ID: 1170282590

View in Genome Browser
Species Human (GRCh38)
Location 20:14667618-14667640
Sequence CACACACAAGCATTTTAGAC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 186}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170282587_1170282590 15 Left 1170282587 20:14667580-14667602 CCTTTGTGGAGGAAAGCACATGT 0: 1
1: 0
2: 2
3: 16
4: 171
Right 1170282590 20:14667618-14667640 CACACACAAGCATTTTAGACGGG 0: 1
1: 0
2: 0
3: 14
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170282590 Original CRISPR CACACACAAGCATTTTAGAC GGG Intronic
900752665 1:4408562-4408584 CACACACACACACTGTAGACAGG + Intergenic
904917116 1:33978030-33978052 CACACTTAAAGATTTTAGACAGG - Intronic
906357439 1:45119116-45119138 CCCACCCAAGAATTTTAAACAGG + Intronic
909648543 1:77945816-77945838 AACACACAAACATTTTAAACTGG + Intronic
910121917 1:83799590-83799612 CACACACAGGCAGTACAGACAGG - Intergenic
910952508 1:92666289-92666311 CACACACACACAATTTAGCCAGG + Intronic
911760231 1:101605548-101605570 CACAAACAGGCATTGCAGACAGG - Intergenic
916245599 1:162685450-162685472 TACAAACTAGCTTTTTAGACTGG + Intronic
918519287 1:185397662-185397684 CACACACAAGCACATAAGAAAGG - Intergenic
922818578 1:228469139-228469161 TACAAACAAGCATTTAATACAGG + Intergenic
924190135 1:241542459-241542481 TACACACAAACAGGTTAGACTGG + Intronic
924195780 1:241605390-241605412 CACACACAAGGATTGCTGACAGG + Intronic
924357904 1:243203025-243203047 CACACACAAACATTTTTGGAAGG - Intronic
924376511 1:243414835-243414857 CACACACACACATATTAGAATGG - Intronic
924787550 1:247212112-247212134 CACACACACCCATTACAGACAGG - Intergenic
924906138 1:248454323-248454345 CACACATTAGCAATATAGACAGG - Intergenic
924921751 1:248637714-248637736 CACACATTAGCAATATAGACAGG + Intergenic
1064906162 10:20348081-20348103 CACACACACACATATTAGCCAGG + Intergenic
1066660261 10:37731674-37731696 CACACACAACACTTCTAGACAGG - Intergenic
1066998951 10:42588261-42588283 CACACAAGAGCATTTTAGGATGG + Intronic
1069219623 10:65867354-65867376 CACACACAATCATTTTTACCTGG - Intergenic
1072470032 10:95705267-95705289 CACACACACACATTTTCTACTGG - Intergenic
1075813227 10:125243912-125243934 CACCAACAACCATTTTAGATAGG - Intergenic
1079854748 11:25588516-25588538 GAGATACAAGCATTTTAAACTGG - Intergenic
1080046115 11:27809950-27809972 CACACACAAGCCTTTAGGACAGG - Intergenic
1080348994 11:31359750-31359772 CACACCCCCACATTTTAGACAGG - Intronic
1082661634 11:55919495-55919517 CACTCAAAAGCATTTTACAATGG + Intergenic
1082826847 11:57586195-57586217 CACACACACATATATTAGACAGG - Intergenic
1085431130 11:76449671-76449693 CAAATAAAAACATTTTAGACTGG + Intronic
1088372810 11:109110202-109110224 CATACACATCCATTTTAGAGAGG + Intergenic
1088855599 11:113749528-113749550 CACACACAAGCATGTAAAACTGG + Intronic
