ID: 1170275634

View in Genome Browser
Species Human (GRCh38)
Location 20:14583744-14583766
Sequence GACTCACTTTAAACACTGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 112}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170275632_1170275634 -7 Left 1170275632 20:14583728-14583750 CCTATCCATGGTACATGACTCAC 0: 1
1: 0
2: 0
3: 7
4: 74
Right 1170275634 20:14583744-14583766 GACTCACTTTAAACACTGACAGG 0: 1
1: 0
2: 0
3: 10
4: 112
1170275631_1170275634 -6 Left 1170275631 20:14583727-14583749 CCCTATCCATGGTACATGACTCA 0: 1
1: 0
2: 1
3: 5
4: 109
Right 1170275634 20:14583744-14583766 GACTCACTTTAAACACTGACAGG 0: 1
1: 0
2: 0
3: 10
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170275634 Original CRISPR GACTCACTTTAAACACTGAC AGG Intronic
903045306 1:20560072-20560094 GACTCAATTAAAAAACTGGCTGG - Intergenic
909103916 1:71384765-71384787 GACCCACTGTAACCACTAACTGG - Intergenic
909638257 1:77842479-77842501 GACCTACTTTAAAAACTGAATGG - Intronic
912131265 1:106604097-106604119 GATTCAGTGTAAAAACTGACTGG - Intergenic
916165154 1:161960220-161960242 GACTCACTTTAGAAACTGAAAGG - Exonic
917683855 1:177396025-177396047 AAATGACTTTATACACTGACAGG + Intergenic
919797486 1:201330031-201330053 ATCTCACTGTAAACACTAACTGG + Intronic
924096975 1:240562371-240562393 GACTGAAATTAAAAACTGACAGG + Intronic
1069841305 10:71341094-71341116 GACCCACTTTAACCAATGAGAGG - Intronic
1073960980 10:108927790-108927812 CACTATCATTAAACACTGACTGG - Intergenic
1077235154 11:1478408-1478430 GAGTGACTTTGGACACTGACTGG + Intronic
1078984227 11:16575726-16575748 GACTAACATTAAACACAGAATGG + Intronic
1079358390 11:19749476-19749498 GACTGAATCTAAACTCTGACAGG - Intronic
1081512921 11:43794602-43794624 CAATCACTTTAAACATTCACCGG + Intronic
1085323321 11:75588149-75588171 GTCTTACTTGAATCACTGACGGG + Exonic
1087949846 11:104207639-104207661 GACTGACTTTGAACACTGTCTGG - Intergenic
1090916769 11:131171442-131171464 GACTCACTTCAAACCCTGCTGGG + Intergenic
1092306438 12:7305899-7305921 GACTCACTTTATAGAATGATGGG + Intronic
1093793202 12:23279280-23279302 CACTCACTTAAAACACTATCAGG - Intergenic
1098540817 12:71654581-71654603 GATTAACTTTAAACACTGGTAGG + Intronic
1105903238 13:24776696-24776718 GACTGAGTTTAAACAATGAGTGG + Intronic
1108039641 13:46327880-46327902 GAATCAATTCAAACACTCACTGG - Intergenic
1108327666 13:49349705-49349727 CACCCACTTTATACACTAACCGG + Intronic
1109597993 13:64581950-64581972 TACTCACACTAAACACTGATGGG - Intergenic
1111521326 13:89408852-89408874 GACTCACTTTACCCAATGGCAGG - Intergenic
1115587944 14:34833986-34834008 GGCTGACTTTCACCACTGACTGG + Intronic
1120509846 14:85399887-85399909 GAAGCATTTTAAACAATGACTGG - Intergenic
1122685810 14:103505679-103505701 AAGTCCCTTTAAACACTGAGTGG + Intergenic
1125269952 15:37928043-37928065 GTCTCACTATAAAAAATGACAGG + Intronic
1129114643 15:73358400-73358422 GACTCACATTAATCATTAACAGG + Intronic
1129592944 15:76933207-76933229 GACCCACTTGGAACGCTGACAGG - Intronic
1131477606 15:92753580-92753602 GACTTACTTTCAACGCTGAAAGG + Intronic
1136282710 16:29223130-29223152 GTCTCACTAAAAACACTGAAAGG + Intergenic
