ID: 1170278858

View in Genome Browser
Species Human (GRCh38)
Location 20:14623685-14623707
Sequence CATCATCCCTGAAAAGCCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 305
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 280}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170278855_1170278858 20 Left 1170278855 20:14623642-14623664 CCTGGAGCCAAACAGATAATAAA 0: 1
1: 0
2: 2
3: 28
4: 317
Right 1170278858 20:14623685-14623707 CATCATCCCTGAAAAGCCAGTGG 0: 1
1: 0
2: 2
3: 22
4: 280
1170278856_1170278858 13 Left 1170278856 20:14623649-14623671 CCAAACAGATAATAAAAATATTA 0: 1
1: 0
2: 11
3: 125
4: 1246
Right 1170278858 20:14623685-14623707 CATCATCCCTGAAAAGCCAGTGG 0: 1
1: 0
2: 2
3: 22
4: 280

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170278858 Original CRISPR CATCATCCCTGAAAAGCCAG TGG Intronic
900858965 1:5211085-5211107 CAACAGGCTTGAAAAGCCAGGGG + Intergenic
901118876 1:6874100-6874122 CAACAACCCTAAAAAGCAAGTGG - Intronic
901207477 1:7505302-7505324 CAGCAGCCCTCAGAAGCCAGAGG - Intronic
903371344 1:22838016-22838038 CATCTTTCCTGAAAAAGCAGAGG + Intronic
904544195 1:31255672-31255694 GACCATCCCTGAACAACCAGGGG + Intergenic
905292203 1:36929689-36929711 CACCATCCCTGAAATTCCAAAGG - Intronic
905985771 1:42280308-42280330 CAACATACCTGAAAATCAAGAGG - Intronic
907309982 1:53533698-53533720 CAGCATCCCAGACACGCCAGGGG + Intronic
908259378 1:62327666-62327688 CATCATCCCTGCAGACTCAGGGG - Intergenic
908392203 1:63693675-63693697 CATCCTCACTGGGAAGCCAGTGG + Intergenic
911764093 1:101653650-101653672 CAGCCTTCCCGAAAAGCCAGGGG - Intergenic
913408762 1:118526846-118526868 CCTCATTCCTGAAAAGGAAGTGG - Intergenic
914680420 1:149934978-149935000 CCTCTTACCTGAAAAGCCTGAGG + Exonic
914885825 1:151583600-151583622 CATCCTCCCTGAAAAGTGAAAGG - Intergenic
915033930 1:152906778-152906800 GATCATGCCTAAAAAGACAGAGG - Intergenic
917924923 1:179781597-179781619 CCTCATCCCTGCAATCCCAGCGG - Intronic
919125592 1:193388941-193388963 CATAAGCAATGAAAAGCCAGTGG - Intergenic
919836642 1:201579228-201579250 CATCAACCCAGAAATGCCAATGG - Intergenic
920496127 1:206456050-206456072 TTTCATTCCTCAAAAGCCAGAGG - Intronic
922002196 1:221490865-221490887 CATCAGCCTAGAAAAGCAAGAGG - Intergenic
922873537 1:228921838-228921860 CTTCATCCCTGACAACTCAGCGG + Intergenic
922979134 1:229810400-229810422 CAGCCTCCCTGAAAATTCAGAGG + Intergenic
924858566 1:247898283-247898305 CAGCATCCTTGAATAGTCAGAGG - Intergenic
1063091853 10:2872649-2872671 CATCACCACGGAACAGCCAGGGG + Intergenic
1065799938 10:29342829-29342851 CAGCCTCCCTGAAAATCCAGAGG - Intergenic
1066249176 10:33616247-33616269 CAGCCTCCCTGAAAATTCAGAGG - Intergenic
1066457402 10:35584402-35584424 CTTCCTCCAAGAAAAGCCAGAGG - Intergenic
1066749790 10:38642392-38642414 CATCATCTCTTAAAAGTCAGTGG - Intergenic
