAATATAAAGCAGG - Intergenic
932953754 2:76326398-76326420 GCTGCCAGCGAATATAAAGCAGG + Intergenic
933105815 2:78323797-78323819 GCTGCCAGCAAATATAAAGCAGG - Intergenic
933394152 2:81710830-81710852 GCCACCAGCAAATATAAAGCAGG - Intergenic
933783967 2:85823622-85823644 GCTGCCAGCGAATATAAAGCAGG - Intergenic
933915952 2:86993739-86993761 GCTGCCAGCGAATATAAAGCAGG - Intronic
934007041 2:87776163-87776185 GCTGCCAGCGAATATAAAGCAGG + Intronic
934054106 2:88237447-88237469 GCTGCCAGCAAATATAAAGCAGG + Intergenic
934072847 2:88401178-88401200 GCTGCCAGCAAATATAAACCAGG + Intergenic
934306116 2:91823574-91823596 GCTGCCAGCAAATATAAAGCAGG - Intergenic
934327140 2:92029168-92029190 GCTGCCAGCAAATATAAAGCAGG + Intergenic
934465523 2:94259735-94259757 GCTGCCAGCAAATATAAAGCAGG + Intergenic
934874407 2:97902793-97902815 GCTTCCAGCAAATATAAAGCAGG + Intronic
935424798 2:102908920-102908942 GCTGCCAGCGAATATAAAGCAGG - Intergenic
935425540 2:102914986-102915008 GCTGCCAGCAAATATGAAGTAGG - Intergenic
936131179 2:109844004-109844026 GCTGCCAGCGAATATAAAGCAGG - Intronic
936213518 2:110527481-110527503 GCTGCCAGCGAATATAAAGCAGG + Intronic
936276156 2:111099439-111099461 TCAGTGAGCAAATAGTAAGCTGG + Intronic
936422655 2:112382041-112382063 GCTGCCAGCGAATATAAAGCAGG + Intronic
937458027 2:122060756-122060778 GCTGCCAGCGAATATAAAGCAGG - Intergenic
939213382 2:139208357-139208379 GCTGCCAGCAAATGTAAAGCAGG + Intergenic
939214183 2:139214759-139214781 GCTGCTAGCGAATGTAAAGCAGG + Intergenic
939724800 2:145703889-145703911 GCAGCTATCAAATTTTAATGTGG + Intergenic
940171769 2:150836269-150836291 GCTGCTAGGAAATATAAAGCAGG - Intergenic
940408374 2:153331639-153331661 GCTGCCAGCAAATATAAAGCAGG - Intergenic
940415232 2:153411985-153412007 GCTGCCAGAAAATATAAAGCAGG + Intergenic
941241308 2:163041718-163041740 GCTGCCAGCAAATATAAAGCAGG + Intergenic
941511254 2:166413730-166413752 GCTGCCAGCAAATATAAAGCAGG + Intronic
941715630 2:168760378-168760400 GCTGCCGGCAAATATAAAGCAGG - Intronic
943073303 2:183167168-183167190 GCTGCCAGCAAATACAAAGCAGG + Intergenic
945146240 2:206741474-206741496 GCTGCCAGCAAATATAAAGCAGG + Intronic
945544505 2:211133915-211133937 ACTGCCAGCAAATATGAAGCAGG + Intergenic
945641729 2:212440282-212440304 GCTGCCAGCAAATACAAAGCAGG + Intronic
945642503 2:212446358-212446380 GCTGCCAGCAAATATAAAGCAGG + Intronic
945763633 2:213945549-213945571 ACTGCCAGCAAATATAAAGCAGG - Intronic
945907127 2:215606680-215606702 GCTGCCAGCAAATATAAAGCAGG + Intergenic
946456886 2:219833747-219833769 GCTGCCAGCAAATATAAAGCAGG - Intergenic
946484676 2:220089539-220089561 GCATCCAGCGAATATAAAGCAGG + Intergenic
947374752 2:229484212-229484234 GCAGCTAGCACATTTTACCCAGG - Intronic
948106144 2:235415353-235415375 GCTGCCAGCTAATATGAAGCAGG - Intergenic
948131031 2:235600719-235600741 GCTGCCAGCAAATATAAAGCAGG - Intronic
1169838415 20:9906536-9906558 GTTGCTAGCAAATGTAAAGCAGG - Intergenic