1137627900 16:49921178-49921200 GACTCAATTTCAACAGGGACTGG + Intergenic
1142087085 16:88189055-88189077 GTCTCACTAAAAACACTGAAAGG + Intergenic
1143960299 17:10711801-10711823 GACTCCCTTTATACACTAATGGG + Intronic
1145964664 17:28908207-28908229 GAGGCACTTTAAACACTGCAGGG - Intronic
1149554370 17:57562680-57562702 TAGTCACTGCAAACACTGACAGG + Intronic
1150731039 17:67694218-67694240 CACTGCCTTTAAACACAGACGGG + Intronic
1151742338 17:75992198-75992220 GACTCAGATTAAAGGCTGACAGG - Intronic
1151753235 17:76054172-76054194 GGCTCAGTTTCAAAACTGACTGG + Intronic
1153112361 18:1607382-1607404 GACTCACTTGACATACTCACAGG + Intergenic
1160477983 18:79210062-79210084 GACTCAGGTTAGACACAGACAGG + Intronic
1164701614 19:30288755-30288777 GATGCACTTAAAACACTGCCTGG + Intronic
926341433 2:11907881-11907903 GACTGTCTTTAAACAGTGCCTGG - Intergenic
926801125 2:16661649-16661671 GACTGAGTTACAACACTGACTGG + Intronic
927955567 2:27205161-27205183 GACTCTCTATAAACACTAGCCGG + Intronic
928534845 2:32230022-32230044 GAGCAACTTTAAAAACTGACAGG + Intronic
930537230 2:52658571-52658593 GACTCACAGAAAACACTGAAAGG + Intergenic
931984520 2:67728699-67728721 GACTCACCGTTAGCACTGACAGG - Intergenic
933574975 2:84057121-84057143 GAAGCACTCTAAACACTAACAGG + Intergenic
937645722 2:124264142-124264164 GACTCCCCTTAAAAACTGTCTGG + Intronic
939044839 2:137238069-137238091 CACTCACCATAAACACTCACTGG - Intronic
941191449 2:162388750-162388772 GAAACACTTTTAAAACTGACTGG + Intronic
941294224 2:163715776-163715798 CACTCATTTTAAAAACTGATAGG + Intronic
942789975 2:179749797-179749819 GACTCAGTTTCCACACTGAAAGG + Intronic
948591706 2:239054555-239054577 GACTCACATTTAACCCCGACTGG - Intronic
1170275634 20:14583744-14583766 GACTCACTTTAAACACTGACAGG + Intronic
1174224846 20:48989421-48989443 TACTCACTTTGAACATTGGCCGG - Exonic
1174927490 20:54776620-54776642 TACTTACTTTAGAAACTGACAGG + Intergenic
1176931138 21:14811836-14811858 GTCTCACTATAAAAACTGATAGG + Intergenic
1178107473 21:29336314-29336336 GACTGAGTTTAAACATTCACTGG + Intronic
1178740655 21:35197388-35197410 GACTCACTAGAAAGACTTACAGG - Intronic
1179329954 21:40390353-40390375 ATCTCCCTTTAAAAACTGACAGG + Intronic
951175019 3:19589049-19589071 GTCTCAATTTAAACACTGTAAGG + Intergenic
954014161 3:47671429-47671451 TACACACGTAAAACACTGACAGG + Intronic
957978609 3:87479104-87479126 TACTGTGTTTAAACACTGACAGG + Intergenic
962756690 3:138470237-138470259 GGCTGACTTTAAACGCTGCCAGG - Intronic
964009508 3:151873729-151873751 GCCTTACTTTATACACTGAGAGG - Intronic
964978161 3:162644367-162644389 GACACACTAAAAAGACTGACAGG + Intergenic
968789517 4:2649864-2649886 GAGTGGCTATAAACACTGACAGG - Intronic
969570810 4:8007023-8007045 GAATCACTTTAAACAAAGAAAGG - Intronic
970876804 4:20880433-20880455 GAATCACTTTAAATACTAATGGG - Intronic
972068005 4:34976303-34976325 GAGTCACTTTAAGCCCTGAAAGG - Intergenic
972897091 4:43636826-43636848 TACTCACATAAAACACTGCCAGG - Intergenic
974478261 4:62410797-62410819 CACCCACTTTAAACACTAACAGG + Intergenic
979084474 4:116389349-116389371 GACTCACTTATACCACTGAATGG + Intergenic
979503219 4:121463499-121463521 GACTAACTTTAAAGAGTGAGAGG + Intergenic
