ID: 1170275921

View in Genome Browser
Species Human (GRCh38)
Location 20:14587988-14588010
Sequence CATTGGAAAATAGAAAAGTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 622
Summary {0: 1, 1: 0, 2: 5, 3: 48, 4: 568}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170275921_1170275923 -5 Left 1170275921 20:14587988-14588010 CCATACTTTTCTATTTTCCAATG 0: 1
1: 0
2: 5
3: 48
4: 568
Right 1170275923 20:14588006-14588028 CAATGTTATCTGTCTTTTTCTGG 0: 1
1: 0
2: 2
3: 42
4: 360
1170275921_1170275924 1 Left 1170275921 20:14587988-14588010 CCATACTTTTCTATTTTCCAATG 0: 1
1: 0
2: 5
3: 48
4: 568
Right 1170275924 20:14588012-14588034 TATCTGTCTTTTTCTGGATCTGG 0: 1
1: 0
2: 2
3: 22
4: 389
1170275921_1170275926 30 Left 1170275921 20:14587988-14588010 CCATACTTTTCTATTTTCCAATG 0: 1
1: 0
2: 5
3: 48
4: 568
Right 1170275926 20:14588041-14588063 GCTTATTTTAACTTTATAAAAGG 0: 1
1: 0
2: 3
3: 55
4: 538
1170275921_1170275925 8 Left 1170275921 20:14587988-14588010 CCATACTTTTCTATTTTCCAATG 0: 1
1: 0
2: 5
3: 48
4: 568
Right 1170275925 20:14588019-14588041 CTTTTTCTGGATCTGGTATCAGG 0: 1
1: 0
2: 75
3: 633
4: 1868

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170275921 Original CRISPR CATTGGAAAATAGAAAAGTA TGG (reversed) Intronic
900170420 1:1265426-1265448 CATTGGAAACTAAAACATTAGGG - Intronic
900303596 1:1990666-1990688 TGTTGGAAACTAGAAAACTATGG + Intronic
903765708 1:25732848-25732870 TATTGGAAAGGAGAAAAGAAAGG - Intronic
905593766 1:39188007-39188029 CAGAGGAAAAAAGAAAAGAAAGG - Intronic
905758652 1:40534679-40534701 TTTTGGTAAATAGAAAAATATGG + Intronic
906134318 1:43485573-43485595 CATTGGAAAAAAAAAAAAAAAGG - Intergenic
906270750 1:44476375-44476397 GAAAAGAAAATAGAAAAGTACGG + Intronic
906926355 1:50121565-50121587 CAAAGTAAAATAAAAAAGTAAGG - Intronic
907125313 1:52045190-52045212 CATTGGAAAAAGCAAAATTATGG + Intronic
907904962 1:58776180-58776202 CTTTGGAAACTACAAGAGTATGG + Intergenic
908136886 1:61142508-61142530 CCTTTGAAAATAGTAAACTATGG + Intronic
908404229 1:63798314-63798336 CAGTGCAAAATAAAAAAGTGGGG - Intronic
908409766 1:63851622-63851644 ATTTGGAAAACAGAAAAATAGGG - Intronic
908424982 1:63998255-63998277 AATTGTAAAGTAGAAAATTAGGG + Intronic
908608006 1:65821887-65821909 CAATATAAAATAGAAAAATAAGG + Intronic
908623954 1:66018918-66018940 CATTATAAAATATAAAATTATGG - Intronic
909048552 1:70740176-70740198 CACTGGAAAATTCAAGAGTAGGG - Intergenic
909429307 1:75568575-75568597 GTATGGAAAATAGAAAAGCAAGG - Intronic
909653726 1:78006140-78006162 CAATGCAAAAAACAAAAGTATGG - Intronic
910427598 1:87132274-87132296 CTTTCGAAAATAGAAAAATAGGG - Intronic
910596761 1:88989564-88989586 CTTTGGAAAATGGAAGAGAAAGG + Intronic
910729208 1:90373043-90373065 CATTTGAAAATATAAATGAAAGG - Intergenic
911843077 1:102709572-102709594 CATAAGAAAATAGAAGAGTTTGG + Intergenic
912079542 1:105917947-105917969 CAATGGAAAACAGAAAAAAAAGG - Intergenic
912144389 1:106773946-106773968 ACTTGAAACATAGAAAAGTAAGG + Intergenic
912746952 1:112252946-112252968 CCTTGGAAAATATGAAAGTGAGG + Intergenic
912802041 1:112725836-112725858 CATAAGAAAATAGAGAAGGAGGG + Intronic
914337456 1:146728420-146728442 CATTGGCAAATAGAAATATCTGG - Intergenic
916248624 1:162713037-162713059 CTTTTGACAATAGAAAAGTACGG - Intronic
916764294 1:167845394-167845416 CAATGGGGAAGAGAAAAGTAAGG - Intronic
918365155 1:183799787-183799809 TATTGCATAACAGAAAAGTAAGG - Intronic
919165726 1:193888976-193888998 AGTTGAAAAATAGAAAGGTAGGG + Intergenic
919687168 1:200494747-200494769 AATAGGAAAATAGAAAAGGGAGG + Intergenic
920577809 1:207074851-207074873 CATAGGACAACAGAAAAGTCAGG - Exonic
921291588 1:213662740-213662762 CATTGGGAAATAGACCAGTTTGG - Intergenic
921365034 1:214365434-214365456 CATGACAAAAGAGAAAAGTATGG + Intronic
921495100 1:215829892-215829914 CATTGGAAGAAAGAAAACTGTGG + Intronic
923308662 1:232712484-232712506 AATTGGGAAATAGAAAAGTGTGG - Intergenic
923861457 1:237896068-237896090 AATTAGAAAATATAAAATTAAGG + Intergenic
924014452 1:239705215-239705237 CATATGAAAAGAAAAAAGTATGG + Intronic
924442788 1:244100682-244100704 CAGTGGAAAAGAGAAAGGAAAGG - Intergenic
924780059 1:247139332-247139354 AAATGGAAAACAGAAAAGCAGGG - Intronic
924853290 1:247852359-247852381 CACTGGGAAAGAGAAAAGTAGGG + Intergenic
1063070857 10:2662464-2662486 CTTTGGAAAATAGACAACTAAGG - Intergenic
1063119577 10:3095942-3095964 CATTAAAAAATAGAAAGGGAGGG - Intronic
1065570195 10:27063280-27063302 CTTTAGAAAATGGAAAAGCAGGG - Intronic
1067170592 10:43902985-43903007 CATTGGAAAATAGCAACTTGTGG + Intergenic
1067525959 10:47038756-47038778 CAATGGAAAATAGACAGGCAGGG - Intergenic
1067978279 10:51051496-51051518 GATTGGCAAATAGGAAAGAAGGG - Intronic
1068029816 10:51692541-51692563 CATTGGAAAATGGTATAGTTGGG - Intronic
1068041673 10:51832998-51833020 CAATTGAAAATAGAAATCTAGGG + Intronic
1068070498 10:52188543-52188565 CATTGGAATAAAAAAAAGTTTGG + Intronic
1068383374 10:56289871-56289893 AATTGGAAAATAGGAAATCAAGG - Intergenic
1068410552 10:56648180-56648202 CTTTGGAATAAAGAGAAGTAAGG + Intergenic
1068844414 10:61655790-61655812 AATTGGAAAAGAGAACAGAAGGG - Intergenic
1069097399 10:64276026-64276048 CATTGGCAAATGGAAAATCAAGG - Intergenic
1069313436 10:67068156-67068178 CAGTGGAAAATAGAAGAGAAGGG + Intronic
1073682857 10:105723386-105723408 CATAGAGAAATAGCAAAGTAAGG - Intergenic
1074280450 10:112046725-112046747 GATTTAAAATTAGAAAAGTAAGG + Intergenic
1074284560 10:112085909-112085931 TATTTGAAAATTTAAAAGTATGG + Intergenic
1077772243 11:5232714-5232736 CATGGGAAAAGAGAAAAGCAAGG - Intronic
1077927511 11:6696470-6696492 CTTTCCAAAATAGATAAGTAGGG - Intergenic
1077945619 11:6894482-6894504 CATTGTAAAGTAAAACAGTAAGG - Intergenic