1090530279 11:127583755-127583777 CACACAAAAGCAAATAAGACAGG - Intergenic
1092154406 12:6273229-6273251 CACACACACACAATTTAGCCGGG - Intergenic
1097943016 12:65333304-65333326 CATACAAAAGCATTTCAAACAGG - Intronic
1099036555 12:77594395-77594417 TATACACAAGGATTTTTGACAGG - Intergenic
1099581174 12:84448923-84448945 CACAGACATGCATATAAGACTGG - Intergenic
1104386953 12:128358943-128358965 CACATGCAAGCACTTTACACTGG - Intronic
1105963970 13:25368602-25368624 CACACATAAGCATTTTAAAAAGG + Intergenic
1109163554 13:59005451-59005473 CACACACACACATTTTAATCTGG + Intergenic
1109547799 13:63849732-63849754 CACAAACACACATGTTAGACTGG + Intergenic
1111220527 13:85199213-85199235 CACAAACAAGAATTTTCAACTGG - Intergenic
1111394804 13:87651579-87651601 CACCCACAAGTATTTTAGTGAGG - Intergenic
1118908467 14:70041340-70041362 CACTCACAAGCAAAGTAGACTGG - Intergenic
1119033573 14:71211410-71211432 CACACACACACATTGTAGAATGG + Intergenic
1119391250 14:74292629-74292651 CACACAAAGGCATTCTGGACAGG + Exonic
1120508090 14:85378386-85378408 CACACACAAAAATATTAGCCGGG - Intergenic
1125613853 15:40992252-40992274 TACACATAAGCATTTAAAACAGG + Intronic
1125996713 15:44168476-44168498 GACACACAAGAATTAAAGACAGG - Intronic
1126155571 15:45562748-45562770 CACACACAAGAAAATTAGCCAGG + Intergenic
1126354456 15:47780537-47780559 CACACACAAGCATTGTACCTAGG + Intergenic
1126853760 15:52817298-52817320 CACACACAAGCAGTGGAGAAAGG - Intergenic
1132022948 15:98380279-98380301 CACACACAAAAAATTTACACAGG + Intergenic
1133519555 16:6543724-6543746 CACACCGAAGCATCTTAGAAGGG + Intronic
1134463388 16:14449790-14449812 CACCCACTAGGTTTTTAGACTGG + Intronic
1135597000 16:23752508-23752530 CATACACAAGCTTTTAAGAGAGG - Intergenic
1139116159 16:63956138-63956160 CACACACTAGGCTTTTAGAGAGG - Intergenic
1139453944 16:67056599-67056621 CAAAAACAAGCATGTTACACGGG - Intronic
1140027547 16:71304311-71304333 CACACACGAGTATCCTAGACAGG + Intergenic
1140396998 16:74636029-74636051 CTTACAGATGCATTTTAGACTGG - Intronic
1140678437 16:77358712-77358734 CACACACAAACATCCTAAACTGG + Intronic
1140952543 16:79833126-79833148 CACACACAAGCATATTAGCAAGG + Intergenic
1141408050 16:83811092-83811114 CCCACAGAAGCATCTGAGACTGG - Intronic
1144285804 17:13772729-13772751 CCCACACAATCATTAGAGACTGG + Intergenic
1146433461 17:32821557-32821579 CACACACACACATCTTTGACTGG + Intronic
1147472101 17:40672077-40672099 CAAACACAAGCAAATCAGACAGG + Intergenic
1148055478 17:44792046-44792068 CACACACACACAGTTTAGGCCGG - Intergenic
1148675118 17:49440423-49440445 CACACACAGGTCTTTTAGCCAGG + Intronic
1149187608 17:54017717-54017739 CACACACAAGGAGTTTAGGATGG - Intergenic
1151572561 17:74934279-74934301 CACACACACACAATTTAGCCAGG - Intergenic
1153409242 18:4775541-4775563 CACACACCAGGATTTAAGGCAGG + Intergenic
