ID: 1170273420

View in Genome Browser
Species Human (GRCh38)
Location 20:14554411-14554433
Sequence CTGTGCAACCCATCTGTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 96}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170273414_1170273420 26 Left 1170273414 20:14554362-14554384 CCACTTTGCTGGGAGACTGAAGC 0: 1
1: 0
2: 0
3: 27
4: 291
Right 1170273420 20:14554411-14554433 CTGTGCAACCCATCTGTGGTGGG 0: 1
1: 0
2: 0
3: 7
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170273420 Original CRISPR CTGTGCAACCCATCTGTGGT GGG Intronic
903433740 1:23330144-23330166 CTCTGCAAAACATCAGTGGTAGG + Intronic
909693922 1:78442508-78442530 CTGTTCTACCCATCTGTGTATGG - Intronic
911159670 1:94671943-94671965 CTTTGCTGCCCATCTTTGGTGGG + Intergenic
916613952 1:166420938-166420960 CTGTGCACCCAATCTGTCCTTGG + Intergenic
1067816478 10:49481571-49481593 CTGTGCATCCCTTCTTGGGTGGG - Intronic
1068504087 10:57877152-57877174 CTGTGCAACTCATCTGTTCAAGG - Intergenic
1071479118 10:86049891-86049913 CTTTGCAAACCAGCTGTGGAAGG - Intronic
1076553296 10:131302516-131302538 CTCTGCGAGCCATCTTTGGTAGG + Intronic
1077892584 11:6430190-6430212 CTTTACAACCCAGCTGAGGTTGG - Intergenic
1080923378 11:36731141-36731163 CTTTGCAGCAGATCTGTGGTGGG - Intergenic
1081782729 11:45724342-45724364 CAGGGTAACCCATCTGTAGTAGG - Intergenic
1086900544 11:92362564-92362586 CTGTTCCACCCATCTGTGGAGGG - Intronic
1087856082 11:103092855-103092877 CTCTGCAAACCAACTGTGATGGG + Intergenic
1089103349 11:115982375-115982397 CTGAGCAACCCATCTGGGTCAGG - Intergenic
1094278974 12:28713557-28713579 CAGTGCCACCCATCTGTACTGGG - Intergenic
1114533992 14:23411807-23411829 CTAAGCAACCCAGCTGTGGCAGG + Intergenic
1117033634 14:51703661-51703683 CAGTCCAAACCATCTGTGGTTGG + Intronic
1118385727 14:65254232-65254254 CTCTACAACCCAGCTGAGGTAGG + Intergenic
1121843268 14:97152019-97152041 CTGTGCTACCCCTCCCTGGTAGG + Intergenic
1126184439 15:45818020-45818042 CTGTTCAATCCATTTGTTGTAGG + Intergenic
1130295485 15:82645049-82645071 CTGTGCAGCACATCAGAGGTTGG - Intronic
1132728458 16:1348953-1348975 CTTTGCATCCCCTCTGTGGGTGG - Exonic
1135749304 16:25044221-25044243 CTGTGAAACCCATCTGGGTTTGG + Intergenic
1135833838 16:25804988-25805010 CTGTGTACCCCACCTGAGGTTGG - Intronic
1136278735 16:29194624-29194646 CTGTGCCTCCCATTGGTGGTGGG + Intergenic
1138133307 16:54500361-54500383 ATGTGAAAACCATCTGAGGTTGG - Intergenic
1140411701 16:74745013-74745035 GTGTCCAACCCATCTGTGTCAGG + Intronic
1141514280 16:84533031-84533053 CTGTGCAACCCTTCTTGGGGAGG - Intronic
1142797976 17:2323654-2323676 GTGTGCAACCCAGCTGGTGTGGG + Exonic