1078656255 11:13243244-13243266 CATTGCAGAAGAGGAAAGTAAGG - Intergenic
1080037735 11:27726939-27726961 CATTGCACAATGGAAAAGTCAGG + Intergenic
1081523043 11:43901433-43901455 CATGGAAAAACAGAAAAGAAAGG - Intronic
1082250306 11:49971594-49971616 CATTGGAAACTCCAAAAGTTGGG + Intergenic
1082928173 11:58573405-58573427 GCTTAGAAAATAGAAAAGAAAGG - Intronic
1084748088 11:71185956-71185978 CAATGGAAAATACAATGGTACGG + Intronic
1086229498 11:84551091-84551113 CATGGGAAAGTTGAAAAATAAGG + Intronic
1086867630 11:91999279-91999301 CATGGTAAATTAGAAAAATATGG - Intergenic
1087429021 11:98027630-98027652 CACAGGCAAACAGAAAAGTAAGG + Intergenic
1087566027 11:99859323-99859345 CAATTGAAAATAAAAAAGGATGG - Intronic
1087674445 11:101143340-101143362 CATTGAAAATTAGAAAATTTTGG + Intergenic
1088362925 11:109010042-109010064 CATTGGAAACTACAAAAGGTGGG + Intergenic
1088401348 11:109424296-109424318 CAGAGGAAAATGGAAAAGGAAGG - Exonic
1088440637 11:109866825-109866847 CAATGGAGAATAGGAAAGCAGGG + Intergenic
1088804081 11:113335140-113335162 CCTTGGAAAATACTAAAGGATGG - Intronic
1089406326 11:118200613-118200635 CTTGGGAAAGTAGAAAAGCAAGG + Intronic
1089918970 11:122188953-122188975 CATTAGAAAAAAAAAAACTAGGG + Intergenic
1090353562 11:126123633-126123655 AGTTTGAAAATATAAAAGTATGG + Intergenic
1090583088 11:128181150-128181172 AAGTAGAAAATAGAAAAGGATGG + Intergenic
1091510777 12:1123286-1123308 CAGTGGAGAATAGAGAAGAATGG + Intronic
1091864552 12:3820100-3820122 CATTGTAACACAGAAATGTAGGG - Intronic
1091915131 12:4266850-4266872 AATTGTAAAAAAAAAAAGTATGG - Intergenic
1093318379 12:17680261-17680283 CAATGTAAAATAGAACAGTTAGG + Intergenic
1093573719 12:20700148-20700170 CTTTGGAAAATATAATAGTATGG - Intronic
1093965790 12:25323703-25323725 CTCTGGAAAATAGATGAGTAGGG - Intergenic
1094696427 12:32823569-32823591 GCCTGGAAAATAGAAAAATAAGG + Intronic
1095132191 12:38556583-38556605 CAGTGGAAAACAGAAAACAAAGG - Intergenic
1095483902 12:42664604-42664626 CTCTGGAAAATAGCAAAGTTTGG - Intergenic
1095618577 12:44222348-44222370 CATTGGCAGAGAGAAAAGGAGGG + Intronic
1098722086 12:73912974-73912996 CCTTGGAATATAGACATGTAAGG - Intergenic
1098731646 12:74042906-74042928 CCTTGGAAATTAGAAACTTATGG + Intergenic
1099104459 12:78481918-78481940 CAGTGGAAAAGAAAAAAATAGGG - Intergenic
1099840949 12:87966385-87966407 AAATGGAAAATACAAAAGAAAGG - Intergenic
1099895425 12:88640416-88640438 CATTGGAAAATAGACAGAGAAGG + Intergenic
1100022449 12:90086258-90086280 CATTCAAAAATTGAAAAATATGG + Intergenic
1100121103 12:91370390-91370412 CACTGGAAAAGAGAAAATTAAGG - Intergenic
1100284083 12:93148161-93148183 CATTGGAAAATAATCAAGTTTGG + Intergenic
1100422382 12:94448863-94448885 CTTAGGAAACTAGAAAAATAAGG + Intronic
1100652580 12:96606625-96606647 AATTGAAAAAGAGAAAAGTCGGG - Intronic
1100660101 12:96687435-96687457 CATGAGAAATTTGAAAAGTATGG + Intronic
1100660302 12:96689938-96689960 CATAAGAAAATTGAAAAGTCTGG - Intronic
1100900052 12:99228126-99228148 CATTTGAAAATGAAACAGTAGGG - Intronic
1102703437 12:114860452-114860474 CATTGGCACATAGAAAAACATGG - Intergenic
1103652031 12:122440449-122440471 CAGAGGAAAATAGCAGAGTATGG - Intergenic
1103929203 12:124440274-124440296 CATTGGAAACAGGAAAAGGAGGG + Intronic
1104700971 12:130904622-130904644 CATTGAAAACTAGAAAAGTGTGG - Intergenic
1105353961 13:19641034-19641056 CAATGAAAAATAGAAAAGATAGG - Intronic
1106894354 13:34282223-34282245 CATTGGGAAAATGAAAATTAGGG - Intergenic
1107390940 13:39963430-39963452 CATTGGAAGAAAGAAAACTAGGG + Intergenic
1108781361 13:53839622-53839644 AAATGGAAAGTAGAAAATTATGG - Intergenic
1108810282 13:54214706-54214728 CATGAGAAAATAGAAAATGATGG + Intergenic
1108862447 13:54878996-54879018 CTTTGGAAAATAAAAAAGAAAGG + Intergenic
1109143356 13:58745146-58745168 CATTGGAAAATTGTAAATTCTGG + Intergenic
1109154157 13:58883937-58883959 CATAGAATAATAGAAAAGTATGG + Intergenic
1109349107 13:61154000-61154022 CATTAGAAAATGGAAGAGAAAGG + Intergenic
1109541573 13:63784872-63784894 AAATGGAAAACAAAAAAGTAGGG + Intergenic
1109573084 13:64217182-64217204 CATTAGAAAATAGACACGGAAGG - Intergenic
1109688714 13:65856487-65856509 AATTGGAAAATTTAAAAGTAAGG - Intergenic
1110108187 13:71707371-71707393 CAGTGCAAAATACAAATGTAGGG - Intronic
1110371128 13:74741786-74741808 CATGGGGAAATGGAAAAGTTGGG - Intergenic
1110610253 13:77480000-77480022 AATTGCAAAATTGAAAAGTTAGG + Intergenic
1110766733 13:79288447-79288469 CACTGGAAAATAGATAAGATTGG + Intergenic
1110971539 13:81768807-81768829 TAATGGAAAACAGAAAAGTGTGG + Intergenic
1110992734 13:82064380-82064402 CTTTGGAAACTACAAAATTAAGG - Intergenic
1111184271 13:84711109-84711131 CATTGAAAAATGGAAAAATAAGG + Intergenic
1111187530 13:84758780-84758802 TTTTGTAAAATTGAAAAGTATGG + Intergenic
1111526691 13:89480470-89480492 CAATGGGAAATAGAAAAGATAGG + Intergenic
1111729968 13:92061937-92061959 CTTAGCAAAATAGAATAGTAGGG - Intronic
1111980866 13:95013869-95013891 CAGTGCAAAATACAAAAGCAGGG + Intergenic
1112801953 13:103121934-103121956 CATTGGTAATTAGAAAAATTTGG - Intergenic
1113258796 13:108537027-108537049 CATTGGAAAATGGTGAAGTTTGG + Intergenic
1113340764 13:109423147-109423169 CATAGGAAAAAAGGAAATTAAGG - Intergenic
1114343222 14:21767649-21767671 CATTAAAAAGTAGAAAAGAAAGG + Intergenic
1114963752 14:27929736-27929758 CATTGAAGAAGAGAAAAGTGTGG + Intergenic
1115955970 14:38779625-38779647 AATTGGAACAGAGAAGAGTATGG + Intergenic
1116360769 14:43994645-43994667 AATTTGTAAATAGAAAAGAATGG + Intergenic
1116423245 14:44758652-44758674 CATTGTAAAAGAAAAAAGTCTGG - Intergenic
1116513555 14:45778239-45778261 TCTTGAAAACTAGAAAAGTAAGG + Intergenic