1156182439 18:34621245-34621267 CACACACAATCATTATTCACAGG - Intronic
1157738032 18:50068056-50068078 CACACACAACACTTTTAGAGTGG + Intronic
1159045506 18:63366366-63366388 CAGAGACAAGCAGTGTAGACGGG + Intronic
1159977368 18:74730496-74730518 GAGACACAAGCATTTGTGACGGG - Intronic
1162221301 19:9178980-9179002 CACACTCATGCATCTTAGAGAGG + Intergenic
1162669975 19:12248792-12248814 ACCTCACAAGCAATTTAGACAGG - Intronic
1166786788 19:45372106-45372128 CACACACACACATTTGAGATAGG - Intergenic
1167809058 19:51812639-51812661 CACACACAAGCTTTGCAGACAGG + Intronic
1168603885 19:57742741-57742763 CACACACAACCAAATTAGCCGGG + Intronic
925806041 2:7649294-7649316 CACACACAAGCATTTGGAAATGG - Intergenic
926154098 2:10441615-10441637 CACCCACATGCATTTCAGGCAGG + Exonic
926549559 2:14285198-14285220 CATAAACAAGCATATTAGTCTGG - Intergenic
926722552 2:15971928-15971950 CAAACAAAAGCATTCTAGGCTGG + Intergenic
929414047 2:41729538-41729560 CACACACACACATTTCACACTGG + Intergenic
932913216 2:75827146-75827168 CAAACACAAGCAATGGAGACAGG + Intergenic
934584077 2:95474234-95474256 CACACACAAGGCTTTGAGAAGGG + Intergenic
934595375 2:95602480-95602502 CACACACAAGGCTTTGAGAAGGG - Intergenic
934787396 2:97023054-97023076 CACACACAAGGCTTTGAGAAGGG + Intergenic
936889515 2:117353026-117353048 CACACACAATCATCTGAGACTGG + Intergenic
938087690 2:128412170-128412192 CACAAACTTGCATTTTAGAAAGG + Intergenic
939189389 2:138898090-138898112 CACACACATGAATTTTAAAAAGG + Intergenic
942017541 2:171831951-171831973 CACACACAACACTTGTAGACAGG - Intronic
942156525 2:173134356-173134378 CACACACACACAATTTAGCCAGG - Intronic
945656866 2:212634788-212634810 CACACAGAAGAATTCTAGGCCGG + Intergenic
946850242 2:223898744-223898766 TCCACACAAGCAATTTAGAAGGG + Intronic
1168918619 20:1512400-1512422 CACACACACGTTTTTGAGACAGG + Intergenic
1170282590 20:14667618-14667640 CACACACAAGCATTTTAGACGGG + Intronic
1170326614 20:15161726-15161748 CAGAGACAAGCATTCTAAACTGG - Intronic
1170438526 20:16354501-16354523 CACACACACACAATTTAGAATGG + Intronic
1174131947 20:48351317-48351339 CACACACACCCATTTTCCACTGG + Intergenic
1174369793 20:50078810-50078832 CACACTCTAGGATTTGAGACAGG + Intergenic
1174470427 20:50755774-50755796 CACACACAAAAATATTAGCCGGG + Intronic
1174567271 20:51474261-51474283 CTCACATAAGCATTTCAGCCAGG + Intronic
1174829018 20:53795934-53795956 CACACACAAAAAATTTAGGCCGG - Intergenic
1177560864 21:22751605-22751627 CATACACAAGCATTTTGAAAGGG + Intergenic
1181119406 22:20655741-20655763 CACACACAACACTTCTAGACAGG + Intergenic
1181755988 22:25025294-25025316 CACACACAAGCAATTACAACTGG - Intronic
1182770957 22:32795994-32796016 TACACACAAGCATCTCAGCCAGG - Intronic
1183173641 22:36205830-36205852 CACACACCAGCTTTTGAGACAGG + Intergenic
1183508280 22:38221141-38221163 CACACACAAGCATTGGGGCCTGG + Exonic