1170273383 20:14554061-14554083 GCAGCTAGCAAATATTAAGCTGG - Intronic
1170312769 20:15010991-15011013 GCAACTACCAAATATAAAGCTGG + Intronic
1171231492 20:23490730-23490752 GCTGCCAGCGAATATAAAGCAGG - Intergenic
1172472285 20:35208676-35208698 TCATTTAGCAAATATTCAGCTGG + Intergenic
1173583293 20:44162520-44162542 GCTGCCAGCAAATATAAAGCAGG + Intronic
1173898542 20:46569451-46569473 ACAGCTAGAAAAGATTAAGCTGG - Intronic
1176596540 21:8702940-8702962 GCTGCCAGCAAATATAAAGCAGG + Intergenic
1177030027 21:15970956-15970978 GCTGCCAGCGAATATAAAGCAGG + Intergenic
1177506047 21:22018061-22018083 GCTGCCAGCGAATATAAAGCAGG - Intergenic
1177527818 21:22319512-22319534 GTAGGTAGCAAATATGAGGCAGG + Intergenic
1178005726 21:28217927-28217949 GCTGACAGCAAATATAAAGCAGG - Intergenic
1178313217 21:31547007-31547029 GCAACTAGCAACTAGTAAGCTGG - Intronic
1179333726 21:40430398-40430420 GCTGCCAGCAAATATTAAGCAGG + Intronic
1180279453 22:10680386-10680408 GCTGCCAGCAAATATAAAGCAGG + Intergenic
1180586666 22:16898921-16898943 GCTGCCAGCAAATATAAAGCAGG + Intergenic
1181935971 22:26438906-26438928 GCTTCCAGCAAATATAAAGCAGG - Intronic
1182836264 22:33344049-33344071 GCTGCCAGCAAATATAAAGCAGG - Intronic
949361215 3:3233882-3233904 GCTGCCAGCAAATATAAAGCAGG + Intergenic
951131100 3:19045708-19045730 GCTGCCAGCGAATATAAAGCAGG - Intergenic
951199942 3:19865027-19865049 GCTGCCAGCAAATGTAAAGCAGG - Intergenic
951291667 3:20878007-20878029 ACTGCTAGCAAATATAAAGCAGG + Intergenic
953192855 3:40704875-40704897 GCTGCCAGCGAATATAAAGCAGG + Intergenic
953812211 3:46122958-46122980 GCTGCCAGAAAATATAAAGCAGG + Intergenic
954250347 3:49362495-49362517 GGAGCTAGCCAAGATGAAGCAGG - Exonic
955306495 3:57838419-57838441 GGAGCTATAAAATACTAAGCAGG + Intronic
956139119 3:66127888-66127910 ACAGATAGCAAAAATTAAGGTGG + Intergenic
957769664 3:84674548-84674570 AGAGCTAGCAAATATAAAACAGG - Intergenic
958258994 3:91357596-91357618 GCTGCCAGCAAAAATAAAGCAGG - Intergenic
958934629 3:100243121-100243143 GCTGCCAGCAAATATAAAGGGGG + Intergenic
959200428 3:103239357-103239379 GCAGGAAGCAAATATTGGGCAGG - Intergenic
959263194 3:104105792-104105814 GCTGCAAGCAAACATAAAGCAGG - Intergenic
959745707 3:109774753-109774775 GCTGCCAGCAAATACAAAGCAGG - Intergenic
959765553 3:110022971-110022993 GCTGCCAGCAAATATAAAGCAGG + Intergenic
962409817 3:135131274-135131296 GCAGAAAGCAAATATTAAATCGG - Intronic
962965817 3:140353460-140353482 GCTGCCAGCAAATATAAAACAGG - Intronic
963134078 3:141884616-141884638 GCTGCCAGCAAATATAAAGCTGG + Intronic
963933675 3:151030521-151030543 GCTTCCAGCAAATATAAAGCAGG + Intergenic
963969993 3:151419450-151419472 GCTGCCAGCGAATATAAAGCAGG - Intronic
964148361 3:153493699-153493721 GCTGCCACCAAATATAAAGCAGG - Intronic
967156628 3:186698333-186698355 GCTGCCAGCAAATATAAAGCAGG - Intergenic
967160085 3:186728192-186728214 GTAGCTAGCGAATGTTAAGATGG + Intronic
967832110 3:193928510-193928532 GCTTCTAGCAAATACAAAGCAGG + Intergenic