1066966858 10:42275384-42275406 CATCATCTCTTAAAAGTCAGTGG + Intergenic
1069662841 10:70135087-70135109 CATCATCCCTAAGGAGCCAGAGG + Intergenic
1070899599 10:80016500-80016522 CAACCTCCCTGAAAATTCAGAGG - Intergenic
1072702832 10:97656428-97656450 CATGACCCTTGATAAGCCAGAGG - Intronic
1073021597 10:100449342-100449364 TGGCATCCTTGAAAAGCCAGTGG + Intergenic
1074533185 10:114310838-114310860 CATGACCTCTGAAAAGCCAGAGG - Intronic
1075642692 10:124076055-124076077 CATCAGGGATGAAAAGCCAGGGG + Intronic
1077049988 11:562284-562306 CAGCCTCCCTGTAAAGCCACGGG + Exonic
1078756675 11:14217470-14217492 AATTATCCCTCAAGAGCCAGTGG - Intronic
1079484213 11:20917225-20917247 CATCATCCTTGAAGAGGAAGAGG + Intronic
1082096885 11:48138188-48138210 ACTCACCACTGAAAAGCCAGAGG - Intronic
1085190006 11:74611826-74611848 CATCAACTGTGAAAAGACAGTGG + Intronic
1087955880 11:104287594-104287616 AATCATCTCTGCAAAGCCAATGG + Intergenic
1088054338 11:105557038-105557060 CACCCTCCCTGAAAATTCAGAGG + Intergenic
1088412018 11:109544630-109544652 CATCTTCCCTGAAAGTTCAGAGG - Intergenic
1089200907 11:116724196-116724218 CAGCATCCCTGAAGTGCCTGCGG - Intergenic
1089868225 11:121650450-121650472 CATCATCCCTGAACTCCCTGTGG - Intergenic
1092003023 12:5046579-5046601 CCACATCCCAGAAAAGACAGAGG - Exonic
1092350094 12:7749223-7749245 CATCCTCCCTCAAGAGCCAAGGG - Exonic
1093604792 12:21076892-21076914 CATCTTCCTGGAGAAGCCAGAGG - Intronic
1094322831 12:29204299-29204321 TATCATCCCTGTGAAGACAGGGG - Intronic
1097837137 12:64284365-64284387 CATCATACATTAAAAGCCGGGGG - Intronic
1097907938 12:64939755-64939777 CATTATCACTGAAATGCAAGGGG + Intergenic
1098532235 12:71554157-71554179 CAGCCTCCCTGAAAATTCAGAGG + Intronic
1102192348 12:110998208-110998230 CATCCTCCCAGAAAATTCAGAGG - Intergenic
1103421020 12:120782652-120782674 CACCATCCATGAGAAGCCAATGG + Exonic
1108253345 13:48588430-48588452 CAGCCTCCCTGAAAATCCAGAGG - Intergenic
1108641389 13:52385612-52385634 TATCAACCCAGAAAAGCCAGGGG - Intronic
1109791216 13:67250328-67250350 CATCATCCCAGAAAAAACTGCGG + Intergenic
1111587251 13:90297973-90297995 CATCAGCACTAAAAGGCCAGTGG - Intergenic
1111922551 13:94427482-94427504 CAGCACCCCTGAGAAGGCAGCGG + Intergenic
1112778840 13:102875542-102875564 CATCAAGCCTGAAAAGAAAGAGG + Exonic
1113891786 13:113739804-113739826 GCTCAGCCCTGAAGAGCCAGAGG - Intergenic
1115658429 14:35466433-35466455 CAGCCTCCCTGAAAATTCAGAGG + Intergenic
1116859104 14:49979388-49979410 CATCAGCTCTGAAAGGCCTGGGG - Intergenic
1117024685 14:51607592-51607614 CATCATCCCTGAGGAGCGAGTGG - Intronic
1118528259 14:66670381-66670403 CATCCTCTCTGGAAAGCCATAGG + Intronic
1118603326 14:67485721-67485743 CATCATCAAGGAAAAGCCAGGGG + Intronic
1118874649 14:69773422-69773444 CCAAATCCCTGAAAAGCTAGGGG - Intergenic