1116527526 14:45925493-45925515 TATAGGAAAATACAAAAGGAAGG - Intergenic
1116651619 14:47600720-47600742 CATTAAAAAAAAAAAAAGTAGGG + Intronic
1116770824 14:49125167-49125189 CATTTAAAAAAAAAAAAGTATGG + Intergenic
1117153969 14:52919266-52919288 CATTGGACCTTAGATAAGTATGG - Exonic
1117695981 14:58363297-58363319 ACTTGTAAAATAGTAAAGTAGGG - Intronic
1117840991 14:59860474-59860496 CAGTGCAAAAGAGAAATGTAGGG + Intronic
1118886290 14:69869080-69869102 CACTGGGAAATAAAAAAGTGGGG - Intronic
1120416997 14:84231887-84231909 TATTGGAAATTATAAAAGAAGGG - Intergenic
1120771430 14:88384640-88384662 CATTAGAAAAGAGAAAACTGGGG + Intergenic
1202928562 14_KI270725v1_random:17597-17619 TATAGGAAAATTGAAAAGGAAGG + Intergenic
1125360317 15:38857888-38857910 CCATGGAAGATAGAGAAGTATGG + Intergenic
1125481121 15:40081589-40081611 CTTTAGAAAATAGAGAAGTTGGG + Intergenic
1126159207 15:45594322-45594344 CATTGGAAACTAAAAAAACAAGG + Intronic
1126528492 15:49685762-49685784 CCTAGGAAGATAGAAAAGGAAGG - Intergenic
1126740052 15:51768402-51768424 CACTGGAGAAAAGAAAGGTAAGG + Exonic
1127126233 15:55814674-55814696 TATTGGCAAAAAAAAAAGTATGG - Intergenic
1127159061 15:56161466-56161488 CATTATAAAAGAAAAAAGTAGGG + Intronic
1127648823 15:60986390-60986412 GATAGGAAACTATAAAAGTAAGG - Intronic
1127809788 15:62554775-62554797 CACTGGAAAATAGAATCCTATGG - Intronic
1128093648 15:64936178-64936200 CATTGGAATATAGAGAAGAAAGG + Intronic
1128433166 15:67619279-67619301 CATTGAAAAAAATAAAGGTAAGG - Intronic
1129571599 15:76691489-76691511 AATTGAAAAATAGAGAAATATGG + Intronic
1129818831 15:78582177-78582199 AATAGGAAAGTGGAAAAGTAAGG + Intronic
1130165539 15:81453783-81453805 CATTGGAAACTACAAAAGGTGGG - Intergenic
1131830280 15:96350260-96350282 AACTGGAAAATATAAAAGAAAGG - Intergenic
1133568334 16:7016705-7016727 CTTTAGAAAAAAGAAAAATACGG - Intronic
1133638112 16:7689682-7689704 AATGGGAAAATACAGAAGTAGGG + Intronic
1135144869 16:19952499-19952521 CTTTTTAAAAAAGAAAAGTATGG - Intergenic
1135511202 16:23085130-23085152 TTTTGGAATATAGAAAAGTTGGG - Intronic
1137402790 16:48166918-48166940 CTTTGTAAAATATAAAACTAAGG - Exonic
1139179386 16:64727952-64727974 CTTTGGAAACTATCAAAGTAAGG + Intergenic
1139895159 16:70282634-70282656 CATTGGCAAAGAGCAAAGTGGGG + Exonic
1139996824 16:70988908-70988930 CATTGGCAAATAGAAATATCTGG + Intronic
1140243687 16:73228822-73228844 CAATGGAATCTAGAAAACTATGG + Intergenic
1140584827 16:76277206-76277228 TATTGGAAAATAGAAGAGAAGGG + Intergenic
1141282132 16:82638393-82638415 CAGGGGAAAACAGAAAAGGAGGG - Intronic
1141344114 16:83229670-83229692 CTTTGGAAGAAAGAAAAATACGG - Intronic
1141387331 16:83633914-83633936 CATGGAAAAATGGAAAAATAAGG - Intronic
1142195365 16:88737070-88737092 CATTGCAAAATGGAAAATCAAGG + Intronic
1144197685 17:12911074-12911096 AATTGGAAAACAGAAAATGAGGG + Intronic
1144434393 17:15226980-15227002 CTCTAAAAAATAGAAAAGTAAGG - Intergenic
1144595069 17:16562700-16562722 AATTAGAAAATAAAAAAGAAAGG + Intronic
1145758691 17:27412081-27412103 CATTTTATAATAGAAAAGTTTGG + Intergenic
1146075324 17:29723511-29723533 CTTTGGAAGATAAGAAAGTATGG + Intronic
1146107234 17:30050764-30050786 CAATGGAAAAAGGACAAGTAGGG + Intronic
1147396764 17:40149541-40149563 GATTGAAAAAAAGAAAAGAAAGG + Intronic
1147437281 17:40424794-40424816 TATTTGAAAATTTAAAAGTAAGG + Intergenic
1148006011 17:44430154-44430176 CAAGGGAAAATAGAAGAGGAAGG + Intronic
1148403932 17:47394472-47394494 CATTGGAAGATAGAAAGAAATGG - Intronic
1149576255 17:57715652-57715674 CCTTGGAAAATGGAGAAGCAGGG - Intergenic
1150825678 17:68472464-68472486 CAGTGCAAAATGGAAACGTAGGG + Intergenic
1150889573 17:69131974-69131996 CTTTGGGAAATACAAAAGAATGG - Intronic
1152803491 17:82343126-82343148 AACAGGAAAATAGAAAAGAAAGG - Intergenic
1153108254 18:1552670-1552692 CATTGGAATATATAAAAATTAGG + Intergenic
1153226488 18:2904150-2904172 TATTGGAAACTAGAAGAGAAGGG - Intronic
1154232000 18:12565371-12565393 CAATGGAAAAAAGAAAAAAAAGG - Intronic
1155602262 18:27563115-27563137 CACTTGAGAATAGAAAAGTTTGG - Intergenic
1155705407 18:28804535-28804557 GCTTGGAAAAGAAAAAAGTATGG - Intergenic
1156025594 18:32650935-32650957 CTTTGAAAACTAGAAAAGGAGGG - Intergenic
1156775288 18:40780240-40780262 CAATGGAAGATGAAAAAGTAGGG + Intergenic
1156835219 18:41545328-41545350 AATTGGAAAAGAGAATAGTCTGG + Intergenic
1156934576 18:42688042-42688064 CATTGGACACTATAAAAGTTGGG + Intergenic
1156949423 18:42875871-42875893 CATTTGAAAATAGCATAGAAGGG + Intronic
1157145470 18:45158106-45158128 CACTGGCAAATTGAAAACTAGGG - Intergenic
1157155068 18:45257347-45257369 CACTGGTAAATACAAAAGTTAGG - Intronic
1157457331 18:47844893-47844915 GTTTGGAGAATAGAAAAATAAGG - Intronic
1157909370 18:51600916-51600938 CATTTGTAAACAGAAAATTATGG - Intergenic
1158194014 18:54864238-54864260 CATTAGTTATTAGAAAAGTATGG - Intronic
1158984220 18:62797474-62797496 CTGTGGAAAAAAGAGAAGTAGGG + Intronic
1162242554 19:9366555-9366577 CATTTGACAATAGAAAATGAAGG - Intronic
1164106868 19:22115111-22115133 AATTGGAAAATAGAGAAATCAGG - Intergenic
1164471407 19:28538297-28538319 CTTTGAAAAATAGTAAAGGAGGG + Intergenic
1165581924 19:36873034-36873056 AAATGGAAAATAGGAAAATATGG - Intronic
925685394 2:6466966-6466988 CAACTGACAATAGAAAAGTATGG - Intergenic
926266415 2:11326225-11326247 CATTTAAAAAAAAAAAAGTAAGG + Intronic
926307586 2:11649930-11649952 CATTGGACTATAGAAGAGTAAGG - Intergenic
926421410 2:12703372-12703394 CAGTGGAAAATAGAAACTTGTGG + Intergenic
926472519 2:13278965-13278987 TATCGGAAAAAAGATAAGTAAGG - Intergenic
926701757 2:15808577-15808599 CATTGGAAAATGCAAAATAAAGG - Intergenic
926944656 2:18174051-18174073 CATTGGAAAATAGAACTTAAAGG + Intronic
926976022 2:18517546-18517568 CACTGGAGAATACAAAAGTGGGG - Intergenic
