ID: 1170275922

View in Genome Browser
Species Human (GRCh38)
Location 20:14588005-14588027
Sequence CAGAAAAAGACAGATAACAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 670
Summary {0: 1, 1: 0, 2: 3, 3: 58, 4: 608}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170275922_1170275926 13 Left 1170275922 20:14588005-14588027 CCAATGTTATCTGTCTTTTTCTG 0: 1
1: 0
2: 3
3: 58
4: 608
Right 1170275926 20:14588041-14588063 GCTTATTTTAACTTTATAAAAGG 0: 1
1: 0
2: 3
3: 55
4: 538
1170275922_1170275925 -9 Left 1170275922 20:14588005-14588027 CCAATGTTATCTGTCTTTTTCTG 0: 1
1: 0
2: 3
3: 58
4: 608
Right 1170275925 20:14588019-14588041 CTTTTTCTGGATCTGGTATCAGG 0: 1
1: 0
2: 75
3: 633
4: 1868

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170275922 Original CRISPR CAGAAAAAGACAGATAACAT TGG (reversed) Intronic
900800031 1:4731762-4731784 CAGAAACAGCCAGAAAACAGTGG - Intronic
901664956 1:10820688-10820710 GGGAAAAACACAGATAACCTTGG + Intergenic
903037158 1:20500331-20500353 CAGAAAAAAACAGAAGACACAGG + Exonic
903274815 1:22214064-22214086 TTGAAAAGGACAAATAACATAGG + Intergenic
905436992 1:37963313-37963335 CAGAAAAAGAGAGAGAAGACAGG + Intronic
905547452 1:38811084-38811106 CATAAAAAGAAAGATAACAGAGG - Intergenic
906010365 1:42518143-42518165 CAATAAAAGATAGAAAACATTGG - Intronic
906773499 1:48506884-48506906 CAGAAAAAAACAGACATTATGGG - Intergenic
907101119 1:51836453-51836475 CAGAAACAGACAGAAAAAAAGGG + Intronic
907213771 1:52844457-52844479 CAGAACTAGACAGAGAAAATGGG - Intronic
908522906 1:64961980-64962002 TAAAAAAAGAAAGATAACAAGGG + Intronic
908952178 1:69574305-69574327 CAGAAAAACAGAGCTAACAGAGG + Intronic
909195907 1:72622820-72622842 AAGATAAAAACAGATAAAATAGG - Intergenic
909274306 1:73665505-73665527 CAGAAAAAGACAGGAAAAAGTGG + Intergenic
910247759 1:85160120-85160142 CAGAAAGAGAAAGATATTATGGG - Intronic
910253115 1:85219164-85219186 CAATAAAAGACAGATAGCATAGG + Intergenic
911086141 1:93978952-93978974 TGGAAAAAGACAGTTAACACAGG - Intergenic
911249535 1:95559246-95559268 CAGCAAAAGAAAACTAACATGGG - Intergenic
911411652 1:97516852-97516874 CTCCAAAAGACAAATAACATTGG + Intronic
912766782 1:112420462-112420484 CAGAAAAAGAAACAGAGCATAGG - Intronic
912978179 1:114348265-114348287 CAGTAAAATACAAATAATATTGG - Intergenic
913470869 1:119184352-119184374 CACACAAAGACAAATACCATAGG - Intergenic
913649129 1:120893253-120893275 CAAAAAAAAAAAGATAATATTGG + Intergenic
914297362 1:146341260-146341282 CAAAAAAAAAAAGATAATATTGG - Intergenic
914737404 1:150430927-150430949 CAAAAAAAAAAAGATAACACGGG + Intronic
915062916 1:153201383-153201405 GAGAAAGAGAAAGATAACAATGG + Intergenic
915183843 1:154087017-154087039 CATAAAAAGATACACAACATAGG + Intronic
915382963 1:155459908-155459930 GAGAAAAAGATAGAAATCATAGG + Intronic
915391098 1:155544697-155544719 AATAAAAAGACAAATAAGATTGG + Intronic
915789478 1:158652522-158652544 GAGAAAAAGGCAGAAAACACTGG - Exonic
915983029 1:160434336-160434358 CAGAAGAAGACAGGAAACTTTGG - Intergenic
916554913 1:165886136-165886158 CACAAAAAGACAAATACCATAGG - Intronic
916624926 1:166544905-166544927 GAGAAAAAGACAGTCAAAATTGG + Intergenic
918166230 1:181950423-181950445 CTGAAAAAAACAGATAAGACAGG - Intergenic
918618984 1:186580934-186580956 CAGTAAAACACAGATTACAGTGG - Intergenic
918969570 1:191397064-191397086 CAGAAGAAGACAGAAAACTATGG + Intergenic
919376862 1:196806007-196806029 CATAAAAGGCCAGATCACATGGG + Intergenic
919386566 1:196930889-196930911 CATAAAAGGCCAGATCACATGGG + Intronic
919573793 1:199281400-199281422 CAGATACAGAGAGATAAAATAGG - Intergenic
920528052 1:206683454-206683476 GGGAAGAAGACAGATAACAGTGG - Intronic
920814454 1:209318337-209318359 AAGAACAAGTCTGATAACATAGG - Intergenic
921050476 1:211507691-211507713 CAGAAAAAGACTAATGACAATGG + Intergenic
922640328 1:227223406-227223428 CTTAAAAATACAGATAACAGGGG + Intronic
922847202 1:228695980-228696002 CATAAAAAGACACATCACTTTGG + Intergenic
1063537340 10:6896958-6896980 GAGAGAAAGACAGATAGCACAGG + Intergenic
1063617907 10:7617960-7617982 CAGAAAAAGAGAAATCCCATAGG - Intronic
1063753381 10:8977523-8977545 AAGAAAAAGAGAGAAAAAATGGG - Intergenic
1063883649 10:10555477-10555499 CTGAAAAAGAAACATAACTTGGG - Intergenic
1064333147 10:14412807-14412829 CAGAAAAACACAGATGTCCTTGG + Intronic
1064444582 10:15382193-15382215 AAGAAAAAGACAGTAAACTTTGG - Intergenic
1064711015 10:18124752-18124774 TAGAAAAAGGCAGAAAACAGGGG + Intergenic
1064951053 10:20850896-20850918 AAGAACAAGAAAGAAAACATGGG + Intronic
1065460840 10:25962534-25962556 TAGAAACAAACAGAAAACATTGG - Intronic
1067246348 10:44550015-44550037 CAGAAAAAGGCAGCTGACATAGG - Intergenic
1067316003 10:45163445-45163467 AACAAAAACACAGATGACATTGG + Intergenic
1068011387 10:51455847-51455869 CAGAAGAAGACAGATAAACGTGG - Intronic
1068486297 10:57663395-57663417 AAAAAAAAGAAAGATAACTTGGG + Intergenic
1068813358 10:61281648-61281670 AAGAAGAAGACAGATAAGGTAGG + Intergenic
1070200997 10:74206285-74206307 CTGAAGAAGAAAGATAAGATTGG + Intronic
1070651761 10:78242507-78242529 CAGAAGAAGACAGAAAAATTTGG + Intergenic
1070738808 10:78888160-78888182 TGGAAAAAGACAAATAACCTAGG - Intergenic
1070813589 10:79310462-79310484 CAGACACAGACAGACAGCATTGG - Intronic
1072417593 10:95262093-95262115 CAGAGAGAGACAGATGTCATTGG - Intronic
1072943926 10:99792448-99792470 GCGAAAAAGACAGATGACCTTGG - Intronic
1072965201 10:99966099-99966121 CAGAAAAAGGCAAATTGCATAGG + Intronic
1073304330 10:102491206-102491228 AAGAAAAAGACAGAAAACCTGGG + Intronic
1073397941 10:103233568-103233590 CAGAAAAAAACAGGCAAAATAGG + Intergenic
1073665232 10:105524569-105524591 AAGATAAAGACAGATTACCTGGG + Intergenic
1073858175 10:107702201-107702223 AAGAGAAAGAGAGAAAACATTGG - Intergenic
1074961734 10:118452257-118452279 CAGAAAAAGAAAAGCAACATAGG + Intergenic
1077827374 11:5825810-5825832 CAGAAAAAGACAGAAAAATGTGG + Intronic
1077914237 11:6600896-6600918 GAGCACAAGCCAGATAACATAGG + Intronic
1078027482 11:7711000-7711022 AAGAAAAAGAAAGACAAAATTGG + Intergenic
1078887675 11:15521020-15521042 CACAGAAAGACAAATACCATGGG - Intergenic