1119038273 14:71248954-71248976 CATCACACCTGAAAAGGCACAGG + Intergenic
1119167115 14:72503767-72503789 CATCAGCCCAGGAAAGCCATGGG - Intronic
1121144808 14:91574363-91574385 CAGCATCCCAGAAACGCCTGGGG - Intergenic
1121225732 14:92320578-92320600 CATCAGCCCTGGATAGGCAGCGG - Intergenic
1122081068 14:99268365-99268387 CATCATCCCTGAAGGACCTGAGG + Intronic
1122101283 14:99412319-99412341 CATCATACCTGGGAAGCCTGGGG - Intronic
1122367055 14:101200561-101200583 AAACATCCCTGAGAAGCAAGGGG + Intergenic
1122633952 14:103121750-103121772 CCTCAGCCCTGCAAAGCCCGTGG + Intergenic
1123058507 14:105583846-105583868 CTTCCTCCCTGCAAAGACAGAGG + Intergenic
1123082840 14:105704079-105704101 CTTCCTCCCTGCAAAGACAGAGG + Intergenic
1124953313 15:34343071-34343093 CATGATCGCTTATAAGCCAGCGG + Exonic
1126962719 15:54015762-54015784 AAACATTCCTGAACAGCCAGTGG + Exonic
1127561022 15:60136100-60136122 CATCATCACTGAGAAACCACTGG + Intergenic
1131355232 15:91739694-91739716 AATTATCCCAGAAAAGTCAGAGG + Intergenic
1131654328 15:94439931-94439953 CTTCATACCTGAAAAGCCCATGG - Intronic
1131717622 15:95130518-95130540 CATCAGCCCTGCAGAGACAGTGG + Intergenic
1132019744 15:98350291-98350313 CAAATTCCCTGAAAAGCCAAAGG + Intergenic
1132059893 15:98683513-98683535 CCTCATCCCTTAAAAACCAACGG - Intronic
1134464144 16:14458369-14458391 CATCATCCCTGCAAACCAAAAGG + Intronic
1136604731 16:31325601-31325623 CATCTTCCCGGAAAACTCAGAGG + Exonic
1136732926 16:32434754-32434776 CATCATCTCTTAAAAGTCAATGG + Intergenic
1137358616 16:47791838-47791860 CATCTTCCTGGAAAAGCCACAGG - Intergenic
1138029218 16:53546569-53546591 CTGCATCCCTGAGAAGCAAGTGG + Intergenic
1139081265 16:63524596-63524618 CACCATCCCAGAAATGCCAACGG + Intergenic
1139945313 16:70637205-70637227 GATCATCCATGCAAAGCTAGAGG - Intronic
1140713903 16:77704613-77704635 CAACCTCCCTGAAAATTCAGAGG - Intergenic
1140926157 16:79586098-79586120 CCTCAACCCTGTCAAGCCAGAGG + Intronic
1203020155 16_KI270728v1_random:394849-394871 CATCATCTCTTAAAAGTCAATGG - Intergenic
1203038490 16_KI270728v1_random:668007-668029 CATCATCTCTTAAAAGTCAATGG - Intergenic
1144117949 17:12118855-12118877 CATCATCACTGAATAGTCACAGG - Intronic
1145232382 17:21183235-21183257 CATCATTTCTGTAAAGTCAGTGG + Intronic
1146133772 17:30300385-30300407 CAGCCTCCCTGAAAACACAGAGG + Intergenic
1146663412 17:34680561-34680583 CAGCATCCCTGAAAATTCAGAGG - Intergenic
1147371592 17:39996534-39996556 CATCATCCCTTAAACGCAATAGG - Intronic
1152943504 17:83185452-83185474 CATCATCTCTGCAAAGCCAAGGG - Intergenic
1153695402 18:7635734-7635756 AATAATCCCAGAAAAGCCACTGG + Intronic
1154161876 18:11986513-11986535 CTTCTGCCCTGAAGAGCCAGAGG - Intronic
1154431231 18:14310085-14310107 CATAAACCCTGCAAAGCCACAGG + Intergenic
1154433907 18:14329391-14329413 CATAAACCCTGCAAAGCCACAGG + Intergenic