1143345478 17:6245838-6245860 CTGTGCATCCCATCTCTTGGAGG + Intergenic
1147660754 17:42115647-42115669 CTGTCCAGCCCCTCTGTGGATGG - Intronic
1152629209 17:81402231-81402253 ATGTTCAACCCATTTGTGATGGG + Intronic
1154104167 18:11505772-11505794 CTGCAAACCCCATCTGTGGTTGG - Intergenic
1155645348 18:28070834-28070856 ATGAGCAATCCATCAGTGGTAGG + Intronic
1156480675 18:37434596-37434618 CTGTGCCACCCCTCCCTGGTGGG + Intronic
1161131007 19:2588688-2588710 CTGGGTAACCCAGCTGGGGTTGG - Intronic
928229709 2:29487268-29487290 CTCTGCAGCCCAGCTCTGGTAGG - Intronic
931181918 2:59910112-59910134 CTGTGAAACCAGTCTGTGGAAGG + Intergenic
933091567 2:78125815-78125837 CTGTGCTTCCCACCTGTGGCAGG + Intergenic
933637694 2:84725397-84725419 CTTTGAAAGCCATCTGTGCTGGG + Intronic
935589166 2:104829969-104829991 GTGTGCAGCTCATCTGTTGTTGG - Intergenic
938003249 2:127764022-127764044 TTGTGCCACCCATGTGTGGGAGG - Intronic
939234057 2:139468287-139468309 CTGTGCACCCTATCTGCAGTGGG + Intergenic
942880602 2:180856944-180856966 CTGTAATACCCATGTGTGGTGGG - Intergenic
943684075 2:190798395-190798417 CTGTTCTACCCACCTGGGGTAGG + Intergenic
1170252649 20:14302455-14302477 CTTTGCTACCTCTCTGTGGTAGG - Intronic
1170273420 20:14554411-14554433 CTGTGCAACCCATCTGTGGTGGG + Intronic
1171096564 20:22337577-22337599 CTGTGCTACCAATCTATAGTTGG - Intergenic
1176222093 20:63974577-63974599 CTGAGCAACCCCTCTCTGGGTGG - Exonic
1179173492 21:38990996-38991018 CTGTGCTGCCCTTCTGTGCTGGG + Intergenic
1179356577 21:40665721-40665743 CTGGGCACCCCATCTGTGCCGGG + Intronic
1183929085 22:41225836-41225858 CAGTCCAAGCCATCTGTGGAGGG - Exonic
949110213 3:251230-251252 ATGTGGAATCCATCTGTGCTGGG + Intronic
949193739 3:1281269-1281291 CTGTGAGAGCCATGTGTGGTAGG - Intronic
950031922 3:9859380-9859402 CTGAGCACCCCATCTGCAGTAGG + Intergenic
950053821 3:10010486-10010508 CTGAGCACCCCATCTGCAGTAGG + Intronic
950142610 3:10625674-10625696 CAGGGCTACCCCTCTGTGGTGGG + Intronic
950415609 3:12867458-12867480 CTGAGCACCCCATCTGCAGTAGG + Intronic
950575315 3:13828712-13828734 CTCTGAAACCCCTCTGAGGTTGG + Intronic
953384056 3:42495473-42495495 CTGTGTATCCCTCCTGTGGTTGG + Intronic
955321557 3:57978333-57978355 CTTTGCCACCTATATGTGGTTGG - Intergenic
958535541 3:95398414-95398436 CTGTGCACCACATCTGGTGTGGG + Intergenic
958624733 3:96609624-96609646 CTGTTCACCGCATCTGCGGTGGG - Intergenic
961783978 3:129338388-129338410 CTGAGCACCCCATCTGCAGTAGG + Intergenic
961785227 3:129343464-129343486 CTGAGCACCCCATCTGCAGTAGG + Intergenic
962221836 3:133570995-133571017 CTGTGCAACCAATCTGGAGAAGG + Intergenic
981434053 4:144699152-144699174 ATGGGCATCCCATTTGTGGTTGG - Intronic