1079656205 11:22988901-22988923 CAGAAAAAGACAGAAAAATGTGG - Intergenic
1079838751 11:25367611-25367633 CAGAAAAAGACAGAAAAACAGGG - Intergenic
1080889641 11:36398311-36398333 CAGAAAATGACAGAACAGATGGG - Intronic
1081502933 11:43684330-43684352 CAAAAAAAGATTGATAACAAAGG + Intronic
1082614981 11:55348686-55348708 CAGAAAAAGACAGAAAAACATGG + Intergenic
1082752010 11:57029494-57029516 CGGAAAAAGACACATAGCAGAGG - Intergenic
1083810661 11:65104335-65104357 CAGAACAATGTAGATAACATTGG + Intronic
1085165173 11:74392943-74392965 CAGTAAAAGTCAGATGACCTAGG + Intronic
1086128674 11:83377939-83377961 CAGAAACAGACAGGAAATATGGG + Intergenic
1086151820 11:83619878-83619900 CAGAAAAAGTAAGATGACACTGG + Intronic
1086232810 11:84591062-84591084 CAGAGGATGAAAGATAACATTGG - Intronic
1087448295 11:98283825-98283847 CAGAATAATACAGATAACAGTGG + Intergenic
1087900076 11:103630705-103630727 CAGAAAAATAGATATAACATAGG + Intergenic
1088162675 11:106892306-106892328 CTGAAAATGAGAGATAGCATTGG - Intronic
1088178095 11:107076860-107076882 GGGAACAACACAGATAACATGGG - Intergenic
1088969084 11:114755768-114755790 TAGAACAAGATAGATAAGATAGG - Intergenic
1089563736 11:119359425-119359447 CAGAGAAAGACAGACAGGATAGG + Intronic
1090038624 11:123270831-123270853 GAGAAAAAGAGACATAAAATGGG + Intergenic
1090558843 11:127907015-127907037 GAGAAAGAGAAAGAAAACATAGG + Intergenic
1090837471 11:130463767-130463789 CAGAAAAAGAAATAAAACACAGG + Intronic
1090897606 11:130992268-130992290 CTGAACAAGACAGATGACAGGGG + Intergenic
1091504555 12:1054032-1054054 CAGGACAATACAAATAACATAGG - Intronic
1092115698 12:6001668-6001690 CAGAACCAGATAGATAAAATGGG + Intronic
1092657401 12:10701380-10701402 CAGATAAAGTCAGATGACAGTGG + Intronic
1093649763 12:21629566-21629588 CAGCAAAAGACAGTAAACAATGG - Intergenic
1094800711 12:34031379-34031401 TAGAAAAAAACAGTTAACATGGG + Intergenic
1095113501 12:38325668-38325690 TAGAAAAAAACATTTAACATGGG + Exonic
1095525563 12:43121099-43121121 CAACAAAAGAGAGATAACTTTGG - Intergenic
1095543010 12:43332313-43332335 CATAAAACAAGAGATAACATGGG - Intergenic
1096025907 12:48360797-48360819 CAGAAAAAAGCAGATGACAATGG - Intergenic
1096421409 12:51461476-51461498 CAAAAAAGGAGAGATAACATAGG - Intronic
1097492889 12:60292587-60292609 CAGAAAAAGAAAGATTATAAAGG - Intergenic
1098484467 12:71004649-71004671 CATAAAAAGACATGTAAGATCGG - Intergenic
1098520288 12:71427963-71427985 CAGAAAAAGATCCATCACATTGG + Intronic
1098686860 12:73433451-73433473 CAGAAAAAGACAGAAAATTGTGG + Intergenic
1098846523 12:75543483-75543505 CAGAAAAACTTAGATTACATGGG + Intergenic
1099009848 12:77279289-77279311 CAGAAAGAGACAGATGAAAGAGG + Intergenic
1099533823 12:83821320-83821342 CAGAAAAATGCTCATAACATTGG - Intergenic
1100035868 12:90250752-90250774 AAGAAAAAAAAAAATAACATTGG - Intergenic
1100349848 12:93770086-93770108 AAAAAAAAAAAAGATAACATAGG - Intronic
1100945624 12:99780272-99780294 CAAAAAAAAAAAGATATCATAGG - Intronic
1101127795 12:101655795-101655817 CAGAAAAAGGAAAATAATATAGG + Intronic
1101208124 12:102509227-102509249 AAGAAAAAGAGAGAAAACCTGGG + Intergenic
1101258225 12:103001196-103001218 CAAAAAAAGACAGAAAATAATGG - Intergenic
1102834261 12:116039358-116039380 CAGCAAAAGAGAAATAAAATTGG + Intronic
1104060181 12:125261210-125261232 CAGGAAAAGAAAGAAAAAATGGG - Intronic
1104346367 12:128003066-128003088 CACAAAAAGACAGATACCACAGG + Intergenic
1104368153 12:128196402-128196424 CAGGAAAAGAAAGAGAAGATGGG + Intergenic
1105509389 13:21038501-21038523 AAGAAAGAGAGAGATAAAATAGG - Intronic
1106184825 13:27400210-27400232 CATTAAAAATCAGATAACATGGG + Intergenic
1106942693 13:34795252-34795274 CAGAAGAAGACAGAAAAATTTGG + Intergenic
1107062642 13:36176014-36176036 TAGAAAACAACACATAACATAGG + Intronic
1107093225 13:36506630-36506652 CAGAGAAACAAAGATAAGATTGG - Intergenic
1107162659 13:37250053-37250075 CATAAAAAGACAGATGATAATGG - Intergenic
1107192115 13:37601585-37601607 CAGAAAAAGACAGTGACCCTGGG + Intergenic
1107227012 13:38063113-38063135 TGAAAAAAGACAGATAATATAGG - Intergenic
1107372177 13:39765190-39765212 CAGAAAGAGAGAGATATCAGAGG - Intronic
1107778569 13:43874928-43874950 CTGAAAAAGAAAGAAAACAGAGG + Intronic
1108078376 13:46706318-46706340 CAGAAAATGTCACATAATATAGG + Intronic
1108122458 13:47204128-47204150 CACAAAAAGCCACATATCATAGG + Intergenic
1108954292 13:56133208-56133230 GAGGAAAAGAAATATAACATAGG - Intergenic
1109035061 13:57247327-57247349 CATAAAATGAGAAATAACATGGG + Intergenic
1109611091 13:64765367-64765389 CAGAAAAAGGCTGATAATAACGG - Intergenic
1109616137 13:64836448-64836470 CAGAAAAAGACAGAAAGCGGAGG + Intergenic
1109936825 13:69298049-69298071 CAGATGAAGATAGATAATATAGG + Intergenic
1110178013 13:72580537-72580559 CACTAAAAGACAAATAACTTTGG - Intergenic
1110261380 13:73489034-73489056 TAGGAAAAGACAGATTACAAAGG + Intergenic
1110297831 13:73889166-73889188 CACAGAAAGCCAGAAAACATAGG + Intronic
1110365079 13:74673733-74673755 GACAAAAAGAGACATAACATGGG - Intergenic
1110600408 13:77366027-77366049 AAGAAAAAGAAAGAAAAAATGGG + Intergenic
1110852838 13:80264051-80264073 CAGAAGAAGACAGAAAATGTGGG - Intergenic
1110955419 13:81547203-81547225 CAGAAGAAGACAGAAAAAGTTGG - Intergenic
1110992797 13:82065320-82065342 CATTAAAATACTGATAACATTGG - Intergenic
1111238966 13:85449814-85449836 CAGATAATGACATATTACATTGG + Intergenic
1111240074 13:85461666-85461688 CTGAAAAAGAAAAATAATATGGG + Intergenic
1111282903 13:86050918-86050940 CTGAAAAATCCAGATCACATGGG + Intergenic
1111710108 13:91801042-91801064 GAGAAAAAGGCAGAAAAAATTGG - Intronic
1111719018 13:91917858-91917880 CAGAAGAAGACAGATGATGTGGG - Intronic
1111839457 13:93431753-93431775 CAGAAAAAGATGGACAACGTTGG + Intronic
1112758539 13:102668187-102668209 GAGCAAAAGGCAGATAACAAGGG - Intronic
1113188238 13:107714632-107714654 AAAAAAAAGAAAGATAAAATTGG + Intronic
1113453920 13:110433617-110433639 CAGAGAAAGAGAGATCAGATAGG + Intronic
1114387381 14:22269182-22269204 CAGATAAAGACACTTAAGATTGG + Intergenic
1115468286 14:33740115-33740137 CAGATAAAGTGAGATAACACAGG + Intronic