969877004 4:10143000-10143022 GCTGCCAGCAAATATAAAGCAGG - Intergenic
970127255 4:12828811-12828833 GCTTCCAGCAAATATAAAGCAGG + Intergenic
970366826 4:15367783-15367805 GCACCTAGCAAATGTTAGCCAGG + Intronic
970839719 4:20453032-20453054 GCAGCTAGCAGATATTTTGAGGG - Intronic
971160983 4:24133822-24133844 GCACCTAGCAAATATTAACTGGG - Intergenic
972192473 4:36611703-36611725 GCTGCCAGCAAATATACAGCAGG + Intergenic
972200977 4:36714690-36714712 GCTGCCAGCAAATATAAAGCAGG - Intergenic
972201716 4:36720745-36720767 GCTGCCAGCAAATATAAAGCAGG - Intergenic
972831670 4:42820938-42820960 GCCTCCAGCAAATATAAAGCAGG - Intergenic
973672546 4:53236152-53236174 GCTGCCAGCGAATATAAAGCAGG + Intronic
974492606 4:62586785-62586807 GCTGCCAGCAAATATAAAGCAGG + Intergenic
974508881 4:62811030-62811052 GCTGCCAGCAAATACAAAGCAGG + Intergenic
975860037 4:78667406-78667428 GCAGCTAGAAAGTATTAAGTGGG - Intergenic
975983037 4:80180554-80180576 GCTGCCAGCAAATATAAAGCAGG - Intergenic
976354594 4:84102453-84102475 GCTGCCAGCAAATATAAAGCAGG + Intergenic
977040365 4:92009050-92009072 GTTGCTAGCAAATATAAAGCTGG + Intergenic
977050549 4:92123893-92123915 GCAGATAGCAAATATTATATAGG + Intergenic
978442671 4:108750277-108750299 GCTGCCAGCGAATATAAAGCAGG + Intronic
978893923 4:113862761-113862783 GCTGCTAGTGAATATAAAGCAGG + Intergenic
978899528 4:113930369-113930391 GCTGGCAGCAAATATAAAGCAGG - Intronic
979767284 4:124476802-124476824 GCTGCCAGCGAATATAAAGCAGG + Intergenic
979966515 4:127083192-127083214 AGAGCTAGCAATTATAAAGCTGG + Intergenic
980388344 4:132114780-132114802 GCTTCCAGCAAATATAAAGCAGG - Intergenic
980406330 4:132357342-132357364 GCTGCCAGCAAATATAAAGCAGG - Intergenic
980471063 4:133252028-133252050 ACAGTTAGAAAATATTAAGATGG - Intergenic
980602187 4:135039857-135039879 GTTGCCAGCAAATATAAAGCAGG - Intergenic
981055374 4:140355132-140355154 GCTGCCAGCGAATATAAAGCAGG + Intronic
981535266 4:145793545-145793567 GCTGCCAGCAAATATAAAGCAGG - Intronic
981900867 4:149860961-149860983 GCTGCCAGTAAATATGAAGCAGG - Intergenic
982851707 4:160325646-160325668 GCTTCCAGCAAATATAAAGCAGG - Intergenic
983129056 4:163992039-163992061 GCAGCTGACAAAGATCAAGCTGG - Intronic
983785182 4:171721136-171721158 GCTGCCAGCAAATATAAAACAGG - Intergenic
985191736 4:187381946-187381968 GCTGCCAGCAAATATAAAGCAGG - Intergenic
986036730 5:3947919-3947941 GCTGCCAGCAAATATAAAGCAGG - Intergenic
986037478 5:3954026-3954048 GCTGCCAGCGAATATAAAGCAGG - Intergenic
986671047 5:10142886-10142908 GCAGCCATCGAATATAAAGCAGG + Intergenic
986694290 5:10338429-10338451 GCCGCCAGCGAATATAAAGCAGG + Intergenic
987125161 5:14805147-14805169 GCTGCCAGCGAATATAAAGCAGG + Intronic
987621386 5:20341277-20341299 GCAACCAGCGAATATAAAGCAGG + Intronic
987657541 5:20825243-20825265 GCTGGCAGCAAATATAAAGCAGG - Intergenic
987668698 5:20980700-20980722 GCTTCCAGCAAATATAAAGCAGG - Intergenic
987885188 5:23804297-23804319 GCTGCCAGCAAATATAAAGCAGG + Intergenic