1155608506 18:27635713-27635735 GATCATGTCTGAAAAGACAGAGG - Intergenic
1156347919 18:36274637-36274659 CATTATCCCTGAAACTCCTGGGG + Intergenic
1157370272 18:47104473-47104495 CATCTTCCTAGAAAACCCAGTGG + Intergenic
1157984497 18:52421538-52421560 CACCATCCCTCAAGAGCCTGAGG - Intronic
1160117771 18:76098037-76098059 CTTCATTCCTGAAGAGCCCGTGG - Intergenic
1160472961 18:79155480-79155502 CATCATCTCTGAAACGAGAGAGG + Intronic
1161107496 19:2451900-2451922 CAGCAGCCCTGAGCAGCCAGGGG + Intronic
1162760117 19:12883998-12884020 CAGCCTCCCTGAAAATTCAGAGG - Intergenic
1163085515 19:14976845-14976867 GAAGATCCCAGAAAAGCCAGTGG - Intronic
1163115162 19:15184838-15184860 CATCATCCCTGATAGGGTAGGGG + Intronic
1165241097 19:34468049-34468071 CACCAGCACTGAAAATCCAGGGG - Intronic
1165956253 19:39503695-39503717 CATCTTCCCTGAAAGGCCAGGGG + Intronic
1166848125 19:45742924-45742946 CCTGTTCCCTGAAAACCCAGAGG + Intronic
1166978991 19:46621742-46621764 CCTCATCCCTGGTAAGCAAGTGG - Intronic
925939342 2:8800990-8801012 CAGCATCCATGAAAACCTAGTGG + Intronic
926116705 2:10218033-10218055 CTTCAGACCTGGAAAGCCAGTGG - Intergenic
927277598 2:21274813-21274835 CATCATCCAGCAATAGCCAGAGG - Intergenic
927739112 2:25551388-25551410 CAACAACCATGAAAATCCAGGGG - Intronic
928296590 2:30089204-30089226 CAGCCTCCCTGAAAATTCAGAGG - Intergenic
930237699 2:48903596-48903618 CCTTATCCCTGAAAAGAGAGTGG + Intergenic
932466178 2:71925780-71925802 CATCCACCCTGAAGAGCCACTGG - Intergenic
933134199 2:78711203-78711225 CATCATCTCTGGGAAGCCAGTGG - Intergenic
933738774 2:85516652-85516674 CACCATCTCTGAAATACCAGTGG - Intergenic
934492201 2:94769109-94769131 CATAAACCCTGCAAAGCCATAGG - Intergenic
935132806 2:100274062-100274084 AATGATCCCTGAAAAGCAAAAGG + Exonic
935939890 2:108227264-108227286 CATTGTCCCTGGAAAACCAGTGG - Intergenic
937288715 2:120769023-120769045 CTTCATCACTGAGAAGCCACAGG - Intronic
937876243 2:126827583-126827605 AATCATCCCCCAAAAGCCTGTGG + Intergenic
938279751 2:130055572-130055594 CATAAACCCTGCAAAGCCACAGG - Intergenic
938435644 2:131281866-131281888 CATAAACCCTGCAAAGCCACAGG + Intronic
939821696 2:146965199-146965221 CCTCATCCTTGAAAAGTCAGAGG + Intergenic
944513479 2:200487496-200487518 CAGCATCACTGAAAAGCTAGAGG - Intergenic
945897841 2:215504614-215504636 AAACATCCCAGAATAGCCAGTGG + Intergenic
947226298 2:227843573-227843595 CAGCCTCCCTGAAAATTCAGAGG - Intergenic
947386177 2:229592816-229592838 AGTCAGCCCTGAGAAGCCAGGGG - Intronic
947696558 2:232195397-232195419 CAGCCTCCCTGAAAATTCAGAGG + Intronic
948648568 2:239424678-239424700 CATCTTCCCTGAACCTCCAGGGG + Intergenic
1170278858 20:14623685-14623707 CATCATCCCTGAAAAGCCAGTGG + Intronic
1171132200 20:22664002-22664024 CAACCTCCCTGAAAAGTCAGTGG - Intergenic
1171252599 20:23660704-23660726 CATCACCCCTGACAAGCCAAAGG + Intergenic