1115518766 14:34212063-34212085 CAGAGAAAGACAGATGGCAATGG + Intronic
1117230224 14:53709430-53709452 AAGAAAAAGACAGATAACCAGGG + Intergenic
1118595710 14:67433855-67433877 CATAAAAAGCCAGAGAAAATGGG + Intergenic
1118961200 14:70534939-70534961 CCAAAAAAGAAAGATAAAATGGG + Exonic
1118984119 14:70738878-70738900 TAGAGAAAGACAGATAAGAGAGG + Intronic
1119416170 14:74471036-74471058 AAGATAAACACAGATAACAATGG + Intergenic
1119720954 14:76890016-76890038 AAGAAAAAGAAAGATTACTTTGG + Intergenic
1119907116 14:78316092-78316114 CAAAAAGAGGCAGATAAAATAGG - Intronic
1120136083 14:80871130-80871152 CAGAGAAAGCCACATAACGTAGG + Intronic
1120255296 14:82111118-82111140 CAGCAAAAGACAGATTACATAGG + Intergenic
1120326566 14:83037172-83037194 CAGAAGAAGACAGAAAATGTGGG - Intergenic
1120481867 14:85059730-85059752 GAGAAAAAGATAGCTAACATTGG + Intergenic
1120707062 14:87756139-87756161 CAGAAGAAGACAGGTCACATGGG - Intergenic
1121467509 14:94125543-94125565 TAAAAAAAGAGAAATAACATGGG - Intergenic
1121636906 14:95460151-95460173 GTGAAAAAGAGAAATAACATTGG + Intronic
1123503506 15:20914121-20914143 AAGAAAAAGAAAGACAATATTGG - Intergenic
1123560753 15:21487786-21487808 AAGAAAAAGAAAGACAATATTGG - Intergenic
1123596992 15:21925082-21925104 AAGAAAAAGAAAGACAATATTGG - Intergenic
1123821862 15:24038204-24038226 CAGAAAAAGAAATGTGACATGGG + Intergenic
1123951053 15:25275665-25275687 CAGAAAAAGACAGATCAAGTGGG - Intergenic
1124173510 15:27399817-27399839 CACACAAAGACAGAAAAGATCGG + Intronic
1124176613 15:27431175-27431197 TTGAAAAAGAAAAATAACATTGG - Intronic
1124185475 15:27523933-27523955 CAGAAAAAGAGAAATAGAATGGG + Intronic
1124390668 15:29253739-29253761 CACAAAAAGAGAGACAATATTGG - Intronic
1124412120 15:29445272-29445294 CACAAAAAGACACATCACCTTGG - Intronic
1124596602 15:31096726-31096748 TAGCAAAGGACAGAGAACATCGG - Intronic
1124647139 15:31445623-31445645 CAGTGAAAGACAGAAAACAAAGG - Intergenic
1125174314 15:36803335-36803357 CAGAAAGTGACAGAGAACAGTGG + Intronic
1125233545 15:37484852-37484874 CAGAAAAAGACAGGTAAATGTGG - Intergenic
1125584308 15:40809471-40809493 GAGAAAAAGACAAAGAGCATTGG + Intronic
1126006633 15:44264253-44264275 GAGAAGAAGGCAGATAACCTGGG + Intergenic
1126246715 15:46515614-46515636 CAAAAAAACAAAGAAAACATTGG - Intergenic
1126466776 15:48967781-48967803 GTGAAAAAAACAGAAAACATTGG - Intergenic
1126499016 15:49323743-49323765 CTGAAAAAGACAGCTAGCAGTGG - Intronic
1126723456 15:51606855-51606877 GATAAAAAGATAGAAAACATGGG + Intronic
1127295334 15:57604199-57604221 CAGAAAGAGCCAGATGACCTTGG - Intronic
1129460486 15:75697905-75697927 TGGAAGAAGACAGCTAACATGGG + Intronic
1129724377 15:77894131-77894153 TGGAAGAAGACAGCTAACATGGG - Intergenic
1129999212 15:80032748-80032770 CAGCAAAAGAGAGAAGACATTGG + Intergenic
1130164030 15:81434424-81434446 CATAAAAAGAGAAATAATATGGG + Intergenic
1130237400 15:82148546-82148568 AAGAGAAAGATAGGTAACATAGG - Intronic
1131273771 15:90963327-90963349 CATAAAAAGACAAATACTATGGG - Intergenic
1131621174 15:94069875-94069897 AAGAAAAAGACTGATAAGACTGG + Intergenic
1132194680 15:99904233-99904255 CAGAAAAAAATAAAAAACATTGG - Intergenic
1132436503 15:101808958-101808980 CAGAAAAAGAAATGTAAAATAGG - Intronic
1202969098 15_KI270727v1_random:214950-214972 AAGAAAAAGAAAGACAATATTGG - Intergenic
1133346363 16:5073389-5073411 CATAAATAGACACATACCATAGG - Intronic
1133668033 16:7989293-7989315 CAGAAAAAGGAAGAGAACAAGGG + Intergenic
1133901055 16:9975194-9975216 CATAAAAAGGCAGATATAATGGG + Intronic
1134209020 16:12260467-12260489 TAGACAACAACAGATAACATGGG - Intronic
1134855258 16:17513327-17513349 TAGAAAAAGACAGAAAATCTGGG - Intergenic
1135116446 16:19727694-19727716 AAGAAAATGTCAAATAACATAGG - Intronic
1135468702 16:22709928-22709950 AAGAAAAAGAAAGAAAACATTGG - Intergenic
1137000317 16:35224234-35224256 AAGAAAAAAACAGAGAACAAGGG + Intergenic
1137413710 16:48252108-48252130 CTGAAAAACACACAAAACATCGG - Intronic
1138284202 16:55795324-55795346 CAGTAAAAGACCGATAATCTGGG - Intergenic
1138284800 16:55801663-55801685 CAGTAAAAGACCGATAATCTGGG + Intergenic
1138890759 16:61141694-61141716 CAGAAGAGGACAGAAAAAATGGG - Intergenic
1139295052 16:65893510-65893532 CAGAAAAAGTCAGCTAAAACAGG - Intergenic
1140054281 16:71511783-71511805 TGGAAAAAGGCAGATAACAGTGG + Intronic
1140344952 16:74204011-74204033 CAGAAATAGAAAGCTAATATAGG + Intergenic
1140510214 16:75502158-75502180 CAGAGAAAAACAGAGAACGTGGG - Intergenic
1140515978 16:75542214-75542236 CAGAGAAAAACAGAGAACGTGGG - Intronic
1140929709 16:79615994-79616016 AAGAAAATAACAAATAACATTGG - Intergenic
1141206666 16:81938194-81938216 CGGAAAGAGAAAGAAAACATGGG + Intronic
1141633159 16:85300007-85300029 CAAAAAAAAAAAGCTAACATGGG - Intergenic
1141687474 16:85578491-85578513 CAGAACAAGACAGAGAAAGTCGG - Intergenic
1141967981 16:87459879-87459901 TAGAAAAATACACATAAGATTGG + Intronic
1144397986 17:14864077-14864099 TAGAAAAAGTTAGATAATATTGG - Intergenic
1145182101 17:20762111-20762133 CAGAAAAAAATACATTACATAGG - Intergenic
1146731532 17:35196773-35196795 AAAAAAAAGAAAGAAAACATAGG - Intergenic
1147166539 17:38596427-38596449 CAGGACAACACAGAAAACATGGG + Intronic
1147356445 17:39901834-39901856 CAGAAAAAAATAGAAAACATGGG - Intergenic
1148433556 17:47662888-47662910 CCGAAAAAGAGAGACAAAATGGG + Intronic
1149327436 17:55546572-55546594 CAGAAAAACACAGCCAACACTGG + Intergenic
1149455903 17:56788177-56788199 CTGAAACAGACAGAGACCATTGG - Intergenic
1150032173 17:61750495-61750517 AAGAAAAATACAGATAAACTCGG + Intronic
1150664185 17:67115584-67115606 CAGAAAAACACAGATAAGGATGG + Intronic
1150883645 17:69059688-69059710 CAGCAATAGAAAGTTAACATGGG + Intronic
1150935817 17:69634256-69634278 CACAGAAAGACAGATATCATAGG + Intergenic
1150961712 17:69920513-69920535 CAGAAGATGAGAGATAAAATGGG - Intergenic
1151004924 17:70423493-70423515 GAGAAAATGACAGATAAGACTGG - Intergenic
1151036613 17:70808095-70808117 CAGACAAATACACATAGCATGGG - Intergenic
1151149960 17:72076514-72076536 CAGAAAAAGGCAGATGCCACAGG + Intergenic