951171515 3:19547492-19547514 CACAGACAAACATTCAAGACAGG + Intergenic
953161991 3:40429501-40429523 CACACCGAAGAATTTTTGACTGG + Intergenic
957487202 3:80877538-80877560 CACAGATAAACATTTTATACAGG - Intergenic
958674220 3:97245856-97245878 CACACACAAGCCCTGTAGATTGG + Intronic
958976346 3:100671815-100671837 CACACACAAGCAATGGAGAAAGG - Intronic
959395146 3:105827665-105827687 CAGACACAAAAATTTAAGACAGG + Intronic
959847608 3:111052788-111052810 CACACACAAGCACTTTCCATAGG + Intergenic
960322024 3:116248467-116248489 CACACACACACATTAGAGACAGG - Intronic
963388123 3:144622680-144622702 GGCACACAAGCAGTTTACACTGG - Intergenic
965074231 3:163955854-163955876 CACAAAACAGAATTTTAGACAGG - Intergenic
966695683 3:182788560-182788582 CACACAGCTGCATTCTAGACTGG - Intergenic
970072479 4:12177109-12177131 CACACACAAGCATTGTACTTAGG + Intergenic
971360166 4:25930890-25930912 CAGACACAGTCATTTTAGCCTGG - Intergenic
972187111 4:36542660-36542682 CACACAAAAGCCTTTTATAAAGG + Intergenic
972323918 4:37997363-37997385 CACACAAAAGCCTTTAAGTCAGG - Intronic
973551459 4:52039236-52039258 GACAAACATGCATTTTAGGCAGG + Intergenic
974312833 4:60234362-60234384 GCCACACAGGCATTTTAGTCAGG - Intergenic
976880495 4:89917343-89917365 ATCACAAAAGCATTTTACACAGG - Intronic
978551005 4:109926937-109926959 CAGACACAAGAATTTTTAACAGG - Intronic
984765499 4:183397839-183397861 CAGAGCCAAGCATGTTAGACTGG + Intergenic
986627965 5:9740634-9740656 AACACACAAGCGTTTTTGAGTGG + Intergenic
987422675 5:17738766-17738788 CTCACCAAAGCATTTTAAACAGG - Intergenic
987695686 5:21327215-21327237 AAAACACAAGCAATTTAGAAAGG + Intergenic
987968949 5:24917023-24917045 GTCACACAGGCATTTTAAACAGG - Intergenic
991744716 5:69724881-69724903 AAAACACAAGCAATTTAGAAAGG - Intergenic
991752988 5:69830352-69830374 AAAACACAAGCAATTTAGAAAGG + Intergenic
991796287 5:70304605-70304627 AAAACACAAGCAATTTAGAAAGG - Intergenic
991802607 5:70387079-70387101 AAAACACAAGCAATTTAGAAAGG + Intergenic
991824096 5:70600195-70600217 AAAACACAAGCAATTTAGAAAGG - Intergenic
991832307 5:70705471-70705493 AAAACACAAGCAATTTAGAAAGG + Intergenic
991888665 5:71304164-71304186 AAAACACAAGCAATTTAGAAAGG - Intergenic
992307495 5:75457949-75457971 CACACACACACATTTTTAACAGG - Intronic
993731893 5:91432415-91432437 GACACAAATACATTTTAGACAGG - Intergenic
995375396 5:111468620-111468642 CACACTCTAGCAATCTAGACAGG - Intronic
995590219 5:113692014-113692036 CACACACACGTATTTTAGCAGGG + Intergenic
997219126 5:132144371-132144393 CACAGACAAGGATTTCAGAGTGG + Intergenic
998211633 5:140203906-140203928 CATACCCCAGCATTCTAGACAGG + Intronic
999229872 5:150055395-150055417 CACCCACACACATCTTAGACTGG + Intronic
1001316182 5:170642685-170642707 CAGACACAAGCAGTTTTCACAGG - Intronic
1004786241 6:18970806-18970828 CACACACAGGCATGTTAGCACGG + Intergenic