927456638 2:23257006-23257028 CATTAGAAAAGAGAAAACTATGG + Intergenic
928650515 2:33399419-33399441 CACTGGAAAAGATAAAAGTGGGG - Intronic
929145597 2:38704672-38704694 CATTAAAAAAAAAAAAAGTAAGG + Intronic
930048467 2:47194628-47194650 CATTGCAAAATGAAAATGTAGGG + Intergenic
930121247 2:47762753-47762775 AATTGAAAAACAGAAAAGGAAGG - Intronic
930670097 2:54140002-54140024 CATTTAAAATTAGAAAAATAAGG - Intronic
930948252 2:57103475-57103497 CCTGGGTAAATAGAAAATTAAGG - Intergenic
931672230 2:64657900-64657922 CAGTGGAAAATGGAATAGGAAGG - Intronic
932885197 2:75543016-75543038 CACTGGAAAATAAAAAATCATGG + Intronic
933234864 2:79853638-79853660 AAAAGGAAAAAAGAAAAGTATGG - Intronic
933883153 2:86692054-86692076 TTTTAGAAAATTGAAAAGTAGGG + Intronic
934017774 2:87907582-87907604 CCATGGAAAATAAAACAGTATGG - Intergenic
934875843 2:97919351-97919373 CATTTTAAAATAGATAAGAATGG - Intronic
935736365 2:106109624-106109646 GATTAGAAAATAGATGAGTATGG - Intronic
935929725 2:108111429-108111451 AAATGGAAAACAGAAAAGAAGGG - Intergenic
936696570 2:114956749-114956771 CATTGACAAATGGAACAGTATGG + Intronic
937108100 2:119338035-119338057 GATTATAAAATAAAAAAGTACGG + Intronic
937374680 2:121327604-121327626 AAGTGGAAAGTAGAAAGGTAGGG - Intergenic
937503050 2:122503935-122503957 CATTAGAAAATAAAAATATAAGG - Intergenic
937527168 2:122785780-122785802 CATTGGAATATAAGAAAGGAGGG + Intergenic
937617439 2:123943144-123943166 CATTAGAATATAAAAAAGAAAGG + Intergenic
938015114 2:127860300-127860322 TATTGGAAAACAGAAAAGAGAGG - Intergenic
938034379 2:128024313-128024335 CATTGGAAAAAAAAAAAATTAGG + Intronic
938679646 2:133676623-133676645 CATTGCACAAGACAAAAGTAGGG - Intergenic
940017967 2:149126506-149126528 CATTGATAAAGTGAAAAGTACGG + Intronic
940238879 2:151541711-151541733 CAAGGGAAAAAAGAAAAGGAGGG - Intronic
940539815 2:154998229-154998251 CATTTGGAAAAATAAAAGTAGGG + Intergenic
940767022 2:157800656-157800678 CTTTTAAAAATAGAAAAGGAAGG - Intronic
941066999 2:160914543-160914565 CAATTTAAAAAAGAAAAGTAAGG - Intergenic
941229163 2:162887382-162887404 GATTGGAAAAGAGAAAAAAAGGG - Intergenic
941352840 2:164457272-164457294 TATTGGAGAAAAGAAAAGCAAGG - Intergenic
942212228 2:173682687-173682709 TCTTGGAAAATAGAAAATTTGGG - Intergenic
942380115 2:175381931-175381953 CATTGAACAATAGTATAGTATGG + Intergenic
942701415 2:178715269-178715291 AATTGGAAAAAAGGAAAATACGG + Intronic
943188410 2:184645311-184645333 CAATGTAAAATAGAAAACTATGG - Intronic
943826041 2:192393646-192393668 CAGTGGAAAGTAGAAATGAAGGG + Intergenic
943863931 2:192903906-192903928 CATAGGCAAATGGAAAAGTGAGG + Intergenic
943864144 2:192907201-192907223 CATAGGCAAATGGAAAAGTGAGG + Intergenic
944052359 2:195485007-195485029 GATGGGAAAATAGAAAGGGAAGG + Intergenic
944416927 2:199488302-199488324 CTTTGGAAAACAGAAACGTCTGG + Intergenic
945046776 2:205788832-205788854 CTTTGGAAAATAAAGATGTAAGG - Intronic
945050339 2:205818138-205818160 CATTTGGAAATAGAAAAATAGGG - Intergenic
945079576 2:206075148-206075170 CATTAGCAAGGAGAAAAGTAAGG + Intronic
945527486 2:210906100-210906122 CAATAGAAATTATAAAAGTAAGG + Intergenic
945578596 2:211563957-211563979 CATTTCAAAATAAAAAATTAAGG + Intronic
945631680 2:212286515-212286537 CATTGTAAAAGAGAAAACTGAGG - Intronic
945726962 2:213482203-213482225 CATTTGATAATATGAAAGTATGG - Intronic
945798713 2:214397456-214397478 CATTAGAAAATTTAAAAATATGG - Intronic
946484932 2:220092424-220092446 CATTGGGAAATAGATAAAAAAGG + Intergenic
946614870 2:221498483-221498505 CATTGGAAAAGAAAAAGGTTGGG + Intronic
946627937 2:221634970-221634992 CATAGGAACATGGAAAAATAAGG - Intergenic
946949477 2:224857587-224857609 CATTGGAACCAAGAAAAGTTAGG + Intronic
947022230 2:225692295-225692317 CTTTGGAAAATTGAATATTATGG + Intergenic
947214752 2:227739823-227739845 TATTGAAATATAAAAAAGTAAGG - Intergenic
947865296 2:233393636-233393658 AATTAGAAAACAGGAAAGTAGGG - Intronic
947978859 2:234391189-234391211 CAATGGCAACTAGAAAAGGAAGG + Intergenic
947983777 2:234431588-234431610 CATTGGAAAAAAGAAAAACTAGG + Intergenic
948539759 2:238681937-238681959 AATTTGAAAATACAAAAGGAAGG - Intergenic
1169690108 20:8320964-8320986 AAAGGGAAAATAGAAAAGGAAGG + Intronic
1170201722 20:13751115-13751137 TATTGCAAAATTGAAAAGTTGGG - Intronic
1170275921 20:14587988-14588010 CATTGGAAAATAGAAAAGTATGG - Intronic
1170333349 20:15240165-15240187 CATTTCAAAATGGAAAAGAATGG - Intronic
1170525753 20:17235314-17235336 CATTAGAAAATTGACAAGAATGG + Intronic
1170759063 20:19233490-19233512 CATTGGAAAGTAGAGTAGGAAGG + Intronic
1170810817 20:19672825-19672847 AATTTGAAAAGAGAAAAGGAAGG + Intronic
1171064303 20:21998434-21998456 TATTGGTATATAGAAATGTATGG - Intergenic
1171899096 20:30840336-30840358 CAATGGAGAAAAGAAATGTAGGG + Intergenic
1171953453 20:31441364-31441386 GAGTCGAAAATAGAAAAGGAAGG + Intronic
1172491395 20:35341314-35341336 CATTAGAAGATGGAAAAGTATGG + Intronic
1174231758 20:49051147-49051169 ACTTGGAAAATAGTAGAGTAAGG + Intronic
1174398426 20:50262139-50262161 GACTGGAAAATAAAAAAGAAGGG - Intergenic
1174927922 20:54781302-54781324 ATTTGGAAAAAGGAAAAGTAAGG + Intergenic
1174964879 20:55200836-55200858 TATTTAAAAATAGAAGAGTAAGG - Intergenic
1175050304 20:56149535-56149557 CTTTGGAAAAGAGAAAATAATGG - Intergenic
1175450515 20:59061937-59061959 CTTTGCAAAAGAGAAAACTAAGG - Intergenic
1175463024 20:59168759-59168781 CGTTGGAAAATAGAAATAGACGG - Intergenic
1176590584 21:8646181-8646203 TATAGGAAAATTGAAAAGGAAGG + Intergenic
1176990100 21:15485264-15485286 CACTGGAAAATAGAAGACTGAGG - Intergenic
1177166285 21:17608551-17608573 CTTTGAAAAAAAAAAAAGTATGG - Intronic
1177822590 21:26048014-26048036 TATTAGAAAATGAAAAAGTAAGG + Intronic