1151873783 17:76854536-76854558 CACAAAAAGACAAATACTATGGG - Intergenic
1152195164 17:78913724-78913746 CAAAAAAAAACAAAAAACATAGG + Intronic
1155492652 18:26415563-26415585 TAGAAAAAGAAAGATAAAAAGGG - Intergenic
1155531167 18:26768296-26768318 CAGCAAAAGAAAGATAATAAGGG - Intergenic
1155654951 18:28181219-28181241 CAGAATAAGATAGAGAGCATAGG - Intergenic
1155669633 18:28353786-28353808 TAGAAAAATCCAGATAAGATGGG + Intergenic
1156441556 18:37194403-37194425 AAGAAAAAGACTAATAACAGTGG - Intronic
1156901063 18:42300511-42300533 CAGGAAATGACATATAACACCGG - Intergenic
1157183509 18:45518709-45518731 CAGAAAAAGACGGATAATCTAGG + Intronic
1157407008 18:47430162-47430184 CCTAAAAAGACAGCTGACATGGG + Intergenic
1157655443 18:49383114-49383136 AAGAAAAAGACAGATGAAAAGGG + Intronic
1158484382 18:57852145-57852167 AAGAAAAAGACAGACAATAAAGG - Intergenic
1158686029 18:59615450-59615472 CAGGAAAAGGCAGATGACATTGG - Intronic
1159186970 18:64987581-64987603 CAGAAGAAGTAAAATAACATAGG - Intergenic
1159412113 18:68092158-68092180 AAGAAAAAGAAAGAGAAAATTGG + Intergenic
1160631659 18:80250710-80250732 CAGAAAATGAGAGAGAAAATAGG + Intergenic
1163059170 19:14745839-14745861 CACAAAAAGACAAATACCACAGG - Intronic
1163401102 19:17093344-17093366 AAGAAAAAGACATATATCTTCGG + Intronic
1163533669 19:17864835-17864857 CAAAAAAAGAAAGATATCCTGGG - Intergenic
1163894765 19:20048993-20049015 CAACAAAACACAGATAATATTGG + Intergenic
1164080423 19:21857469-21857491 CATAAAGAGACAGAGAACAAAGG - Intergenic
1164660674 19:29963968-29963990 CAGAATTTGACAGATACCATGGG + Intronic
1166126016 19:40715825-40715847 CAGAGAAAGAAAGATAGGATGGG - Intronic
1166142028 19:40810431-40810453 AAGACAAGAACAGATAACATTGG + Intronic
1167570574 19:50285989-50286011 CAGAACGAGACAGATACAATGGG - Intronic
1167782663 19:51609825-51609847 CAGAAAACAAAATATAACATGGG - Intergenic
1167989604 19:53347179-53347201 AATAAAAAGACAGATAAGCTGGG - Intronic
1168074288 19:53970962-53970984 GAAAAAAAGAAATATAACATGGG + Intronic
925035847 2:685152-685174 CAGAAAAAGACAGATAGATGTGG + Intergenic
925534634 2:4902894-4902916 CAGAAAAAACCAGATATAATTGG + Intergenic
925716275 2:6786857-6786879 GAGAAACAGAAAGATGACATGGG + Intergenic
926024596 2:9530305-9530327 CAGAAAAAGACAGCTGGCTTTGG + Intronic
926042745 2:9687771-9687793 GAGAAAAAGAAACATAAAATAGG + Intergenic
926763430 2:16301141-16301163 AAGAAAAAAATAGATAAAATAGG - Intergenic
926788653 2:16546908-16546930 CAGAAAAGGAAAGTTAGCATGGG + Intergenic
927106912 2:19835779-19835801 CCCAAAAAGACAGAAAACACAGG + Intergenic
927389136 2:22573310-22573332 AAAAAAAAGACAGATAATAATGG + Intergenic
927392854 2:22614916-22614938 CTGAAAAAGAGTGATATCATAGG - Intergenic
927655088 2:24938492-24938514 CAAGAAAAGAAAGAAAACATAGG + Intergenic
927799205 2:26081599-26081621 CAGAAACAGGAAAATAACATTGG - Intronic
928155712 2:28874416-28874438 CAAAAAAAAACAAAAAACATTGG - Intergenic
928194883 2:29208390-29208412 AAGGAAAAGTCAGATAACAGAGG + Intronic
928781076 2:34821316-34821338 CATAAACAGACTGATCACATTGG + Intergenic
929803182 2:45121809-45121831 GAGAAATAGCCAGATAACATTGG - Intergenic
929847932 2:45551759-45551781 AAGAAAAAAACAGATCACAAAGG + Intronic
930597421 2:53405451-53405473 CAGATAAATACAAATAACAGTGG - Intergenic
931089982 2:58875477-58875499 AAGAAAAAGACACAGAAGATTGG - Intergenic
931224433 2:60317423-60317445 CAGTAACAGACAGTTCACATTGG + Intergenic
931923817 2:67049160-67049182 AAGAAATAGGCAGATGACATTGG - Intergenic
932267837 2:70383513-70383535 CAGCAAGAGACAGAGAACAAGGG - Intergenic
932312776 2:70757242-70757264 CAAAAAAACACAGCTAAAATTGG + Intronic
932546780 2:72719829-72719851 CAGAAAGAAACAAAGAACATGGG + Intronic
934701954 2:96449525-96449547 TACAAAAATACAGATAACAAAGG - Intergenic
936043684 2:109169808-109169830 CAGAAAAAGATAAGTCACATAGG + Intronic
936403323 2:112182419-112182441 AAGATAAAGAGAGTTAACATGGG + Intronic
936822814 2:116543343-116543365 CAGAAAAAGACAGAAAGAAGTGG - Intergenic
937512986 2:122619341-122619363 CATAAAGAGAAAGAGAACATAGG - Intergenic
938054771 2:128206537-128206559 AAGAAAAAAACAGATAAATTGGG + Intergenic
938078014 2:128351253-128351275 AAGAAAAAGACTGATAATTTAGG + Intergenic
938189621 2:129264520-129264542 TAGAGAAAGACAAATAACATAGG + Intergenic
938232990 2:129678146-129678168 CTGAGAAAGACAGCTAAAATGGG - Intergenic
938602517 2:132856657-132856679 AAGTAAAAGACAGAACACATAGG + Intronic
938968053 2:136406019-136406041 CAAAAAAAAAAAGATAGCATTGG - Intergenic
939669145 2:144988251-144988273 CAGAAAAAGAGAAAGAAAATAGG - Intergenic
939823892 2:146990740-146990762 CAGAGAAGGAGAGATAAAATTGG + Intergenic
940049177 2:149443354-149443376 CAGTGACAGACAGATAAAATTGG + Intronic
940431006 2:153589403-153589425 CAGAAGAAGACAGAAAATGTGGG - Intergenic
940533192 2:154905593-154905615 CAGAAGAAGACAGAAAATGTGGG - Intergenic
941483430 2:166047279-166047301 CAGATATAGAAAGATAACTTTGG - Intronic
942229167 2:173843658-173843680 CAGGCAAATACAGAAAACATGGG - Intergenic
943545664 2:189273747-189273769 CACAGAAAGACAAATATCATGGG + Intergenic
943548145 2:189307007-189307029 CAGACAAAGACATACAAAATAGG - Intergenic
943871795 2:193009019-193009041 CAGAAAAAGACAGGTAAATGTGG - Intergenic
943935699 2:193913402-193913424 AAAAAAAAGAAACATAACATTGG - Intergenic
944052795 2:195490463-195490485 GAAAAAAAGACAAATTACATAGG - Intergenic
944084667 2:195831738-195831760 CAGACAAAGACAGAAGACTTAGG + Intronic
945046455 2:205786264-205786286 CAGTAAAAGATAAATAACAAAGG - Intronic
945050905 2:205823433-205823455 GAGAGAAAGAAAGAAAACATGGG + Intergenic
945240265 2:207670277-207670299 AAGAAAAAGAAAGAAAATATAGG - Intergenic
945469024 2:210205698-210205720 CAGAAAAAGGCTAATACCATGGG + Exonic
945794022 2:214339645-214339667 CAGGAAATGACAGATAAAATAGG - Intronic
946562571 2:220929031-220929053 CAGAAAAAGACAGAAAAATGTGG - Intergenic
946988525 2:225302054-225302076 CAGAAGAAGACAGATAAATGTGG + Intergenic
947292869 2:228597062-228597084 CAGAAAAATACAAATGACATAGG + Intergenic
947880017 2:233499935-233499957 CAGAAACAGAAAACTAACATTGG - Intronic
948504164 2:238416767-238416789 CAGAGAAAGAGAGACCACATAGG - Intergenic