987906412 5:24083277-24083299 GCTGCCAGCAAATATAAAGCAGG + Intronic
988056459 5:26104121-26104143 GCTTCTAGCAAATATAAGGCAGG - Intergenic
988766001 5:34378708-34378730 GCTGGCAGCAAATATAAAGCAGG + Intergenic
988954320 5:36299059-36299081 GCTGCCAGCAAATACAAAGCAGG + Intronic
989044838 5:37264769-37264791 GCTGCCAGCAAATATGAACCAGG - Intergenic
989244026 5:39233192-39233214 AGAGCTAGCAAATATTTGGCTGG + Intronic
989307184 5:39972096-39972118 GCTGATAGAAAATATAAAGCAGG - Intergenic
989365571 5:40652057-40652079 GCTGCCAGCGAATATGAAGCAGG - Intergenic
989714315 5:44443136-44443158 GCAGCTCACAAAGATAAAGCAGG - Intergenic
991013467 5:61908379-61908401 GCTGCCAGCGAATATAAAGCAGG - Intergenic
991033879 5:62108430-62108452 GCTGCCAGCGAATATAAAGCAGG + Intergenic
991133548 5:63154749-63154771 GCTGCCAGCGAATATAAAGCAGG + Intergenic
991525742 5:67555991-67556013 GCCACTAGCGAATATAAAGCAGG - Intergenic
992481877 5:77159360-77159382 GCTGCCAGCAGATATAAAGCAGG + Intergenic
992868958 5:80986854-80986876 GCCAACAGCAAATATTAAGCAGG - Intronic
993196985 5:84761673-84761695 GGAGCAAGCAAATAAAAAGCTGG - Intergenic
993296500 5:86147809-86147831 GCTGCCAGCGAATATAAAGCAGG - Intergenic
993413021 5:87595372-87595394 GCAGCCAGTGAATATAAAGCAGG - Intergenic
994494805 5:100498398-100498420 GCTGATAGCAGATATAAAGCAGG - Intergenic
994984056 5:106912951-106912973 GCTGCTAGCGAATATAAAGCAGG - Intergenic
994984850 5:106919235-106919257 GCTGCCAGCGAATATAAAGCAGG - Intergenic
996651505 5:125882581-125882603 GCAGATAGGAAATATTAAGTTGG + Intergenic
996922520 5:128785432-128785454 GTTGCTAGCAAATATAAAGCAGG - Intronic
998198030 5:140092925-140092947 GAAGCTAGGAAGTATTAACCTGG - Intergenic
998748031 5:145284033-145284055 GCACCTAGAAAACAGTAAGCCGG - Intergenic
1001006645 5:168057489-168057511 GCAGCTAGCTAGTTTTAGGCAGG - Intronic
1001151282 5:169229856-169229878 GCACCCAGCAAAAATTAAGGGGG + Intronic
1003663779 6:8089557-8089579 GCTGCCAGCAAACATAAAGCAGG - Intronic
1003695575 6:8403657-8403679 GCTGCCAGCAAATATAAAACAGG - Intergenic
1003696357 6:8409707-8409729 GCCACCAGCAAATATAAAGCAGG - Intergenic
1003758926 6:9152588-9152610 GCCGCCACCAAATATAAAGCAGG + Intergenic
1003795528 6:9598450-9598472 TAAGCTAGCAAAGATTAAGCTGG + Intronic
1007101725 6:39252713-39252735 GCAGCTAGCAAGTAATGTGCAGG - Intergenic
1008721180 6:54354994-54355016 GCAAATAGCAAAGATTAAGCAGG + Intronic
1008996259 6:57662991-57663013 GCTGCCAGCAAAAATAAAGCAGG + Intergenic
1009730024 6:67589960-67589982 GCTGCCAGCAAATATAAAGCAGG + Intergenic
1010291825 6:74146527-74146549 GCTGCCAGCGAATATAAAGCAGG - Intergenic
1010818099 6:80384213-80384235 GCTGCCAGCAAATATAAAGCAGG + Intergenic
1010818951 6:80390923-80390945 GCTGGCAGCAAATATAAAGCAGG + Intergenic
1010868072 6:81005121-81005143 GCTGCCAGCAAATATAAAGCAGG + Intergenic
1011026542 6:82875555-82875577 GCTGCCAGCGAATATAAAGCAGG - Intergenic
1011491327 6:87896474-87896496 GCTGCCAGCAAATATAAAGCAGG - Intergenic