1178000107 21:28152175-28152197 CTTTAGAAAATAATAAAGTATGG + Intergenic
1180273413 22:10623214-10623236 TATAGGAAAATTGAAAAGGAAGG + Intergenic
1180679904 22:17618109-17618131 CATTGCAAAAAAGTAAAGTTTGG - Intronic
1180894868 22:19323210-19323232 CAAAGAAAAATAGAAAAGGAGGG + Intergenic
1181521975 22:23453724-23453746 CATTCCAAAAAAGAAGAGTAGGG - Intergenic
1182115007 22:27751333-27751355 CACTGGGAAATAGGAAAGTGAGG + Intronic
1182632736 22:31699740-31699762 AATTGGAAAACAGAAAAGTCAGG + Intronic
1183122708 22:35742611-35742633 CATTAGGAAATAGAAAAGCACGG - Intronic
1184641419 22:45873404-45873426 CATTTTAAAACACAAAAGTAGGG + Intergenic
1185283979 22:49991646-49991668 CACAGGAAAATAGAAAATCAAGG + Intergenic
949136687 3:575497-575519 TATAGGAAAATTGAAAAGGAAGG - Intergenic
949208602 3:1470849-1470871 CAGTGGGAAAGAGAAAAATACGG - Intergenic
949231105 3:1752111-1752133 CTCTGGAAAATACAAAACTATGG + Intergenic
949484008 3:4520011-4520033 TCTTGGAGAATAGAACAGTAAGG + Intronic
950860018 3:16139632-16139654 AAATAGAAAATAGAAAATTATGG + Intergenic
951186260 3:19716988-19717010 TCATGGAAAATAGAAAAGAAAGG + Intergenic
951411200 3:22369585-22369607 CTTTGGAAAATAGAAAATCTTGG - Intronic
951599714 3:24360112-24360134 CACTGGAATTTAGAAAAGAAAGG - Intronic
951689970 3:25385227-25385249 CTTTGGCAAATAGACAAGTCAGG - Intronic
951828947 3:26902039-26902061 CAATGAAAAAAAGAAAACTATGG + Intergenic
952150964 3:30591253-30591275 TTCTGGAAAATAGAAAAGGAGGG - Intergenic
952685117 3:36138829-36138851 CAGTGGAAAATAAAAATGTGAGG - Intergenic
952944642 3:38470071-38470093 AATTGGAAATTAGGAAAGGAGGG + Intronic
953604210 3:44399333-44399355 CATGGAAAAATTGAAAAATAGGG + Intronic
953769569 3:45769344-45769366 CATTGGAAAAAAAAAATCTAGGG - Intronic
954959928 3:54555180-54555202 CATTAGAAAATAAATAAATAAGG - Intronic
955043466 3:55338195-55338217 CAGTGGAAAAAAAAAAAGTATGG + Intergenic
955300876 3:57777422-57777444 CATTGGAAGATAGAATAGCCAGG + Intronic
955416757 3:58699469-58699491 CATCGGAGAAGAGAAAAGCAAGG + Intergenic
955634583 3:61013607-61013629 AAAAGGAAAATAGAAAAGAAGGG + Intronic
956186911 3:66571329-66571351 CATAAGAAAAAAAAAAAGTATGG - Intergenic
956358113 3:68416246-68416268 CATTGTGAAAAAGAAAAGGAGGG - Intronic
956417100 3:69043649-69043671 TATTGGAAAAAAGAGAAGTAAGG - Intronic
957202220 3:77150760-77150782 TATTAGAAAGAAGAAAAGTAGGG - Intronic
957802993 3:85109431-85109453 TTTTGAAAGATAGAAAAGTAGGG + Intronic
958755958 3:98249378-98249400 CATTAAAAAACAGAAATGTAAGG + Intergenic
958896512 3:99835811-99835833 CAGTGGAAAACTAAAAAGTAAGG + Intronic
958902462 3:99903921-99903943 CATTTGGTAATAGAAAAATATGG + Intronic
959035834 3:101362620-101362642 CATTGGAAACTCCAAAAGTAGGG - Intronic
959177778 3:102938152-102938174 CATTTGAAAATAATAAAATACGG - Intergenic
959853758 3:111122974-111122996 CATCTGAAAATATAAAAGAAAGG - Intronic
960113197 3:113865744-113865766 TAATGGAAAATAGAGAAGAAAGG - Intronic
960183621 3:114612077-114612099 TATGGGAAAACAGAGAAGTAGGG - Intronic
960383950 3:116997179-116997201 CATTGGAATATAAAAAAGTATGG - Intronic
960480101 3:118177544-118177566 CCTAAGAAACTAGAAAAGTAGGG + Intergenic
961031022 3:123604154-123604176 CAGTGCAAAATAAAAATGTAGGG - Intergenic
961483880 3:127203780-127203802 TATTGCAAAATACAAAAATATGG - Intergenic
961937190 3:130597781-130597803 TTTTGGAAACTGGAAAAGTAGGG + Intronic
962502175 3:136006634-136006656 CTTAAGCAAATAGAAAAGTATGG + Intronic
962901532 3:139765997-139766019 CATTGCAAAATGAAAATGTAGGG + Intergenic
962935026 3:140072964-140072986 AATTTGAAAAGAGAAAAGTGAGG - Intronic
964124130 3:153218243-153218265 CAATGGAACATTGAAAAATATGG + Intergenic
964334386 3:155639556-155639578 CATTGGAAAATGAAAAGGGAAGG + Intronic
964352359 3:155815751-155815773 AATTTGAACATATAAAAGTAGGG - Intergenic
966811386 3:183848045-183848067 CAGTGAAAAATAACAAAGTAAGG + Intronic
966967374 3:185007857-185007879 CAATGGTTAATAGAAAATTATGG - Intronic
967292185 3:187932065-187932087 CGTTGGTAAATAGTAAAGTTTGG - Intergenic
967631764 3:191751820-191751842 CATTGGAAAAAAAAAAAGACTGG - Intergenic
967790908 3:193548050-193548072 CATAGAAAAATAGTATAGTATGG + Intronic
968335145 3:197907194-197907216 CATTGAGAAATAGAATAGTGAGG - Intronic
969946113 4:10784725-10784747 CATAGGCAAACAGAAAAGTCAGG - Intergenic
970477732 4:16440722-16440744 CAATGGAAAATGGAAATGGAAGG - Intergenic
970715710 4:18920097-18920119 CATTGAAAAAAAATAAAGTAAGG + Intergenic
970973163 4:22009164-22009186 CATTTGTTAATAGAAAAGGAAGG + Intergenic
971752663 4:30670574-30670596 CATTGGACAATAGATAAGGCAGG - Intergenic
972877057 4:43375390-43375412 AATTTGAAAATAGAAAAGTTTGG + Intergenic
972930530 4:44066591-44066613 CCTTTAAAAATAGAAAAGAATGG - Intergenic
973821747 4:54667791-54667813 CTTTTAAAAATGGAAAAGTATGG + Intronic
974024488 4:56721398-56721420 CTTGGGAAAATAGAGAAGTAAGG + Intergenic
974346413 4:60687736-60687758 CATATGGAAATTGAAAAGTATGG - Intergenic
974467618 4:62277292-62277314 CAGTGGAAGATAGAACACTAGGG + Intergenic
974569399 4:63625690-63625712 CATATGAAAAAAGAAAACTACGG + Intergenic
974788575 4:66655293-66655315 CATCAGAAAAGAGAAAACTAGGG + Intergenic
975229780 4:71919206-71919228 CAATTGAAAATAGAAAAAAAGGG + Intergenic
975437363 4:74368373-74368395 CCTTGGAAAATATAAAAATAAGG - Intronic
975925039 4:79440313-79440335 AATTGGAAAATTCAAAAATAAGG - Intergenic
976032546 4:80773554-80773576 CTATGGAAAAAAGAAAAGTGGGG - Intronic
976065235 4:81179576-81179598 CAATGGAAAATATAAATCTATGG + Intronic
976643106 4:87360257-87360279 CTTTGGAAAATAGAAAGCTGTGG - Intronic
977150890 4:93510069-93510091 CAGTGGAAAAGAGACAAATAGGG - Intronic
977158698 4:93607148-93607170 CATTTGAAGGTAGAAAAATATGG - Intronic