1169715912 20:8617673-8617695 TACAAAAAGACAGATTACATTGG - Intronic
1170272261 20:14540445-14540467 CAGAAAAAGAGAGTTCACAAAGG + Intronic
1170275922 20:14588005-14588027 CAGAAAAAGACAGATAACATTGG - Intronic
1170307132 20:14950911-14950933 CATAAAAAGCCAGATCCCATAGG - Intronic
1171402730 20:24888860-24888882 CCCAAAAAGACAAATATCATAGG + Intergenic
1172919378 20:38468483-38468505 CAGACTAAGACAGAGGACATAGG + Intergenic
1173024318 20:39293925-39293947 CTGCAAAACACAGATAACAGTGG - Intergenic
1174922392 20:54717732-54717754 CACAAAAAGACAGGGGACATGGG + Intergenic
1175726998 20:61325335-61325357 CAGAAAGAGAAAGATACCTTTGG - Intronic
1175905202 20:62376247-62376269 CTGTAAAATACAGATAACAAGGG - Intergenic
1176137777 20:63532113-63532135 CAGACACACACAGATCACATTGG - Intronic
1176388804 21:6152959-6152981 CAGAGAAACACACACAACATGGG + Intergenic
1176456942 21:6921503-6921525 CACAAAAAGACAAATACTATGGG - Intergenic
1176835115 21:13786563-13786585 CACAAAAAGACAAATACTATGGG - Intergenic
1177047545 21:16189018-16189040 CAGGATAAGACAAATAACTTCGG - Intergenic
1177659701 21:24066725-24066747 CTGAAAGAGTCAGATAATATGGG + Intergenic
1178586893 21:33878406-33878428 CAGAAACAGAGAGAAAAAATGGG - Intronic
1178761835 21:35410632-35410654 CTGCAAAATACAGATAAAATGGG - Intronic
1178987515 21:37319799-37319821 CACAAAAAGACAAATATGATAGG + Intergenic
1179309255 21:40182275-40182297 AAGAATAAGACAGAGAACAAGGG - Intronic
1179734668 21:43385289-43385311 CAGAGAAACACACACAACATGGG - Intergenic
1179769487 21:43603768-43603790 CAAAAAAAGGCAGATAAACTAGG + Intronic
1180204384 21:46248536-46248558 CAGATATAGACAGATAGCCTTGG + Intronic
1180743182 22:18067887-18067909 AAGAAAGAGACAGACAACATAGG - Intergenic
1181493305 22:23274181-23274203 CATTAAAAAACAGTTAACATCGG + Intronic
1181561889 22:23709060-23709082 CATGAAAAGGCAGATAACACAGG - Intergenic
1182156595 22:28079228-28079250 AAGGAGAAGACAGATAAGATAGG + Intronic
1183133623 22:35865081-35865103 CATAGAAAGATAGATAACTTTGG + Intronic
1183555805 22:38525986-38526008 AAGAAAAAGAAAGATATTATGGG + Intronic
1185404632 22:50640851-50640873 AAAACAAAAACAGATAACATTGG + Intergenic
949168770 3:972768-972790 TAGAAAAAGACAGATGAGAGAGG - Intergenic
949470395 3:4390087-4390109 CAGAGAAAGACAGCTAAAACAGG - Intronic
949747872 3:7315742-7315764 AAGAAAAAGACAAATAGGATGGG - Intronic
949941691 3:9159556-9159578 CAGTTAAAGACACATAACCTGGG + Intronic
950965398 3:17142560-17142582 CAGAAAAAGAAAGAAAAAAGAGG + Intergenic
951337795 3:21445257-21445279 CAGAAAAAGACAGATGTAAAAGG + Intronic
951478822 3:23138071-23138093 CATAAAAGGAAAGATAATATTGG - Intergenic
952049715 3:29369702-29369724 CAAAAAGAGACAGAAAATATGGG + Intronic
953267570 3:41407134-41407156 CAGGAAGAAACAGATAACCTGGG + Intronic
954910849 3:54106313-54106335 CTGAAAAAGAAATATAACAGTGG - Intergenic
955468843 3:59264935-59264957 CAGAAAAACAAAGAAAACCTAGG - Intergenic
955551550 3:60090548-60090570 CAGAAGAAGAAAGAGAACACAGG - Intronic
955712459 3:61794440-61794462 CTGAAAAAGTCAAATTACATAGG - Intronic
955756239 3:62227895-62227917 CAGAAGAAGCCAGATAACTGGGG - Intronic
955896842 3:63709382-63709404 CAGACTAACACAGTTAACATTGG + Intergenic
956115482 3:65913751-65913773 CAGCAGAAGACAGTTAACAGAGG + Intronic
956530520 3:70212784-70212806 CAAAAAAAGAGAGAGAAAATGGG - Intergenic
957447211 3:80329055-80329077 CAAAAGAAGAAAGCTAACATTGG - Intergenic
957585136 3:82123228-82123250 CAGAAAAAGCCAGTAAATATAGG + Intergenic
957647054 3:82944093-82944115 CAGAAGAGGAGAGATAAAATTGG - Intergenic
959110765 3:102119772-102119794 CAAAAATAGACAAATAAGATTGG - Intronic
959269109 3:104182969-104182991 CATTAAAACACAGTTAACATAGG + Intergenic
959445006 3:106428070-106428092 CAGAGAAAGACAAATGAAATGGG + Intergenic
960082058 3:113552418-113552440 CAGAAAAGGAAAGAGGACATAGG + Intronic
960086651 3:113598373-113598395 CACACACAGACAGAGAACATTGG + Intronic
960123885 3:113976569-113976591 GAGAAACAGAAAGAAAACATAGG + Intronic
962450836 3:135515696-135515718 CTGAGAAAGACAAATAAAATGGG + Intergenic
962548266 3:136460160-136460182 CAGAAAAAGAGACATTACAATGG + Intronic
963312386 3:143722972-143722994 CAGAAAAAAATAGGTAGCATTGG - Intronic
963454375 3:145524355-145524377 CATAAAAAGAAATATAATATGGG + Intergenic
963941482 3:151099999-151100021 CCCAAAGAGACAGTTAACATCGG + Intronic
964020871 3:152008824-152008846 CAGATGAAGAAAGATGACATTGG - Intergenic
965501480 3:169461053-169461075 TAGAAAAAAAAAGAAAACATTGG - Intronic
965620878 3:170641329-170641351 GAGAAAAAGAAAGACAACAAAGG + Intronic
966075379 3:175930577-175930599 CAGAAATAGACATAGAAAATGGG - Intergenic
966159703 3:176955070-176955092 GAGGAGAAGACAGATAATATAGG + Intergenic
966241074 3:177756021-177756043 TAGAGAAAGACAGATATCACTGG - Intergenic
966676153 3:182592754-182592776 CAGAGAAAGACAGATAATAAAGG + Intergenic
966745496 3:183271645-183271667 TAGAAAATGACACATAACACGGG + Exonic
967530519 3:190544234-190544256 CAGAAAAAGTCAGAAAACAGAGG - Intronic
967758881 3:193201768-193201790 AAGGAAAAGACAGAAAATATGGG + Intergenic
967956596 3:194881921-194881943 CAGAAAATGACAAATGACTTAGG - Intergenic
968395763 4:235673-235695 AAGAAACAGACAGATATAATAGG - Intergenic
969088638 4:4675474-4675496 CTGGAAAAGACAGAAAAGATGGG - Intergenic
970224577 4:13844186-13844208 CAGAAAAAGAGAGAGAAGAAAGG - Intergenic
970468528 4:16352123-16352145 AAGAAAAAGAGAGAAAATATGGG + Intergenic
970568800 4:17359072-17359094 AAGAAAAAAAAAGATAACATAGG + Intergenic
970861586 4:20709697-20709719 CAGTAAAACACAGATTACAGTGG + Exonic
970909556 4:21258718-21258740 TAAAGAGAGACAGATAACATTGG - Intronic
971931051 4:33083419-33083441 CAGAACAATACAGTTAATATAGG + Intergenic
971971333 4:33624278-33624300 TAGAAAAAGAGAGATAAAATGGG + Intergenic
972619142 4:40730093-40730115 CAGAGACAGACAGATCACTTGGG + Intergenic
973096381 4:46206126-46206148 CAGTGAAAGCCAGACAACATTGG + Intergenic
974191982 4:58517508-58517530 TAGATAAAAACAGAAAACATGGG + Intergenic
974559793 4:63502516-63502538 CAGAGAAAGACAGAGAAGTTTGG + Intergenic
974723658 4:65773121-65773143 CAGAGAAAGACAGATCCCACTGG - Intergenic