986168737 5:5298126-5298148 CTATGCAAACCAACTGTGGCTGG + Intronic
988610855 5:32723322-32723344 CTGTGTAGCCCTTATGTGGTAGG + Intronic
994095840 5:95846715-95846737 CTGTGCCGCCCATCTGTGCCTGG - Intergenic
997047943 5:130342364-130342386 ATGTGCAAAGCCTCTGTGGTAGG + Intergenic
999040071 5:148399369-148399391 CTGTTCCACACATCTGTGATTGG + Intronic
1002836963 6:873181-873203 CTGTCCTACCCATCTGATGTGGG + Intergenic
1002944411 6:1747216-1747238 CCGTGCATGCCTTCTGTGGTGGG + Intronic
1003856800 6:10284717-10284739 CTATGCCTCCCATCTCTGGTAGG - Intergenic
1006730041 6:36230001-36230023 CTGATAAACTCATCTGTGGTGGG - Intronic
1007849967 6:44793423-44793445 CTGTGCCTCTCATCTGTGGCCGG - Intergenic
1011768544 6:90650743-90650765 CTGTGAAATCGATCTGTGTTGGG - Intergenic
1013829870 6:114258469-114258491 CTGTGCAACACGTTTGGGGTAGG + Intronic
1013845984 6:114452239-114452261 CTCTGCCACCCATCTGTGGGTGG + Intergenic
1014250403 6:119110135-119110157 CTGGGCTACCCATCTGTAGGTGG - Intronic
1015896846 6:138025937-138025959 CTGTGCATCTCATCTGGGGTGGG + Intergenic
1018361542 6:163075864-163075886 CTGTGCAACCTGTCTGTTGCAGG + Intronic
1019527896 7:1488979-1489001 CTGTCTAACCCATCTCTGGCCGG + Intronic
1023734270 7:43220913-43220935 CTGTGCAGACCATGTGTGGCTGG + Intronic
1028097572 7:86781032-86781054 CTGAGGAACCCATAAGTGGTAGG - Intronic
1032464221 7:132133808-132133830 CTGCGCAACCCCCCTCTGGTGGG - Intronic
1033469288 7:141629918-141629940 CTGTGCAACCCTTCTTTGGGAGG - Intronic
1034496725 7:151427597-151427619 CTGTGGAACCCAGCTGGCGTGGG - Intergenic
1035286943 7:157812766-157812788 CCCAGCTACCCATCTGTGGTGGG - Intronic
1040344526 8:46476733-46476755 CTGTGAAACCACTTTGTGGTGGG - Intergenic
1040781780 8:51117820-51117842 CCAGGCAACCCATCTGTGGCTGG + Intergenic
1042580580 8:70273726-70273748 CTGTCCAAACAATCTGTGGGTGG + Intronic
1046122731 8:109865783-109865805 CTGAGCAACCAATTTGTGGCAGG - Intergenic
1050381889 9:5040514-5040536 TTGTGGAACCCATTTGTGGGTGG - Intronic
1052498210 9:29255721-29255743 CTGCCCAAATCATCTGTGGTTGG - Intergenic
1054869999 9:70040412-70040434 CTCTGCAAAACGTCTGTGGTAGG + Intergenic
1056023320 9:82464437-82464459 CTGAGCACCCCATTTGTGGCTGG + Intergenic
1056786707 9:89597754-89597776 CTGTGCAACTCAGCTGTACTTGG - Intergenic
1057220274 9:93253852-93253874 ATGGGCAACCCCTCTGTGGCTGG - Intronic
1058509121 9:105696744-105696766 CTGTCCTACACATCTCTGGTTGG - Intronic
1060587662 9:124796463-124796485 CTGTGGAAACCATCTCTGGTTGG - Intronic
1189483183 X:41408651-41408673 CTGTAGACCCCATCTGGGGTTGG + Intergenic
1198848194 X:140936384-140936406 TTGTGCAACCACACTGTGGTAGG - Intergenic