977587670 4:98792216-98792238 CATAGGAAATGAGAAATGTAAGG + Intergenic
978040971 4:104061514-104061536 GAATGGAATATAGAAGAGTAAGG + Intergenic
978119920 4:105066042-105066064 CTTTGGAAAGAAGAAAAATAAGG + Intergenic
978483756 4:109226358-109226380 TTTTAGAAAATAGAAAAATAGGG - Intronic
978920513 4:114177525-114177547 AAATGGAAAATAGAAATATATGG - Intergenic
979025873 4:115574163-115574185 CATTTGAAAATATAAAATTGTGG + Intergenic
979082727 4:116362845-116362867 CAGTAGGCAATAGAAAAGTAGGG + Intergenic
979529307 4:121751861-121751883 CAGTGGAAATGAGAAAGGTAAGG - Intergenic
979756377 4:124345226-124345248 GGTAGGGAAATAGAAAAGTAAGG + Intergenic
980402612 4:132311732-132311754 CATTGGAGATTACAAAAGTGGGG + Intergenic
980521539 4:133942608-133942630 CAGTAGAAATTAGAAAACTAAGG + Intergenic
980599774 4:135007120-135007142 CAATAGAAAATAGAAAAAGATGG + Intergenic
980621469 4:135311701-135311723 CACTGGAAAATGGAAAGATAAGG + Intergenic
980635234 4:135493626-135493648 TATTGCAAAATAAAAATGTAGGG + Intergenic
980851337 4:138386863-138386885 CACTGGTAAATACAAAAATAAGG + Intergenic
981267022 4:142797779-142797801 CATTTGAAAATAGACAATTTAGG - Intronic
981278020 4:142924229-142924251 TATTGGAAAACAGTAAAATAAGG + Intergenic
981627423 4:146775069-146775091 CAATGGAAAACAAAAAAGTAGGG - Intronic
981650887 4:147057309-147057331 CATTTGAAAATAAAAAACTGTGG + Intergenic
981947847 4:150370472-150370494 CATTGGAAAAGGCAAAACTATGG + Intronic
982071444 4:151698875-151698897 GATTGGAAAAAAAAAAAGAAGGG - Intronic
982658940 4:158183183-158183205 CATTAGAAGAGAGAAAAGGACGG + Intergenic
982689677 4:158533744-158533766 AATAGAAAAATAGAAAAGTAGGG - Intronic
982735172 4:158998636-158998658 CAATAAAAAATAGAAAAGTGGGG + Intronic
983679846 4:170340972-170340994 CATTGGAAACTACAAAAGGTGGG - Intergenic
984207246 4:176799955-176799977 CATTAGAAGATTGAAAATTAGGG + Intergenic
984286507 4:177736400-177736422 CATTGTAAAATGGAAGAATATGG - Intronic
984332073 4:178336378-178336400 CATAGAAAAATAGAACAGAATGG + Intergenic
984659267 4:182355637-182355659 CATAGGAAAATAGAAAAGTTTGG + Intronic
985027260 4:185750204-185750226 CATGGGCAAAAAGAAAAGGATGG + Intronic
986620989 5:9674089-9674111 CATTGGAAACTAGAGAAGATAGG - Intronic
986801180 5:11261744-11261766 TATTGGTAAATAGGAAAGAAAGG + Intronic
987410335 5:17608580-17608602 TTTTGGAAAATAGTCAAGTACGG - Intergenic
988166711 5:27600012-27600034 CATATCAAAACAGAAAAGTAAGG + Intergenic
988292478 5:29306322-29306344 CATTGGGAATTAGAAATTTAAGG - Intergenic
988676106 5:33434686-33434708 CAATGCAAAATAAAAATGTAGGG - Intergenic
988707455 5:33740380-33740402 CAGTGCAAAATAAAAATGTAGGG + Intronic
989078493 5:37590155-37590177 CAGCTGAAAATAGAAAAGGATGG + Intronic
989344390 5:40412756-40412778 CATGGGAAAATAGAGAAGTAAGG - Intergenic
990054268 5:51550873-51550895 AATAGAAAAATAGAAAAATATGG - Intergenic
990153826 5:52851451-52851473 CAATGGAAAATTGAAAAATCAGG + Intronic
990236673 5:53776250-53776272 CATTTGAAAAGAGAGAAGTGGGG + Intergenic
992307098 5:75452247-75452269 CATATGAAAATATAAAATTAGGG - Intronic
993759629 5:91777100-91777122 CATTGGATAAAAGCAAAGTAAGG + Intergenic
993990632 5:94653155-94653177 CATTAAAAAATAAAGAAGTACGG - Intronic
994258607 5:97630675-97630697 GTTTGGAAAATAAAAAAGAAAGG + Intergenic
994549493 5:101212783-101212805 CATTGGTAAATATAAATATATGG + Intergenic
995130314 5:108623156-108623178 CATAGGAAAATAGAAAATTCCGG - Intergenic
995285249 5:110381048-110381070 CATTGGAAAAGGCAAAAGTATGG - Intronic
995342048 5:111071076-111071098 TATGGGAAATTTGAAAAGTAGGG + Intronic
995658088 5:114449674-114449696 CATTTGAAGATATAAAAGTCAGG - Intronic
996047218 5:118886984-118887006 CATTGTAAAATAGATAAACACGG - Intronic
996144421 5:119956171-119956193 CTTTGGAAAATAGCTATGTATGG - Intergenic
996392509 5:122976910-122976932 CATTAGAAAAGGGAAAAGAAAGG - Intronic
997804060 5:136896696-136896718 TATTGGAAAATTTAAAAGTCTGG - Intergenic
998542337 5:142994358-142994380 GAAGGGAAAGTAGAAAAGTAAGG + Intronic
998750444 5:145315706-145315728 TAATGAAAAATAGTAAAGTATGG + Intergenic
999073686 5:148774698-148774720 CATTTGGAAAAAGAAAAGAAGGG - Intergenic
999455480 5:151713026-151713048 CATAGCAAAAAAGAAAAGTAGGG - Intergenic
999586607 5:153095956-153095978 CAATGGAAAAAAGGAAAGTGTGG - Intergenic
1000792125 5:165620922-165620944 CAGTGGAAAAAAGCAAAGAAGGG - Intergenic
1001619920 5:173075106-173075128 AATGGGAAAAGAGGAAAGTAAGG - Intronic
1002387170 5:178876903-178876925 CATAAAAAAATAGGAAAGTATGG - Intronic
1002412883 5:179097199-179097221 CATTGAAAATTAGAAAATTCTGG - Intergenic
1003757303 6:9136184-9136206 CATTGGAAAAAGCAAAAGAAAGG + Intergenic
1004127064 6:12884216-12884238 TATTGGGAAATAAAAATGTATGG - Intronic
1005414243 6:25584354-25584376 GTTTGAAAAATAGAAAAGAAAGG + Intronic
1005996213 6:30932952-30932974 CTTTAGAAACTAGGAAAGTAAGG + Intergenic
1006490236 6:34380988-34381010 GAGTGTAAAATAGAGAAGTATGG - Intronic
1006961262 6:37932564-37932586 CATTGTAATTTAGTAAAGTATGG + Intronic
1007186771 6:39978416-39978438 CATAGGAAAATATGAAGGTAGGG + Intergenic
1007870317 6:45028376-45028398 CTTTGGAACATGGAAAAGTTTGG - Intronic
1008059405 6:46981432-46981454 CAGAGGAAAAGAGGAAAGTAAGG - Intergenic
1008290562 6:49710608-49710630 AATAGGAAAATGGAAAAGTATGG - Intronic
1009329987 6:62406587-62406609 CTTTAGAATATAGAAAAGTGTGG + Intergenic
1009585045 6:65589784-65589806 CATTAGAAAATAGAAATGTCAGG - Intronic
1010101283 6:72111233-72111255 CATTGGATAATAGAAAGGAGAGG - Intronic
1010706384 6:79116673-79116695 CATTGAAAAATATAAACATAAGG + Intergenic
1011285963 6:85723350-85723372 CTTTAGAAAACAGAAAAGAAAGG + Intergenic
1011366415 6:86587040-86587062 CATTTGTTAATAGCAAAGTAGGG - Intergenic