975491242 4:74991077-74991099 TAAAAGAAGTCAGATAACATGGG + Intronic
976584394 4:86779088-86779110 AAGAAAAACAGAGATAATATTGG + Intronic
977189041 4:93977135-93977157 CAGAAAAAGACAGAAAAATATGG + Intergenic
977846272 4:101771635-101771657 CAAAAAAATACAGAGAACACTGG - Intronic
978675848 4:111314948-111314970 CAGAAAAATAAAAATAAAATTGG - Intergenic
978718966 4:111882862-111882884 CAGTAAAAAACACAAAACATGGG + Intergenic
979327886 4:119400267-119400289 AAGAAGATGACAGAAAACATAGG - Intergenic
979570467 4:122217676-122217698 CAGAAAAAGACATTTAAAAAAGG - Intronic
979859700 4:125678017-125678039 CTGATAAAGACAGATAAAATGGG - Intergenic
980391810 4:132156682-132156704 CAGAAAAAGACAGAAAAATGTGG - Intergenic
981436973 4:144736001-144736023 AACAAAAAGACAGAGAAGATGGG - Intronic
982012736 4:151122630-151122652 CAGAAGAGGACAGAAAGCATGGG + Intronic
982262347 4:153505766-153505788 CAGAAAAAGAGAGCTAATTTGGG + Intronic
982717119 4:158820703-158820725 CACAAAAAGACAGTTATCACTGG - Intronic
983085472 4:163438810-163438832 CAGAAAAATAGATATAACAATGG + Intergenic
983086259 4:163448468-163448490 AAGTAAAAGGCAGTTAACATTGG + Intergenic
983292925 4:165829017-165829039 AAGAAATAGACAAATGACATGGG - Intergenic
983519309 4:168690274-168690296 TAGATAAAGAAAGTTAACATTGG + Intronic
983752332 4:171290573-171290595 GAGAAATAGACAAAAAACATAGG + Intergenic
984143459 4:176032493-176032515 GAGAAATAGACAGATGAGATAGG + Intergenic
984369590 4:178845852-178845874 CAGAAAAAGACAAGACACATAGG + Intergenic
984382206 4:179009295-179009317 GAGACAAATACATATAACATTGG - Intergenic
984699485 4:182809500-182809522 CAGAAAAAGGGGGACAACATTGG - Intergenic
985046051 4:185941383-185941405 TGGGAAAAGACAGATAATATAGG - Intronic
985201324 4:187488128-187488150 CAGAAGAAGACAGAAAATGTGGG + Intergenic
985417615 4:189752738-189752760 CAGAAGAAGACAGAAAATATAGG + Intergenic
986862261 5:11940735-11940757 CAAAAAATGACAGATCACAGGGG + Intergenic
986957695 5:13174879-13174901 CAGAACAAGAAAGATAAAATAGG + Intergenic
986960436 5:13203678-13203700 CAGAAGAAGACAGAAAATGTGGG - Intergenic
987805040 5:22753444-22753466 AAAAAAAAGGCAGATGACATAGG + Intronic
988165861 5:27589231-27589253 CTGTAAAAGCCAAATAACATTGG - Intergenic
988498602 5:31765490-31765512 CAGAAAGAGAGAGAGAACAGGGG - Intronic
989545541 5:42668201-42668223 CAGAAAAAGAAAGTTTAGATAGG + Intronic
990171319 5:53053184-53053206 AAAAAGAAGACAGATAAAATGGG - Intronic
990194396 5:53297813-53297835 AAAAAAAAGACAAATCACATAGG - Intergenic
990452381 5:55947284-55947306 GAGAAGAAGACAGATTACAAAGG + Intronic
991370875 5:65918257-65918279 AAGAAAAAGAAAGATTAGATAGG + Intergenic
991432322 5:66561378-66561400 CTGCATAAGACAGATAAAATTGG + Intergenic
992123953 5:73622819-73622841 CAAAAAACGACCAATAACATGGG + Intergenic
992479090 5:77132735-77132757 CAGAGGAAGATAGAAAACATAGG - Intergenic
992550385 5:77854096-77854118 CAGTAAAAGACAGATGACCACGG + Intronic
993788944 5:92182740-92182762 CAGAAAACGAGAGATAATATAGG + Intergenic
994093979 5:95832348-95832370 CAGAGAAAGAACCATAACATAGG + Intergenic
994558990 5:101343599-101343621 CAAAAATAGACAGATAAAAATGG - Intergenic
994755716 5:103791190-103791212 CAGAAGAAAACAGAAAATATGGG - Intergenic
995575698 5:113530808-113530830 CAGAGAAAGAAAAATAACATAGG - Intronic
995971411 5:117975351-117975373 CACAGAAAGACAGATACCACAGG - Intergenic
996173479 5:120325244-120325266 CACAGAAAGACAAATACCATAGG + Intergenic
996355308 5:122589538-122589560 GTGAAAAAGGCAAATAACATTGG - Intergenic
996437150 5:123447269-123447291 CAGTAAAACACAGATAGCATAGG + Intergenic
996608157 5:125348146-125348168 AAAAAAAAGAAAGAAAACATGGG - Intergenic
997987615 5:138515702-138515724 GAGCAAAAGCCAGACAACATGGG + Intronic
998304856 5:141064237-141064259 AAGAAAAAGAAAGTTAGCATGGG + Intergenic
998392745 5:141797843-141797865 CAAAGAAAGAAAGAAAACATAGG - Intergenic
998722386 5:144968016-144968038 CTGAAACAGACAAATAAAATTGG + Intergenic
998766686 5:145496427-145496449 CAGAAAAAAAGAGATAACCTGGG + Intronic
999588339 5:153116293-153116315 CTGTAAAAGACATATAACTTGGG - Intergenic
1000554622 5:162710624-162710646 TAGAAACAGACAGGTAACTTTGG - Intergenic
1001499911 5:172223135-172223157 CAGAAAAAAATAGATAATTTAGG + Intronic
1001636241 5:173212455-173212477 CACAAAAGGACAAATAATATAGG + Intergenic
1001817895 5:174686111-174686133 ATGAAAAAGACAGATGACAATGG - Intergenic
1001883698 5:175269375-175269397 CAAAAAAAGACAAATAGCATAGG + Intergenic
1002308459 5:178298140-178298162 CAGTAAAAGCCAGATGACCTGGG + Intronic
1003419312 6:5941407-5941429 CAAAAGAAGCCAGATAACTTAGG + Intergenic
1003583571 6:7365056-7365078 AAGATAAAGGCAGATAAAATAGG - Intronic
1004602295 6:17162102-17162124 CAGAAAAAGAGAGATGCCAGGGG + Intergenic
1004955067 6:20720503-20720525 TAAAGAAAGACAGATAACAGAGG - Intronic
1005013142 6:21355043-21355065 CAGAAACAGAGAGATCACCTGGG + Intergenic
1005748810 6:28864555-28864577 CAGAAGAAGACAGACAAAAAAGG - Intergenic
1006286086 6:33095610-33095632 AAGAAAAAGAGAGAGTACATTGG + Intergenic
1007089928 6:39177435-39177457 CAAGAAAAGACAGATGGCATTGG + Intergenic
1007478224 6:42133358-42133380 CAGAAAAAGCCAGACACCAAGGG - Intronic
1008121094 6:47617661-47617683 CAGAACAAGACAGATACAGTGGG - Intronic
1008276940 6:49552910-49552932 TAGAAAAAGAAAGAAAACCTAGG - Intronic
1008284961 6:49638444-49638466 CAGAGAAAGAGAGATGCCATCGG - Intergenic
1008709114 6:54201702-54201724 CAGAAAAAGAAAGTTGTCATGGG + Intronic
1008910416 6:56726254-56726276 CAGAGAAAGACAAATAGCAAAGG - Intronic
1009214313 6:60901764-60901786 CATAAGAATACAGATAACAAGGG + Intergenic
1009546121 6:65021565-65021587 CAGAAAAAGACAGAAAAATGTGG - Intronic
1010268557 6:73894419-73894441 CAGCAACAGACAGATAACCCAGG - Intergenic
1011032412 6:82938013-82938035 TAGATAAAGTCAGATTACATAGG - Intronic
1011064141 6:83306473-83306495 GAGAAAAAGATAGGTAACAATGG + Intronic
1011516759 6:88163916-88163938 CAGAAAAAGACAGAAAACAGTGG + Intronic
1011579611 6:88845563-88845585 AGGAAAAAGACAGAAAAGATGGG - Intronic
1011673010 6:89702160-89702182 CGGGAAAAGACACACAACATAGG + Intronic
1012029704 6:94042855-94042877 CATAAAAACACTGAGAACATAGG - Intergenic
