ID: 1170275925

View in Genome Browser
Species Human (GRCh38)
Location 20:14588019-14588041
Sequence CTTTTTCTGGATCTGGTATC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2577
Summary {0: 1, 1: 0, 2: 75, 3: 633, 4: 1868}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170275922_1170275925 -9 Left 1170275922 20:14588005-14588027 CCAATGTTATCTGTCTTTTTCTG 0: 1
1: 0
2: 3
3: 58
4: 608
Right 1170275925 20:14588019-14588041 CTTTTTCTGGATCTGGTATCAGG 0: 1
1: 0
2: 75
3: 633
4: 1868
1170275921_1170275925 8 Left 1170275921 20:14587988-14588010 CCATACTTTTCTATTTTCCAATG 0: 1
1: 0
2: 5
3: 48
4: 568
Right 1170275925 20:14588019-14588041 CTTTTTCTGGATCTGGTATCAGG 0: 1
1: 0
2: 75
3: 633
4: 1868

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170275925 Original CRISPR CTTTTTCTGGATCTGGTATC AGG Intronic
Too many off-targets to display for this crispr