1011539334 6:88414010-88414032 CATAAGAAAATAGAAAAAGATGG + Intergenic
1012466937 6:99526076-99526098 CAGATGAAAATAGAAAAGTGTGG + Intergenic
1012566125 6:100654815-100654837 CATGGGAAAATTGAAACTTAAGG - Intronic
1012599869 6:101082391-101082413 CCTTTGAAAAAAGAAAACTATGG - Intergenic
1013953437 6:115812766-115812788 AAATGGAAAATAAAAAAGCAAGG + Intergenic
1014762261 6:125369530-125369552 AATTAGAAAATGGAAAAATAAGG + Intergenic
1014775543 6:125504984-125505006 CCTTTGAATATAGAAAACTAAGG + Intergenic
1014872825 6:126617110-126617132 CATTAGAAAATAAGAAAGTGTGG - Intergenic
1015055557 6:128898624-128898646 AAATGGAAAAGAGAAAAGAAGGG - Intronic
1015555276 6:134454676-134454698 CATTAGGAAATGGAACAGTAAGG - Intergenic
1015928403 6:138333159-138333181 CATTGGCAAATTAAAAAGTTTGG + Intronic
1016461487 6:144284473-144284495 TATTGGAAAACAGAAAAATAAGG + Intergenic
1016582008 6:145638672-145638694 TATTGAAAGATAGAAAAGTAAGG + Intronic
1016812942 6:148278651-148278673 CATTAGAAAAAAGAAAATTCTGG + Intronic
1016930789 6:149406198-149406220 CATTTGAAAATACAAACATATGG - Intronic
1017469897 6:154729344-154729366 AATTGGAAAAAAGAAAACTTAGG - Intergenic
1017634571 6:156431237-156431259 CATTGCAAAATAAAAATGTGAGG + Intergenic
1018484958 6:164231689-164231711 CATCAGAACTTAGAAAAGTAAGG - Intergenic
1018512270 6:164537872-164537894 CATCTGAAAAGAGAGAAGTAGGG - Intergenic
1018531671 6:164770785-164770807 CATAGGATAATTGAAAAGGAAGG + Intergenic
1020507060 7:9004204-9004226 CCTTGGGAAATAGAAAGGTGAGG - Intergenic
1020724615 7:11795561-11795583 CATTGTAAAACATAAAACTAGGG - Intronic
1021286859 7:18791018-18791040 CTTTGGCAGATAGAAAGGTATGG + Intronic
1023818685 7:43968577-43968599 CCTGGGAAAATAGAAATGGATGG - Intergenic
1024792038 7:52977315-52977337 AATTGGAAAATAAAAAAATTAGG + Intergenic
1026073123 7:67140541-67140563 AATAAGAAAATAGAAAAATAAGG + Intronic
1026164452 7:67897617-67897639 CATTGGAAAAAACAAAGGCAAGG - Intergenic
1026363655 7:69625915-69625937 CAATGGAACATAGGAAATTAGGG + Intronic
1026482880 7:70793972-70793994 CAGTGAAAAATAGCAAAGCAAGG - Intergenic
1026703764 7:72671670-72671692 AATAAGAAAATAGAAAAATAAGG - Intronic
1027337097 7:77162811-77162833 CACTGGAAACTATAAAACTATGG - Intronic
1027661406 7:80992080-80992102 CATTGGCAATTAGAAAAAAATGG - Intergenic
1028414973 7:90570105-90570127 AATAGGAAAATAGAGAAGGAAGG + Intronic
1029743734 7:102505543-102505565 CCTGGGAAAATAGAAATGGATGG - Intronic
1029761721 7:102604706-102604728 CCTGGGAAAATAGAAATGGATGG - Intronic
1029778702 7:102708299-102708321 CACTGGAAACTATAAAACTATGG + Intergenic
1030889408 7:114980724-114980746 CATAGCAAAATAGAAAGGAAAGG - Intronic
1030981790 7:116194398-116194420 GATTGTAAAATAGAAATGTGAGG - Intergenic
1031014893 7:116562748-116562770 CATCAGAAAAAAGAAAAGAAAGG + Intergenic
1031101229 7:117482358-117482380 CATTGGAAAACCAAAAAGTTTGG + Intronic
1031196080 7:118615647-118615669 GATTGGAGAGTAGAAAAGAAAGG + Intergenic
1031342806 7:120625251-120625273 CATAGTAAAATAGCAAAGCAAGG + Intronic
1031381569 7:121092561-121092583 CATTGGAAGTTAGAAGAGAAGGG - Intronic
1031647027 7:124238955-124238977 CCTTGGAAAATTGAAAATTTAGG - Intergenic
1032874498 7:136023135-136023157 CATTGTTAAATAAAAAATTAGGG + Intergenic
1033028051 7:137796100-137796122 CATAGTAAAATAGGAAAGCATGG + Intronic
1033113520 7:138604814-138604836 CACTGGAAAATAGAAACAAATGG + Intronic
1033670691 7:143489654-143489676 AATAGGAAAATGGAAAAGGAGGG + Intergenic
1033685527 7:143637028-143637050 CATTGGAAAAAAAAAAAGGATGG - Intronic
1033688697 7:143716245-143716267 CATTGGAAAAAAAAAAAGGATGG - Intronic
1033699087 7:143820593-143820615 CATTGGAAAAAAAAAAAGGATGG + Intergenic
1033764735 7:144476198-144476220 CATTGGAAAATAGAAATGGAAGG + Intronic
1033842255 7:145388903-145388925 CATTGGAAAAAAGAAAATATGGG + Intergenic
1033925301 7:146451599-146451621 CAGTGCAAAATAAAAACGTAGGG - Intronic
1035900768 8:3456443-3456465 TATTAGAAAATAGGAGAGTAAGG - Intronic
1036145484 8:6251039-6251061 CAGTGCAAAATAGAAAGGCAGGG + Intergenic
1036161281 8:6390824-6390846 AACTGGAAAAAAAAAAAGTACGG + Intergenic
1036198883 8:6749391-6749413 AATTGTAAAGTAGAAAACTAAGG + Intronic
1037407379 8:18557184-18557206 CATGTGAAACTAGAACAGTAAGG - Intronic
1039257570 8:35735670-35735692 CTCTGGAAAATAGAGAAGAAAGG + Intronic
1039354389 8:36799256-36799278 TATTGGAAAATATAAAAACATGG - Intronic
1040642337 8:49351483-49351505 CAGTGGAAAATAAAAATGGATGG - Intergenic
1040916068 8:52566923-52566945 AATTGGAAAATAAAAAAATAGGG + Intergenic
1040987523 8:53312761-53312783 CATGGGAAAATGGAAGAGGAAGG - Intergenic
1041052235 8:53946361-53946383 CATTAGAAAATAGTAAAAAAGGG - Intronic
1041170244 8:55134261-55134283 CTTTGAAAAACAGAAAAGAAAGG - Intronic
1041370649 8:57156772-57156794 AATTCTAAAAAAGAAAAGTAAGG + Intergenic
1041422799 8:57688096-57688118 CATTCAAAAATAACAAAGTAGGG + Intergenic
1041569778 8:59324390-59324412 CACTGGAAAATGGAAATGAAAGG + Intergenic
1041790935 8:61695470-61695492 CATGGGAAAAGGGAAAAGTCTGG - Intronic
1042058363 8:64790204-64790226 CATTGGAAATTAGAAATGACAGG - Intronic
1043049629 8:75369182-75369204 CCTTGGTAAAGAGAAAAGAAGGG + Intergenic
1043415918 8:80049113-80049135 CAGTGTAAGATATAAAAGTAAGG - Intronic
1043441754 8:80282667-80282689 CATTGTAAAATTGAATAGAAGGG + Intergenic
1043622348 8:82210856-82210878 TATTTGAAAATTGAAAAGTGTGG + Intergenic
1045098650 8:98824692-98824714 CATGGGATAATTGAAAAGTTAGG - Intronic
1045608574 8:103807782-103807804 AATGTGAAAATAGAAAAGAAAGG - Intronic
1045618343 8:103944221-103944243 CATTTGAAAATAGAAGTGTATGG - Intronic
1045682138 8:104673394-104673416 CATCAGAAAAATGAAAAGTATGG - Intronic
1046402056 8:113717148-113717170 CATAGAAAATTAGAAAAGTGTGG - Intergenic