1012487041 6:99733734-99733756 CAAAAAAATAAAGATAAGATAGG - Intergenic
1012661876 6:101908745-101908767 TATGAAAAGACAGATAAGATAGG + Intronic
1012788558 6:103662163-103662185 TAGAAAAAAACAGATAAAATTGG - Intergenic
1013072814 6:106744204-106744226 CAGTAAAATACAGATAAGACGGG - Intergenic
1013224365 6:108109529-108109551 AAGGCAAAGACAGATGACATTGG + Intronic
1013455039 6:110322873-110322895 CTGCAAGAGACAGAAAACATAGG + Intronic
1013588695 6:111602300-111602322 CAGAAAAAAAAAAAAAACATGGG - Intronic
1014290312 6:119550776-119550798 CAGAAACAGACAGGTAACAAGGG + Intergenic
1014334720 6:120119215-120119237 CAGCAAAATACAGATGACACAGG + Intergenic
1015737046 6:136412449-136412471 GAGAAAAATACAGAGAATATAGG + Intronic
1016014858 6:139173232-139173254 CAGCCAAAGACAGATAACCTTGG - Intronic
1016892376 6:149019525-149019547 AAGAGAAAGACAAACAACATGGG - Intronic
1017050071 6:150382635-150382657 AAGAGAAAGACAGAAAACATAGG - Intronic
1017902655 6:158731538-158731560 AAGAAAAAGAGAGATAACTTTGG - Intronic
1018895097 6:168009907-168009929 CAGAAAAAGAGATATCACAACGG - Intronic
1019890958 7:3946047-3946069 AAGAAAAACACAGAAAACAGAGG + Intronic
1020183348 7:5939700-5939722 CAGAACAGGACATAGAACATGGG + Intronic
1020221355 7:6240732-6240754 AGGAAGAAAACAGATAACATCGG + Intronic
1020299564 7:6785058-6785080 CAGAACAGGACATAGAACATGGG - Intronic
1020790769 7:12625873-12625895 TAGAAAAAAATAGAAAACATTGG + Intronic
1021352378 7:19610959-19610981 CAGAAAAAAACAGGTGTCATGGG - Intergenic
1021363238 7:19743321-19743343 CAGAGAAAGACAGAAAAAGTTGG - Intronic
1021500132 7:21323721-21323743 CAGAAAAAGACTGTAAACTTGGG + Intergenic
1022076604 7:26977339-26977361 CCGAAAAACAAAGAAAACATTGG - Intronic
1022290001 7:28992143-28992165 CTGAAAAAGACACTTAACAGAGG + Intergenic
1022677907 7:32516963-32516985 AAGAAAGAGATAGATAACTTAGG - Intronic
1022862453 7:34382478-34382500 CAGAAAAAGACAGGAAAATTTGG + Intergenic
1022886262 7:34648629-34648651 CAGTAAAAGACAGAAAACAAAGG + Intergenic
1023651519 7:42374098-42374120 CAGGAAAAGATGGATAAGATGGG + Intergenic
1025042518 7:55660553-55660575 CAGAAAAAGGCTTATAGCATTGG - Intergenic
1026106613 7:67426070-67426092 CGGAGAAAGAAAGATAAAATGGG - Intergenic
1026276591 7:68883616-68883638 TTGTAAAAGACAGATAAAATGGG - Intergenic
1026969521 7:74459458-74459480 CAAAAAAAAAAAGATAAGATAGG + Intronic
1027018680 7:74795534-74795556 AAGGCAGAGACAGATAACATAGG + Intergenic
1027069349 7:75150405-75150427 AAGGCAGAGACAGATAACATAGG - Intergenic
1027396345 7:77758795-77758817 TAGAAAAAGGCAAATAAAATAGG + Intronic
1028127388 7:87129450-87129472 CAGAAAGAGAAAGATCACAGGGG - Intergenic
1028361779 7:89976337-89976359 CGGAAAAAGACAAATAAAAGTGG - Intergenic
1028465538 7:91147459-91147481 TAGAAAAATAGAGTTAACATGGG - Intronic
1028716267 7:93973637-93973659 CACAGAAAGACAGATAAGAGAGG + Intronic
1030283925 7:107805807-107805829 AATAAAAAGAAAGATATCATTGG + Intergenic
1030853445 7:114519870-114519892 TATAAAAAGACGGATAAAATTGG - Intronic
1030925711 7:115451645-115451667 CTGAAAAAAGCAAATAACATGGG - Intergenic
1031196773 7:118625253-118625275 CAGAGAGAGAGAGATAAAATGGG + Intergenic
1031308014 7:120158397-120158419 CAGGAACAGAAAAATAACATAGG - Intergenic
1031423906 7:121583266-121583288 AAGTAAAAGAAAGATAATATTGG + Intergenic
1031874913 7:127128504-127128526 CAGATAAAGACAGATGACTTTGG - Intronic
1031954038 7:127923764-127923786 CAGAAAAACATAGATAACGATGG + Intronic
1032453947 7:132057677-132057699 CAGAAGAAGACAGGGAAAATTGG + Intergenic
1032538849 7:132686859-132686881 CAGAAAAACACACACAAAATAGG - Intronic
1032972286 7:137178539-137178561 AAGAAAAAGAAAGAAAACATTGG + Intergenic
1033062896 7:138124750-138124772 CAGAAAAGGATAATTAACATTGG - Intergenic
1034311896 7:150095678-150095700 CAGAAAAAGACAGAAGGCAATGG + Intergenic
1034330601 7:150278937-150278959 CAGAAAAAAATACATATCATTGG - Intronic
1034667442 7:152830911-152830933 CAGAAAAAAATACATATCATTGG + Intronic
1034794961 7:154004980-154005002 CAGAAAAAGACAGAAGGCAATGG - Intronic
1035479502 7:159170846-159170868 CAGAAACACACAGATAACCAAGG + Intergenic
1036407356 8:8467100-8467122 CAGATAAAGACAGACAAGAATGG - Intergenic
1036515173 8:9437199-9437221 CAGAAAAATAAAGATAACAGTGG - Intergenic
1037315099 8:17593264-17593286 CAGTAAAAAACATATAACATAGG + Intronic
1037568133 8:20135026-20135048 AAGAAAAAGACTGAAAACAGTGG + Intergenic
1037701510 8:21279225-21279247 CAGAAAAAGAGAAAAAAAATAGG + Intergenic
1038142777 8:24864729-24864751 GAGAAAAGGACAGAAGACATAGG - Intergenic
1038678440 8:29644630-29644652 CAGAAAAAGAAAGAAAATAAAGG + Intergenic
1038842076 8:31193934-31193956 CAGTAAAAGACACAAATCATAGG - Intergenic
1039017900 8:33173055-33173077 CAGAGAAAAACTGATAACCTGGG - Intergenic
1039232537 8:35464478-35464500 CAGAAAATTACAAATAACCTGGG - Intronic
1039717392 8:40124705-40124727 TAGAAAAAGAGAGAAAACCTTGG + Intergenic
1039732671 8:40296769-40296791 AAAAAAAAGACAGATAAAAATGG - Intergenic
1040397293 8:47011964-47011986 CAGAAGAAGACAGAAAACATGGG - Intergenic
1040501542 8:48009237-48009259 AAGAAAAAGGCAGATCACACGGG - Intronic
1040834362 8:51717172-51717194 AAGGAAGAGACAGATAAAATTGG - Intronic
1040954212 8:52963198-52963220 CAGACAAAGACAGGGAAGATTGG - Intergenic
1041300505 8:56406742-56406764 CAGAAAAAGAAAAATAATAATGG - Intergenic
1041780276 8:61570812-61570834 CAGAAAATGACACATCTCATAGG - Intronic
1041780768 8:61576275-61576297 TAGAAAAAGCCAGATAAGAAAGG + Intronic
1041899929 8:62970946-62970968 CAGAAAAAGAAAAATGACAATGG + Intronic
1041938037 8:63356509-63356531 AAGAAAAAGAGAGATAATACAGG - Intergenic
1042233641 8:66585742-66585764 CAAAAAAAGAAAGAAAACATAGG + Intronic
1042523290 8:69737103-69737125 CATATAAAGACATACAACATTGG - Intronic
1042761423 8:72275756-72275778 CAGAAGAAGACAGAAAATGTGGG + Intergenic
1043253299 8:78102751-78102773 TAGAAGAAAACAAATAACATTGG + Intergenic
1045043454 8:98250263-98250285 CAGAAAAAAAGTTATAACATAGG + Intronic
1045469846 8:102502447-102502469 CAGAATAAAACATATAACTTTGG - Intergenic
1045783140 8:105891472-105891494 CATAAAAAGATGGTTAACATTGG + Intergenic