1012646537 6:101690681-101690703 GGAGCAAGCAAATATGAGGCTGG - Intronic
1012746758 6:103100977-103100999 GCTGCCAGCGAATATAAAGCAGG + Intergenic
1012920416 6:105216735-105216757 GCTGCCAGCAAATATAAAGCAGG - Intergenic
1012921244 6:105223019-105223041 GCTGCCAGCAAATATAAAGCAGG - Intergenic
1013974937 6:116066198-116066220 GCTGCCAGCAAATAAAAAGCAGG + Intergenic
1014417307 6:121197926-121197948 GCTGCTAGAGAATATAAAGCAGG + Intronic
1014418844 6:121216162-121216184 GCTGCCAGCAAATATAAAGCAGG + Intronic
1014456281 6:121638268-121638290 GCTGCCAGCCAATATAAAGCAGG - Intergenic
1014502708 6:122212560-122212582 GAAGATAGAAAATATGAAGCAGG + Intergenic
1014534652 6:122600251-122600273 GCTGCCAGCAAATATAAAGCAGG - Intronic
1014700941 6:124686910-124686932 GCTGCCAGCAAATAGAAAGCAGG + Intronic
1014971384 6:127819434-127819456 GCAGCTTCAAAACATTAAGCAGG + Intronic
1014982992 6:127967132-127967154 GCTGCCAGCAAATATAAAGCAGG + Intergenic
1015060706 6:128961628-128961650 GCCGCCAGCAAATATAAAGCAGG - Intronic
1015376593 6:132516826-132516848 GCTGCCAGCAAATATAAAGCAGG + Intergenic
1015443391 6:133273319-133273341 GCTGCCAGCGAATATAAAGCAGG - Intronic
1015570104 6:134612066-134612088 GCTGCCATCAAATATAAAGCAGG + Intergenic
1015699580 6:136021346-136021368 CCAGCTAGGAAATATTTTGCAGG - Intronic
1016594696 6:145786276-145786298 GCTGCCAGCAAATATAAAGCAGG - Intergenic
1016903808 6:149129365-149129387 GCTGCCAGCGAATATAAAGCAGG - Intergenic
1017173813 6:151483095-151483117 GCTGCCAGCAAATATAAAGCAGG - Intergenic
1017461611 6:154656250-154656272 GCTGCCAGCAAATATAAAGCAGG + Intergenic
1017558729 6:155604035-155604057 GCTGCCGGCAAATATGAAGCAGG - Intergenic
1018772261 6:166981537-166981559 ACAGATGGCAAATATTAAGTGGG - Intergenic
1018894716 6:168005761-168005783 GCCGCCAGCAAATATAAAGCAGG - Intronic
1020883520 7:13793719-13793741 GCTGCCAGCGAATATAAAGCAGG - Intergenic
1020960907 7:14800421-14800443 GCTGTCAGCAAATATAAAGCAGG + Intronic
1021152412 7:17167664-17167686 GCTGCCAGCAAATATAAAGCAGG - Intergenic
1021398123 7:20175866-20175888 GAATATAGCAAATATAAAGCTGG + Intronic
1021692639 7:23245844-23245866 GCAGTTACCAAAAATTATGCAGG + Intronic
1022197228 7:28081097-28081119 GCAGCTGGCAGAGATAAAGCAGG + Intronic
1022234527 7:28448093-28448115 GCTGCCAGCGAATATAAAGCAGG + Intronic
1022962482 7:35441667-35441689 GCTGCCAGCAAATGTAAAGCAGG - Intergenic
1024040866 7:45552666-45552688 GCTGTCAGCAAATATAAAGCAGG + Intergenic
1024654934 7:51444079-51444101 GCTGCCAGCCAATATAAAGCAGG - Intergenic
1024683341 7:51717514-51717536 GCTGCCAGCGAATATAAAGCAGG + Intergenic
1024958712 7:54952677-54952699 GCTGCCAGCGAATATAAAGCAGG - Intergenic
1026324299 7:69295568-69295590 GCTGCCAGCAAATATAAAGCAGG - Intergenic
1027853509 7:83479560-83479582 GAAGATAGTAAATATTAAGGCGG + Intronic
1028262727 7:88685243-88685265 GCTGCCAGCAAATATAAAGCAGG - Intergenic
1028828290 7:95299586-95299608 GCTGCCAGCGAATATAAAGCAGG + Intronic