980460822 4:133109865-133109887 CGCTAACTTTAAACAATGACTGG + Intergenic
982335342 4:154230763-154230785 CACTCATTTTAAAAACGGACTGG + Intergenic
986204652 5:5612163-5612185 GACTCTCTTGAACCTCTGACGGG - Intergenic
989494276 5:42093470-42093492 GTATCACGGTAAACACTGACTGG - Intergenic
991730979 5:69587658-69587680 GAATCACATTAAACACTTACTGG + Intronic
991807414 5:70442819-70442841 GAGTCACATTAAACACTTACTGG + Intergenic
991863971 5:71040198-71040220 GAATCACATTAAACACTTACTGG - Intronic
993239358 5:85360522-85360544 TACTGACATAAAACACTGACAGG + Intergenic
993419051 5:87676908-87676930 GACTCCCTTTATCCTCTGACAGG - Intergenic
995664846 5:114530424-114530446 CACTCACTTTTAAGACTGAAAGG - Intergenic
999962913 5:156776188-156776210 AACTGAATTTAAACACTGAGTGG - Intergenic
1003024064 6:2537815-2537837 GTCTGACTTTAGACAGTGACAGG - Intergenic
1003771110 6:9301969-9301991 GACTCAGATGAAACACTGACAGG + Intergenic
1004157726 6:13184791-13184813 GACTCTCTTCAGACACTGAGGGG - Intronic
1008457137 6:51724258-51724280 CACTCCCTTTGAACACTGAATGG - Intronic
1009746129 6:67818495-67818517 GAATCACTTTAAAAATTGTCTGG + Intergenic
1012210921 6:96517979-96518001 GACTCACTTTAAAATATGAAGGG - Intergenic
1015477217 6:133667443-133667465 GACACTCTTTAACCACTGAGGGG - Intergenic
1018264354 6:162006268-162006290 CATTCAATTTAAACACTGAATGG + Intronic
1018685237 6:166298925-166298947 GTCTCACATTCATCACTGACTGG - Intergenic
1018997849 6:168724081-168724103 GTCTCACCCTAACCACTGACTGG - Intergenic
1022325567 7:29328094-29328116 AACTCTCTTTAAAGACTCACAGG - Intronic
1034394943 7:150815229-150815251 GTTTCACTTAAAACACGGACCGG + Intergenic
1035004604 7:155645491-155645513 GACGCACATAAAACACTAACAGG - Intronic
1035586643 8:780580-780602 GACTCACGTTCACCACTGACGGG - Intergenic
1036448519 8:8844468-8844490 TGCTAACTTTAAACAATGACAGG - Intronic
1038155141 8:24982229-24982251 GAAGCACTTTCTACACTGACTGG - Intergenic
1038188887 8:25300642-25300664 GACTTACTGTAAACACTGCTTGG - Exonic
1038827081 8:31015744-31015766 GGCTCACTTTAAACACAGAGAGG - Intronic
1040082375 8:43300275-43300297 AACTCACTTTAAACATTTACTGG - Intergenic
1044323423 8:90832001-90832023 GACTCACTCTAAACCATTACTGG + Intronic
1046850104 8:118962309-118962331 AACTTCCTTTAAACACTAACTGG - Intergenic
1050778934 9:9305815-9305837 GCCTCACTTTAATCTCTGATTGG - Intronic
1051822862 9:21189177-21189199 GACTCTCAGTAAACACTGAATGG - Intergenic
1055310720 9:74976909-74976931 GACTCACTGTAATCACCTACTGG - Intergenic
1060467396 9:123919142-123919164 GAAAAACTTTGAACACTGACTGG + Intronic
1061893864 9:133636816-133636838 GAGTCAACTCAAACACTGACAGG - Intronic
1186112122 X:6269531-6269553 GAAGCACTTTAAATAGTGACTGG - Intergenic
1193670484 X:84378301-84378323 TAATCACTTTAATCACTCACAGG + Intronic
1196583453 X:117402216-117402238 GGCTCACTTTAAAGGATGACAGG - Intergenic
1200821765 Y:7591612-7591634 AACTCACTGTAATCATTGACAGG + Intergenic
1200876821 Y:8165018-8165040 AACTCACTGTAATCATTGACAGG + Intergenic
1201691650 Y:16773515-16773537 GACACTATTTAAATACTGACAGG + Intergenic
1202103789 Y:21339867-21339889 AACTCACTGTAATCATTGACAGG + Intergenic
1202238540 Y:22741142-22741164 AACTCACTGTAATCATTGACAGG - Intergenic