1171462997 20:25309345-25309367 CACCATCCCTGCAAACCCTGTGG - Intronic
1173332150 20:42084546-42084568 CAACATCCCTCAAAGGCTAGTGG - Intronic
1173831007 20:46088718-46088740 CATTATCCCTGAAGAGCCCAGGG + Intronic
1174662276 20:52224021-52224043 CATAATCCCAGGTAAGCCAGTGG + Intergenic
1174788451 20:53455177-53455199 CATCGTTACTGAAAGGCCAGGGG - Intronic
1175300038 20:57936223-57936245 CAACCTCCCTGAAAATTCAGAGG - Intergenic
1176843127 21:13856332-13856354 CATAAACCCTGCAAAGCCACAGG - Intergenic
1176845815 21:13875680-13875702 CATAAACCCTGCAAAGCCACAGG - Intergenic
1176848550 21:13895234-13895256 CATAAACCCTGCAAAGCCACAGG - Intergenic
1179421006 21:41236792-41236814 CAGCAGCCCTGCAAAGCCGGAGG + Intronic
1181095045 22:20499057-20499079 CCTGATCTCTGAATAGCCAGTGG + Intronic
1181372808 22:22431688-22431710 GATCATTCCTGAGAAGACAGGGG + Intergenic
1182155407 22:28067133-28067155 CATAATACCTGAAAAGCAGGAGG - Intronic
1182699735 22:32226838-32226860 GTTCATCCATGAGAAGCCAGTGG - Intronic
1183033945 22:35126640-35126662 CAGCATCTCTGAGAAGCCTGGGG + Intergenic
1183199008 22:36373150-36373172 CACCATCCTGGAAAAGGCAGGGG + Intronic
1183861542 22:40673819-40673841 CATCATTCCTGCCAAGCCTGTGG - Intergenic
1185178841 22:49347807-49347829 CATCATACCAGGAAAACCAGGGG - Intergenic
1185221864 22:49633128-49633150 CCCCATCCCTGCAAAGCCACTGG + Intronic
949230993 3:1750394-1750416 CTTCATCCATGACAAGCCATTGG + Intergenic
949786503 3:7747327-7747349 CTTCATCCCTGAAGACACAGCGG + Intergenic
950461057 3:13122448-13122470 CTCCCTCCCTGAACAGCCAGAGG - Intergenic
953572752 3:44084559-44084581 CATCATAGCAGAAAGGCCAGGGG + Intergenic
953745610 3:45571613-45571635 CAGCCTCCCTGAAAATTCAGAGG - Intronic
953839591 3:46378729-46378751 CATCATTTCTGAAAACCGAGAGG + Intergenic
954749988 3:52808031-52808053 CATCAACCCTGAAAGGCCAGTGG + Intronic
956325486 3:68047941-68047963 CATCATCCCTTACAAGCATGTGG - Intronic
959023458 3:101214372-101214394 CATCTTCCTGGAAAAGCCACAGG + Intergenic
960310688 3:116112877-116112899 CATAATCCCTGAAAATTCTGTGG + Intronic
960914498 3:122681897-122681919 CATCATCCATAAGATGCCAGTGG - Intronic
961795120 3:129403610-129403632 CAGCATCCCTGCAGAGGCAGGGG - Intronic
962389298 3:134958132-134958154 CTTCATGCCTGGAAACCCAGGGG + Intronic
963416577 3:145002580-145002602 CATGATTCCTGTAAAGCCTGTGG - Intergenic
965119876 3:164540690-164540712 CATCATCACTAAAACGTCAGTGG + Intergenic
965431429 3:168593765-168593787 CAAAATACATGAAAAGCCAGGGG - Intergenic
966899841 3:184473295-184473317 CATCAGCCATGAAAAGCAGGCGG - Intronic
967796392 3:193603032-193603054 CATAATCCCAGAAAAACTAGAGG - Intronic
968069885 3:195778260-195778282 CATCACCCCTCAAAAGGCACAGG + Intronic
970745807 4:19293945-19293967 CAGCATCTCTGAAAAGGAAGAGG - Intergenic
971916629 4:32878395-32878417 CAACATCACTCAAAGGCCAGTGG + Intergenic