1028935334 7:96457588-96457610 GCTGCCAGCAAATATAAGGCAGG + Intergenic
1029148693 7:98465017-98465039 GCAGCCAGACAATATTAATCTGG + Intergenic
1029277156 7:99413109-99413131 GCAGGTAGTAAAGATTCAGCAGG - Intronic
1030435536 7:109514628-109514650 GCTGCCAGCAAATATAAAGCAGG - Intergenic
1030527188 7:110668410-110668432 GCAGCTATCAAATTTTAAAAAGG - Intronic
1030930976 7:115523157-115523179 GCTGCAAGCAAATTTAAAGCAGG - Intergenic
1031225262 7:119028965-119028987 GCAGGTAGCAAATATAATGTGGG - Intergenic
1031239237 7:119217189-119217211 GCTGCCAGCAAATACAAAGCAGG + Intergenic
1031418951 7:121526616-121526638 GCTGCCAGCAAATATAAAGCAGG - Intergenic
1032152774 7:129444464-129444486 GCTGCCAGCAAATATAAAACAGG - Intronic
1033632945 7:143179035-143179057 GCTGCCAGCAAATATAAAGCAGG - Intergenic
1035816103 8:2542692-2542714 GCTGCCAGCGAATATAAAGCAGG + Intergenic
1036661528 8:10712129-10712151 GCTGCCAGCACATATAAAGCAGG - Intronic
1036990086 8:13582465-13582487 GCTGCCAGCAAATATAAAGCAGG + Intergenic
1037325158 8:17681568-17681590 GCACTTAGTAAATATTAGGCTGG + Intronic
1037621847 8:20570837-20570859 GCTGCCAGCGAATATAAAGCAGG + Intergenic
1038202456 8:25426466-25426488 GCTGCCAGCAAATATAAAGCAGG - Intergenic
1040579414 8:48684632-48684654 TCTACTAGCAAATATTAAGATGG - Intergenic
1040912248 8:52530930-52530952 GCTTCCAGCAAATATAAAGCAGG + Intergenic
1042000746 8:64121477-64121499 TCTGCCAGCAAATATAAAGCAGG - Intergenic
1042001498 8:64127616-64127638 TCTGCCAGCAAATATAAAGCAGG - Intergenic
1044882427 8:96737567-96737589 GCTTCCAGCAAATATAAAGCAGG - Intronic
1045781506 8:105869385-105869407 GCTGCCAGCAAATATAAAGCAGG - Intergenic
1045868281 8:106894797-106894819 GCTGCCAGCAAATATAAAGCAGG - Intergenic
1046585459 8:116145254-116145276 GCTGCCAGCAAATATAAAGCAGG - Intergenic
1046586220 8:116151229-116151251 GCTGCCAGCAAATATAAAGTAGG - Intergenic
1046586235 8:116151350-116151372 GCTGCCAGCAAATATAAAGCAGG - Intergenic
1046956701 8:120069509-120069531 GCTGCCAGCGAATATGAAGCAGG + Intronic
1048341582 8:133543742-133543764 GCACCTGGCACATAATAAGCTGG + Intronic
1048908823 8:139114794-139114816 GCTGCCAGCAAATATAAAGCAGG - Intergenic
1051056241 9:12990481-12990503 GCTGCCAGCAAATATAAAGCAGG - Intergenic
1051505836 9:17826704-17826726 GCTGCCAGCGAATATAAAGCAGG - Intergenic
1052003304 9:23315064-23315086 GCTGCCAGCAAATATAAAGCAGG + Intergenic
1052725274 9:32221537-32221559 GCTGCCAGCGAATATAAAGCAGG - Intergenic
1053695588 9:40636516-40636538 GCTGCCAGCAAATATAAAGCAGG + Intergenic
1053942577 9:43267559-43267581 GCTGCCAGCAAATATAAAGCAGG + Intergenic
1054306835 9:63435738-63435760 GCTGCCAGCAAATATAAAGCAGG + Intergenic
1054405566 9:64759728-64759750 GCTGCCAGCAAATATAAAGCAGG + Intergenic
1054439191 9:65245217-65245239 GCTGCCAGCAAATATAAAGCAGG + Intergenic
1054491215 9:65776724-65776746 GCTGCCAGCAAATATAAAGCAGG - Intergenic
1054843747 9:69770701-69770723 GCTGCCAGCGAATATAAAGCAGG - Intergenic