1046597856 8:116282571-116282593 CAATGGAAAACAAAAAAGCAAGG + Intergenic
1047094130 8:121605999-121606021 TGTTGGAAAAGAAAAAAGTATGG - Intergenic
1048148230 8:131866505-131866527 CTCTGGAAAATAGAACAGCATGG - Intergenic
1049699446 8:144002814-144002836 AATTGAAAAATAAAAAAATAAGG + Intronic
1050881865 9:10710591-10710613 CATTGCAAAATCGAAAATAAAGG + Intergenic
1051543322 9:18245696-18245718 CATTGAAAAAAAAAAAAGGAGGG - Intergenic
1052074639 9:24125966-24125988 CATAGGTAAACAGTAAAGTATGG + Intergenic
1052375853 9:27716749-27716771 CCTTGGAAAATACAAATGTCTGG + Intergenic
1052726685 9:32236557-32236579 GATAGGAAAAAAGAAAAGGAAGG + Intergenic
1053649942 9:40157257-40157279 CTCTAGAAAATAGAAAAATAGGG - Intergenic
1054330449 9:63749014-63749036 CTCTAGAAAATAGAAAAATAGGG - Intergenic
1054534639 9:66218946-66218968 CTCTAGAAAATAGAAAAATAGGG + Intergenic
1055839486 9:80485131-80485153 AATTGAAAAATGGAAAAGAAAGG - Intergenic
1055920865 9:81459588-81459610 CATTGGAACATATAAAAAGATGG + Intergenic
1056016411 9:82392891-82392913 CATTCTATAATAGAAAGGTAGGG - Intergenic
1056047003 9:82729270-82729292 TATTGATAAAGAGAAAAGTATGG + Intergenic
1056082587 9:83111742-83111764 CATTGAAAAACAGAAAAAAATGG + Intergenic
1056130075 9:83575858-83575880 TTCTAGAAAATAGAAAAGTAGGG + Intergenic
1056484099 9:87036804-87036826 CAATGAGAAATAGAAAACTAAGG + Intergenic
1058014609 9:100016316-100016338 CATTTGAAAATGGAGAGGTATGG - Exonic
1058090181 9:100797311-100797333 TAAAGGAAAATAGAAAAGAAAGG - Intergenic
1058115130 9:101076917-101076939 CATAGGAAAAGAGGGAAGTAGGG - Intronic
1058427737 9:104890116-104890138 CGTTGGAATATAGAAATGAAAGG - Intronic
1058621297 9:106886181-106886203 CTTAGTAAAAAAGAAAAGTAGGG + Intronic
1058860994 9:109117730-109117752 TATAGGAAAGTAGAAAAGAAAGG - Intronic
1059156496 9:111993791-111993813 CCTTGGAAAATACTAAACTAAGG + Intergenic
1059499340 9:114737606-114737628 AATTGAAAAAAAGAAAAGAAAGG - Intergenic
1060841474 9:126796559-126796581 CATTTGAAAATAGTTAAGAATGG - Intergenic
1203620597 Un_KI270749v1:124905-124927 TATAGGAAAATTGAAAAGGAAGG + Intergenic
1186193719 X:7091177-7091199 CAATGGTAAATAAAAAAGAAAGG + Intronic
1187080763 X:15984618-15984640 AAGTGGAAAATAGAAAAAGAGGG + Intergenic
1187595092 X:20762477-20762499 CCTTGGAAAATAAAAATGTGTGG - Intergenic
1187807781 X:23140051-23140073 CACTGGAGAATAGGAAGGTAAGG - Intergenic
1188678543 X:32973337-32973359 CATTGGCAAATGGAAAGGTAGGG + Intronic
1188908186 X:35813242-35813264 AATTGAAAAATAGAAAAGGGGGG - Intergenic
1189299198 X:39940470-39940492 CGTTGGCAAAAAGAAAAGAATGG - Intergenic
1189426169 X:40902981-40903003 CTTTAGAAAATAGAAGAGGATGG + Intergenic
1189764226 X:44353298-44353320 CTTTAGAAAATAGAAGAGAAGGG + Intergenic
1190340421 X:49291626-49291648 AATTTTAAAAAAGAAAAGTAGGG - Intronic
1190457045 X:50636662-50636684 CACTGGAGAATACAAAAGCAGGG - Intronic
1190848259 X:54214397-54214419 CTTCAGAAAATAGAAAAGGAAGG + Intronic
1192043469 X:67647014-67647036 GATGAGAAAATAGAAAAGAAAGG - Intronic
1192818194 X:74615817-74615839 TATTGGAAAACAGAAAAATTGGG - Intergenic
1193459554 X:81774488-81774510 GATTAGAAAATAAAATAGTAAGG + Intergenic
1193460116 X:81780882-81780904 CATAGGAAGATAGAAGAGAATGG - Intergenic
1193610674 X:83628365-83628387 CAATGGAAAACAGAAAAGAAGGG - Intergenic
1194260557 X:91689398-91689420 CAATGAAAAACAGAAAACTATGG + Intergenic
1194590585 X:95795845-95795867 CATTGGAGAAAAGAATATTAAGG - Intergenic
1194603305 X:95950162-95950184 AATATGAAAAAAGAAAAGTAGGG - Intergenic
1194829373 X:98601860-98601882 CATTGGAAAGTACAAAAGATGGG - Intergenic
1194839119 X:98716383-98716405 CATTGAAAAATGGAAAACTTGGG - Intergenic
1194841018 X:98742202-98742224 CATTTAAAGATAGAAAAGTGTGG - Intergenic
1194980447 X:100434833-100434855 CATGGGGAAATGGAAAAGTGTGG - Intergenic
1195361757 X:104089048-104089070 TAGTGGGAGATAGAAAAGTATGG - Intergenic
1195449096 X:104989898-104989920 AACAAGAAAATAGAAAAGTATGG - Intronic
1195742011 X:108074410-108074432 CATTGGAAAAAAGACTAGAAAGG - Intronic
1195981897 X:110587697-110587719 CAATGGAAAATAGAATAGACAGG - Intergenic
1196254821 X:113504885-113504907 CAAAGGAGAATAGGAAAGTATGG + Intergenic
1196614869 X:117756578-117756600 CATTGGAAAATACCAAACAATGG + Intergenic
1197269030 X:124405856-124405878 TATTTGAAGACAGAAAAGTAAGG - Intronic
1197632628 X:128879213-128879235 CCTTGGAAAATCGAGATGTATGG + Intergenic
1198671088 X:139081759-139081781 CATTTGAAAATAGAGATGAAAGG - Intronic
1198769032 X:140108774-140108796 CATTTGGAAACAGAAAATTATGG + Intergenic
1199095991 X:143739516-143739538 TATTGGAAAATAGAAAAATATGG + Intergenic
1199126759 X:144131427-144131449 CCATGGAAAATAAAACAGTATGG + Intergenic
1199152934 X:144510514-144510536 CATTGGAAAAAAGACAGATATGG - Intergenic
1199340673 X:146673470-146673492 GATTGGAAAATAGTAAATTAAGG - Intergenic
1199824338 X:151483527-151483549 CAATGGAAAATGGAAAATTCTGG + Intergenic
1200579247 Y:4928464-4928486 CAATGAAAAATGGAAAACTATGG + Intergenic
1200649175 Y:5819658-5819680 TACTGGACAATAGAAAAGTCAGG - Intergenic
1200877428 Y:8172675-8172697 CATTGTAAGATAGAAGAGGAGGG - Intergenic
1200908329 Y:8508728-8508750 AATTGCAAAATGGAAAAGAAAGG - Intergenic
1200953428 Y:8922629-8922651 AATTGCAAAATGGAAAAGAAAGG - Intergenic
1201388796 Y:13473747-13473769 CATTTGAAAATACAAAATAAAGG + Intronic
1201707373 Y:16951771-16951793 AAATGGAAAATAAAAAATTACGG + Intergenic
1201751366 Y:17435633-17435655 AATTGAAAAATGGACAAGTAGGG + Intergenic
1202231522 Y:22663983-22664005 AATTGCAAAATGGAAAAGAAAGG - Intergenic
1202311636 Y:23532182-23532204 AATTGCAAAATGGAAAAGAAAGG + Intergenic
1202559166 Y:26138412-26138434 AATTGCAAAATGGAAAAGAAAGG - Intergenic