972911455 4:43822314-43822336 GGTGAACCCTGAAAAGCCAGAGG - Intergenic
975862630 4:78693721-78693743 CAACCTCCCTGAAAATTCAGAGG + Intergenic
976107251 4:81632297-81632319 CATCAGTCCTGGAAAGCCATAGG + Intronic
977314764 4:95431837-95431859 CATTATCACTGAAAAGCTATAGG - Intronic
978620536 4:110631830-110631852 CAACATCCCTGAAGAGCTGGAGG - Intronic
979867054 4:125769728-125769750 AATCATCCATGAAAAGGGAGAGG + Intergenic
980957180 4:139441156-139441178 CAGGATCCCAGAAAAGCAAGTGG + Intergenic
981335403 4:143563302-143563324 CTTCAGCCTTGAAAAGCCACAGG + Intergenic
982506078 4:156219196-156219218 GATGAACCCTGAAAAGCCACAGG + Intergenic
983050941 4:163047342-163047364 AGTCATCCCTGAGAAGCCTGAGG - Intergenic
984782890 4:183541885-183541907 CACCCTCCCTGAGGAGCCAGTGG - Intergenic
985427031 4:189841065-189841087 CAACTTCCCTGAAAATTCAGAGG - Intergenic
987268423 5:16279880-16279902 CATGATCCCTGGAGACCCAGAGG + Intergenic
988879580 5:35486407-35486429 CAGCTTCCCTGAAAATTCAGAGG - Intergenic
988893142 5:35641521-35641543 CATCATCACAGAAAAGCCTGGGG + Exonic
990343492 5:54848728-54848750 CATTATCTCTGAAAGGCCTGTGG + Intergenic
990758733 5:59104796-59104818 CATCATCCTTCAAATGCCATAGG - Intronic
991409439 5:66331830-66331852 CATGTACCCTGCAAAGCCAGGGG + Intergenic
992391842 5:76336836-76336858 CATCATCCCTGATACACTAGGGG - Intronic
993806784 5:92420370-92420392 CATCATTACTGAAACACCAGGGG + Intergenic
994987533 5:106956405-106956427 CATCTTCCCTACAAAGCCAAAGG - Intergenic
995353404 5:111209369-111209391 CATACTCTCTGATAAGCCAGAGG + Intergenic
995620184 5:114017377-114017399 CAGCCTCCCTGAAAATTCAGAGG - Intergenic
996252832 5:121358445-121358467 CATCTTTCCTGATAAGCCATAGG - Intergenic
996754833 5:126924526-126924548 TAACATGCCTGAAAAGCCAGAGG - Intronic
998401803 5:141852322-141852344 CCCCACCCCGGAAAAGCCAGGGG - Intergenic
998460169 5:142304169-142304191 CATCATCCCAGAAAGGACTGAGG - Intergenic
1000064232 5:157681318-157681340 CACCATTCCTGAAGAGCAAGTGG - Intergenic
1000622649 5:163503391-163503413 AGTCATGCCTGAAATGCCAGAGG + Intronic
1000765263 5:165281611-165281633 CCACATCTCAGAAAAGCCAGTGG + Intergenic
1001813699 5:174650038-174650060 CACCAGCCCTGACAAGCCGGTGG - Intergenic
1002345796 5:178546856-178546878 CACCATCTCTGCAAGGCCAGGGG + Intronic
1004001721 6:11602472-11602494 CATCATTCCTGAAAAGTTAAAGG - Intergenic
1004179792 6:13371347-13371369 CAACTTCCCTGAAAAGACAAGGG + Intronic
1004293498 6:14389502-14389524 CAACCTCCCTGAAAATTCAGAGG + Intergenic
1005077874 6:21926377-21926399 CATCAGTCCTGACACGCCAGTGG + Intergenic
1007269554 6:40625942-40625964 CACCATCCCTGACCAACCAGAGG - Intergenic
1011262072 6:85480285-85480307 GGTCATCACTGAAAGGCCAGAGG + Intronic
1014279956 6:119431167-119431189 CATGATCCTTGAAATGCCACTGG + Intergenic