1055903617 9:81268680-81268702 GCTGCCAGCAAATATAAAGCAGG - Intergenic
1056156529 9:83844082-83844104 GCTGCCAGCGAATATGAAGCAGG + Intronic
1056313922 9:85370415-85370437 GCTGCTAGCAAATATAAAGCAGG - Intergenic
1058073814 9:100630148-100630170 GTAGCTAGGTAATATTAAGTAGG + Intergenic
1058181984 9:101809510-101809532 GCCACCAGCAAATATAAAGCAGG + Intergenic
1058487076 9:105452431-105452453 ACAGCTAGCAAATAGTAGTCTGG + Intronic
1058686241 9:107482838-107482860 GCACTTAGCAAATATAAAGATGG + Intergenic
1202778033 9_KI270717v1_random:10132-10154 GCTGCCAGCAAATATAAAGCAGG + Intergenic
1186780561 X:12907994-12908016 GCAGCTTACAAATATCAAGTAGG - Intronic
1188048817 X:25459385-25459407 GCTGCCAGCGAATATAAAGCAGG + Intergenic
1188406094 X:29811458-29811480 GCTGCCAGCAAATATAAAGCAGG - Intronic
1190461687 X:50682943-50682965 GCTGCCAGCAAATATAAAGCAGG + Intronic
1190548957 X:51558924-51558946 GCAGCTTGCACCTATGAAGCAGG + Intergenic
1190578533 X:51867535-51867557 GCTGCCAGCGAATATAAAGCAGG - Intronic
1190940415 X:55035025-55035047 GCTGCCAGCAAATATAAAGCAGG - Intergenic
1191721835 X:64237292-64237314 GCTGCCAGCAAATATAAAACAGG - Intergenic
1191975938 X:66870996-66871018 GCATCTAGCCAAGATTAAACAGG + Intergenic
1193053811 X:77128278-77128300 GCTGCCAGCAAATTTAAAGCAGG + Intergenic
1193415036 X:81211656-81211678 GCTTCCAGCAAATATAAAGCAGG + Intronic
1193433315 X:81438990-81439012 GCAGCCAGCAAATATAAAGCAGG - Intergenic
1193928023 X:87514663-87514685 GCTGCCAGCGAATATAAAGCAGG + Intergenic
1194208833 X:91044050-91044072 GCTACCAGCAAATATAAAGCAGG + Intergenic
1194209861 X:91059006-91059028 GCTGCCAGGAAATATGAAGCAGG + Intergenic
1195235983 X:102898703-102898725 GCTTCCAGCAAATATAAAGCAGG - Intergenic
1195781976 X:108477055-108477077 GCTGCCAGCGAATATAAAGCAGG - Intronic
1195782816 X:108483455-108483477 GCTGCCAGCGAATATAAAGCAGG - Intronic
1195881529 X:109597608-109597630 GCTGCCAGCGAATATAAAGCAGG + Intergenic
1196324004 X:114379737-114379759 GCCACCAGCAAATATAAAGCAGG - Intergenic
1197116070 X:122835147-122835169 GCTGCCAGCGAATATAAAGCAGG + Intergenic
1197386819 X:125812596-125812618 GCTGCCAGTAAATATAAAGCAGG + Intergenic
1197405474 X:126042713-126042735 GCTGCCAGCAAATGTAAAGCAGG + Intergenic
1198144533 X:133841814-133841836 GCTTCCAGCAAATATAAAGCAGG + Intronic
1198307019 X:135393526-135393548 GCTGCCAGCGAATATAAAGCAGG + Intergenic
1198307236 X:135395267-135395289 GCTGCCAGCAAATATAAAGCAGG + Intergenic
1198412179 X:136381921-136381943 GCTTCCAGCAAATATAAAGCAGG - Intronic
1198542534 X:137655090-137655112 GCAGTTACCAATTATTGAGCAGG + Intergenic
1198653777 X:138891764-138891786 GCTGCCAGCGAATATAAAGCAGG + Intronic
1198661311 X:138970979-138971001 GCAGTTAACAAAGATTAAGTGGG + Intronic
1199023955 X:142916117-142916139 GCTGCCAGCGAATATAAAGCAGG + Intergenic
1199024685 X:142922243-142922265 GCTGCTAGAAAATATAAAGTAGG + Intergenic
1201193361 Y:11468424-11468446 GCTGCCAGCAAATATAAAGCAGG + Intergenic