1046105677 8:109663181-109663203 CATAAAGAGACATAAAACATAGG + Intronic
1046511482 8:115209980-115210002 CGGATATAGACAGATAAGATAGG + Intergenic
1046580444 8:116086178-116086200 CATAGAAAGACAAATAACATAGG + Intergenic
1046700064 8:117390507-117390529 CATGCAAAGACAGATAACAGTGG + Intergenic
1046875458 8:119249814-119249836 CAGATAAACTCAGAAAACATAGG + Intergenic
1047524521 8:125621217-125621239 CAGAAAAAGCCAAAGAACTTAGG - Intergenic
1047694568 8:127390708-127390730 CTGAAAAAGAGAGATAAAAATGG - Intergenic
1048065086 8:130959482-130959504 CAGCAATAGATAGAGAACATTGG + Intronic
1048066216 8:130971383-130971405 CAGTAATATACAAATAACATTGG - Intronic
1048139494 8:131779611-131779633 CACAAAAGAACAGATACCATAGG - Intergenic
1048514827 8:135096864-135096886 GAGAAAAGGACAGATAAGCTAGG + Intergenic
1049105482 8:140609838-140609860 CAGAAAAAGACAGACTACAATGG + Intronic
1049153581 8:141053136-141053158 CATAAAATGACAGTGAACATTGG + Intergenic
1049303899 8:141887508-141887530 AAAAAAAAAACAGATAAAATGGG + Intergenic
1050236749 9:3589611-3589633 ATGTAAAACACAGATAACATTGG + Intergenic
1050664253 9:7917379-7917401 CAGAAAAAGAAAAAGAACAGAGG + Intergenic
1050684843 9:8156689-8156711 CAGAAAGAGAAGGATACCATTGG + Intergenic
1050695661 9:8276574-8276596 CAGAAAAAGACAGAAAAACGTGG - Intergenic
1051317304 9:15854502-15854524 CTTAAAAAGACAAATAATATTGG - Intronic
1051480907 9:17559252-17559274 AAGAAAAAGAAAGAAAACATTGG + Intergenic
1052240134 9:26261772-26261794 CAGTAAAACACAGATAAGACAGG - Intergenic
1052727940 9:32252383-32252405 GAGAAAAAGGCAAATAAGATTGG + Intergenic
1052783365 9:32803772-32803794 CAGGAACAGACGGATAACATAGG + Intergenic
1054957655 9:70931636-70931658 CAGAGAAAGAAAGAAAAAATTGG + Intronic
1055259889 9:74421263-74421285 GAGAGAAAGAAAAATAACATAGG - Intergenic
1056189929 9:84175062-84175084 CAGAAAAGGAGAGAGAACAAAGG - Intergenic
1056334835 9:85557793-85557815 AAGGAAAATACAGATAACAGAGG + Intronic
1056861494 9:90188270-90188292 CACAAAGATACAGATAACAAAGG + Intergenic
1057419069 9:94894290-94894312 CAATAAAACAGAGATAACATTGG + Intronic
1057503721 9:95615980-95616002 CAGAAAAATCCAGATAAAATTGG - Intergenic
1058445248 9:105049471-105049493 CAGAAATACACAGAAAACAAAGG + Intergenic
1058628757 9:106963684-106963706 CAGTAAAAACCATATAACATGGG + Intronic
1058664878 9:107303625-107303647 CACAAAAAGACAAATACCATAGG - Intronic
1058857733 9:109081389-109081411 CTAAAAAATACAGATAAAATTGG + Intronic
1059282500 9:113147167-113147189 CGGCAAAATACACATAACATAGG - Intergenic
1059304581 9:113343925-113343947 CAGACAAATTCAGATCACATGGG - Intergenic
1059554781 9:115268805-115268827 CAGAAAAAAAATGAGAACATAGG - Intronic
1062632363 9:137469904-137469926 TAGAAAAATTCAGATAAAATGGG + Intronic
1062674007 9:137729262-137729284 CAGAAAAAGACAGACACCTGTGG - Intronic
1185595915 X:1306879-1306901 CAGAAAGAGACAGAGAGCAAGGG + Intronic
1185617339 X:1430374-1430396 CAGAAGAAGACACATACCACAGG - Intronic
1185827440 X:3265540-3265562 CTGAAAAACAGAGATAACAATGG + Intergenic
1186265989 X:7834294-7834316 CAGGAAGGGACAGATAACACTGG + Intergenic
1187172364 X:16864546-16864568 AAGAAAAAGAAAGAAAACATGGG + Intronic
1187245926 X:17552922-17552944 CAGAAATTGACTGATAACACAGG + Intronic
1188720867 X:33521511-33521533 AACAAAAATACAGAAAACATGGG + Intergenic
1189125595 X:38442725-38442747 CAGACAAAGACAAAAAGCATGGG + Intronic
1189481006 X:41392184-41392206 CAGAAATTGACAGAAAACACGGG - Intergenic
1189818973 X:44851616-44851638 CTGAAAAAGAAACATAACAGTGG - Intergenic
1189898632 X:45682671-45682693 CAGAAGAAGTCAGATCACACAGG - Intergenic
1190229681 X:48572602-48572624 CAGAAAAAAGCACAGAACATAGG + Intergenic
1194096752 X:89649807-89649829 GACAAAAAGACAGATAAAGTGGG - Intergenic
1194330074 X:92571811-92571833 CAGAGAAAGGCTGAGAACATAGG - Intronic
1195274143 X:103263507-103263529 CAGAAAAAGAAGGACAAAATTGG - Intergenic
1195307949 X:103604099-103604121 GAGAAAATGGGAGATAACATAGG + Intergenic
1195525613 X:105886017-105886039 CAGAAAAAAACACCTACCATAGG - Intronic
1195757885 X:108217374-108217396 CAGAAAAACACAGACACCATAGG - Intronic
1195883015 X:109612285-109612307 CAGAGAAGGACAGATAAGAAAGG - Intergenic
1196595871 X:117544893-117544915 TAGAAAAAGAGGGAAAACATAGG + Intergenic
1197382923 X:125767289-125767311 CAGAAAAAAAAAGATGAAATTGG - Intergenic
1197565754 X:128083742-128083764 CAAAAAGAGAGAGATATCATGGG + Intergenic
1198049411 X:132934888-132934910 TAGAAAAAGATAGAAATCATTGG + Intronic
1198387227 X:136140992-136141014 CAGAAAAAGAGAGAGAAGAGAGG + Intergenic
1198505710 X:137299346-137299368 AAGAAAAAAACAGATAAGTTGGG + Intergenic
1199045985 X:143173745-143173767 TAGAAAATTACAAATAACATGGG + Intergenic
1199101586 X:143807591-143807613 AAGAAAAAGGCAGAAAGCATTGG - Intergenic
1199155131 X:144537611-144537633 CAGAAAAAGACAGAAAAATGTGG - Intergenic
1199165336 X:144666723-144666745 GAGAAGAAGACACATAAAATGGG + Intergenic
1199181569 X:144861531-144861553 CAGAAAAACACAAATAAAAAAGG - Intergenic
1199237667 X:145509745-145509767 CAGAAGAAGACAGAAAACTGAGG + Intergenic
1199319496 X:146421745-146421767 AACAAAAAGACATATAACTTGGG - Intergenic
1199646219 X:149915416-149915438 TAGTAAAAGAAAAATAACATAGG - Intergenic
1199774281 X:150997190-150997212 AAGAAAAAGAAAGAAAGCATGGG - Intergenic
1200375218 X:155773246-155773268 CAGAAATAAACAGATAAGAAAGG - Intronic
1200405044 Y:2801444-2801466 CAGAATACGACTGAAAACATGGG - Intergenic
1200449769 Y:3311181-3311203 GACAAAAAGACAGATAAAGTGGG - Intergenic
1200638781 Y:5690993-5691015 CAGAGAAAGGCTGAGAACATAGG - Intronic
1200765585 Y:7078183-7078205 AAAAAAAAGACACATAAGATGGG + Intronic
1200823015 Y:7607193-7607215 CAGAAAAAGAGAGAAAATTTGGG - Intergenic
1200855822 Y:7937146-7937168 CAGAAAAAGTCATATTACTTAGG + Intergenic
1201250899 Y:12056710-12056732 CTGAAAAACACAGATAACAATGG - Intergenic
1201348545 Y:13012536-13012558 CAGAAAAAAACAGACCACATGGG - Intergenic
1201509639 Y:14744795-14744817 CAGAAACAGACAGATGAGTTAGG - Intronic
1201977441 Y:19868090-19868112 CAGAAAATAAGAAATAACATTGG + Intergenic
1202237040 Y:22723902-22723924 CAGAAAAAGAGAGAAAATGTGGG + Intergenic