1015694955 6:135969845-135969867 CTTCATCTCTGAATAGCCATGGG - Intronic
1018506767 6:164479498-164479520 AATCATCCCTGGAAAGTCAATGG - Intergenic
1019423747 7:963535-963557 CATCCACTCTGAAGAGCCAGGGG - Intronic
1022490858 7:30816560-30816582 CATCCTCCTGGAAAAGCCATCGG - Intronic
1023523381 7:41071749-41071771 CAGCCTCCCTGAAAATTCAGAGG - Intergenic
1024093557 7:45967198-45967220 GATCATCCCTGAGAAAACAGAGG - Intergenic
1025983531 7:66427738-66427760 CATAATCCCTGAAAATAAAGGGG + Intergenic
1026031666 7:66799597-66799619 CATAATCCCTGAAAATAAAGGGG - Intronic
1028084274 7:86617197-86617219 GGCCATCCCTGAAAAGCCACAGG + Intergenic
1028496768 7:91470054-91470076 CAAAATCCCTGTAAAGCCAATGG - Intergenic
1028903921 7:96132201-96132223 GATCTTCCTTGAAATGCCAGTGG - Intronic
1029930183 7:104362728-104362750 CAGCCTCCCTGAAAATTCAGAGG + Intronic
1030324198 7:108202824-108202846 CCTCATCCCTGAGAGGACAGGGG + Intronic
1031170948 7:118291232-118291254 CCTCTTCCCTGAAAATCCACAGG + Intergenic
1035667449 8:1389351-1389373 CAGCATCCCGGGGAAGCCAGAGG + Intergenic
1035775247 8:2182635-2182657 CCTCATCCATGCAAAGCCATGGG + Intergenic
1038554817 8:28501776-28501798 AATCATCCCTAAAAAGTCACAGG - Intronic
1039269215 8:35862518-35862540 CATCATCCCAGAGAAGAGAGAGG + Intergenic
1039474748 8:37833752-37833774 CATCATGTCTGAAAAGCTAGCGG - Exonic
1040683518 8:49842508-49842530 CATGATCCCTGAAGTGCCATAGG - Intergenic
1042878922 8:73466404-73466426 CATCCTCTCTAATAAGCCAGAGG - Intronic
1043139173 8:76566325-76566347 CACCATCCCTCAAATGGCAGTGG - Intergenic
1043357993 8:79436256-79436278 GAGGATCCCTGAAAGGCCAGAGG - Intergenic
1044087622 8:87959755-87959777 CCTCATCCCTGAAGGGGCAGTGG - Intergenic
1045344417 8:101281648-101281670 CATCATTCCTGGAAAGCCGCAGG - Intergenic
1046433643 8:114160152-114160174 CAGCCTCCCTGAAAACTCAGAGG - Intergenic
1047053989 8:121144073-121144095 CAGCCTCCCTGAAAATTCAGAGG - Intergenic
1047622431 8:126621440-126621462 CATCCTCCCTGAGAACTCAGAGG - Intergenic
1049015308 8:139915702-139915724 CATCTTCCCTGAATGGGCAGAGG + Intronic
1049611062 8:143555536-143555558 CAGCATCCCTGCAAGGCCACAGG - Intronic
1050944414 9:11499542-11499564 CATGATCCCTGAAGCCCCAGAGG - Intergenic
1052350183 9:27450476-27450498 AATCATCTCTGAAATGCCTGAGG - Intronic
1052880018 9:33596054-33596076 CATAAACCCTGCAAAGCCACAGG + Intergenic
1053011142 9:34634312-34634334 CACCATGCCTGACAAGACAGTGG - Intergenic
1053495955 9:38548166-38548188 CATAAACCCTGCAAAGCCACAGG - Intronic
1056065995 9:82935438-82935460 GAACTTCCCTGAAAAGCCACAGG + Intergenic
1056190783 9:84181980-84182002 CACCAGCCTTGAAATGCCAGAGG - Intergenic
1056236317 9:84598262-84598284 AGCCATCCATGAAAAGCCAGGGG - Intergenic
1057210877 9:93200403-93200425 CATGTTCCCTCAAGAGCCAGCGG + Intronic
1057237897 9:93380283-93380305 CATAATCCCTGAAAAACAAGAGG + Intergenic
1057675885 9:97135684-97135706 CATAAACCCTGCAAAGCCACAGG - Intergenic
1058324496 9:103678741-103678763 CATCATTGGTGAAAAGGCAGGGG - Intergenic
1062212133 9:135370898-135370920 CCTCATCCCTGAGACACCAGTGG + Intergenic
1062471375 9:136706969-136706991 CAACATCCCTGAGTGGCCAGTGG + Intergenic
1203760741 EBV:12230-12252 CCCCATCCCTGAAGACCCAGCGG + Intergenic
1203761670 EBV:15302-15324 CCCCATCCCTGAAGACCCAGCGG + Intergenic
1203762599 EBV:18374-18396 CCCCATCCCTGAAGACCCAGCGG + Intergenic
1203763528 EBV:21446-21468 CCCCATCCCTGAAGACCCAGCGG + Intergenic
1203764457 EBV:24518-24540 CCCCATCCCTGAAGACCCAGCGG + Intergenic
1203765386 EBV:27590-27612 CCCCATCCCTGAAGACCCAGCGG + Intergenic
1203766315 EBV:30662-30684 CCCCATCCCTGAAGACCCAGCGG + Intergenic
1203767244 EBV:33734-33756 CCCCATCCCTGAAGACCCAGCGG + Intergenic
1187133768 X:16527244-16527266 CAACCTCCCTGAAAATTCAGAGG - Intergenic
1187670920 X:21665152-21665174 CATCAGTCCTGAAAGACCAGAGG - Intergenic
1187864056 X:23707904-23707926 ACTCATCCCTGAAAGCCCAGAGG - Exonic
1189431627 X:40952234-40952256 CACCATCCCAGAACAGCAAGTGG + Intergenic
1189493830 X:41491868-41491890 CATAAACCCTGAAATACCAGTGG + Intergenic
1190430938 X:50377223-50377245 CATCATGACTGACAAGACAGTGG + Intronic
1192743155 X:73912925-73912947 CCTCATCCATGGAAAGCCAGAGG + Intergenic
1192849236 X:74936543-74936565 CAGCATCTCTGGAAAACCAGAGG + Intergenic
1194955168 X:100170458-100170480 CATCATCCCTGAATATTTAGAGG + Intergenic
1195664513 X:107416674-107416696 CATCCTCCCAGAGAAACCAGGGG - Intergenic
1195709220 X:107760621-107760643 CACCAACCCTGAAAAGGGAGGGG + Intronic
1195858613 X:109357282-109357304 CTTGATCTCTGAAAAGCCAGTGG + Intergenic
1195858800 X:109358702-109358724 CGTGATCCCTGAAGACCCAGAGG - Intergenic
1196025749 X:111039902-111039924 TGCCAACCCTGAAAAGCCAGGGG + Intronic
1196970169 X:121099742-121099764 CCTCAACCCTGAAATGCCACAGG - Intergenic
1196970179 X:121099799-121099821 CCTCAGCCCAGAAAAGCCACAGG - Intergenic
1197439359 X:126471250-126471272 CAACCTCACTGAAAAGCCCGTGG + Intergenic
1198224986 X:134636859-134636881 CACCATCCATCAAAATCCAGGGG + Intronic
1200913450 Y:8550976-8550998 AATCAAACCTGAAAACCCAGAGG - Intergenic
1200920945 Y:8612388-8612410 AATAATACCTGAAAACCCAGAGG - Intergenic
1200937582 Y:8751804-8751826 AATCATACCTGAAACCCCAGGGG + Intergenic
1200962206 Y:9006004-9006026 CATCATACCTGAGACCCCAGAGG - Intergenic
1200981698 Y:9268498-9268520 CATCATACCTGAGACTCCAGAGG + Intergenic
1200984391 Y:9290459-9290481 AATCATACCTGAAACCCCAGAGG + Intergenic
1201180732 Y:11342009-11342031 CATCATCTCTTAAAAGTCAATGG - Intergenic
1201336424 Y:12885784-12885806 CTTCATCCCTGAGAAGTCTGAGG - Intergenic
1202126050 Y:21569785-21569807 AATCATACCTGAAACCCCAGAGG - Intergenic
1202128720 Y:21591226-21591248 CATCATACCTGAGACCCCAGAGG - Intergenic