1006433576 6:34013993-34014015 CACACACACACAAATTAGACAGG + Intergenic
1007853177 6:44824874-44824896 CACACACAAACATGTCAGGCTGG + Intronic
1008039261 6:46778634-46778656 GCCACAGAAGCATTTTAGCCAGG + Intergenic
1010049629 6:71487483-71487505 CAGACACATCTATTTTAGACTGG - Intergenic
1011536305 6:88379987-88380009 CTGACACAATTATTTTAGACTGG - Intergenic
1012098488 6:94997988-94998010 CACACACACACATCTCAGACAGG - Intergenic
1013061242 6:106636096-106636118 CTCACTGGAGCATTTTAGACTGG + Intronic
1015450398 6:133360950-133360972 GACACAGAAGCGCTTTAGACTGG + Intronic
1016461198 6:144281907-144281929 CACATACAAGCATTTAAGAGAGG - Intergenic
1017469265 6:154723486-154723508 CACACACACGAATATTAGCCGGG - Intergenic
1018750706 6:166802107-166802129 CACACACAAACAAATTAGCCAGG + Intronic
1019135538 6:169905471-169905493 CACACACAAACCTTTTCCACTGG - Intergenic
1020259493 7:6522797-6522819 CACACACACACATATTAGCCAGG - Intronic
1020462143 7:8437943-8437965 CACACAAAAGTACTTTAGATTGG - Intronic
1021107946 7:16660354-16660376 CACACCCCTGCATTTTAGCCTGG + Intronic
1025153052 7:56575477-56575499 CACACACAAAACTATTAGACGGG + Intergenic
1025773902 7:64541406-64541428 CACATAAATGCATTTTTGACAGG - Intronic
1027324401 7:77036206-77036228 CACACACACACATATTAGCCAGG - Intergenic
1028005980 7:85567904-85567926 CTCACACAAACATTTCAGATAGG + Intergenic
1028016285 7:85717992-85718014 CCCACACTAGCAATTTAGACGGG + Intergenic
1029858382 7:103542140-103542162 CAGAAACAAACATTTTAAACTGG - Intronic
1030562960 7:111114151-111114173 CACACACACACATTTTTGCCAGG + Intronic
1031767034 7:125793077-125793099 CACACACACGCATCTTAAATTGG + Intergenic
1038432188 8:27509363-27509385 CACACAGAAGCATTGAAAACAGG - Intronic
1039152739 8:34525492-34525514 CACACAAAAGCATTTTATAGTGG + Intergenic
1040023386 8:42760685-42760707 CACACACATCTATTTTAGATGGG + Intronic
1041156918 8:54997027-54997049 CACACAGAATCATTTAAGATGGG + Intergenic
1045869926 8:106914121-106914143 CACACACATGCTTGTTAGATTGG - Intergenic
1045944306 8:107778410-107778432 GACACACAAGCTTTTTAGAGTGG + Intergenic
1050863141 9:10461916-10461938 CACATACAAGCAAGATAGACCGG - Intronic
1052140161 9:24971224-24971246 CACACACAATACTTTTAGAGTGG + Intergenic
1052658485 9:31397032-31397054 CACACACAATTATTTCAGGCTGG + Intergenic
1055932303 9:81572132-81572154 CACTCACATGAATTTTAGATGGG - Intergenic
1057805221 9:98215087-98215109 CACACAGCAGCATTTTTGAGAGG - Intronic
1060344880 9:122807260-122807282 CACACAGATTCAATTTAGACTGG + Intronic
1061699185 9:132402458-132402480 CACACCAAAGCATTTTAGAAAGG - Exonic
1185582132 X:1217779-1217801 CACACACAAAAAATTTAGCCAGG + Intergenic
1185943947 X:4353614-4353636 CACCCATGGGCATTTTAGACAGG + Intergenic
1186856739 X:13634340-13634362 CACACACAACCTTTTAAGATGGG + Intergenic
1187353842 X:18547515-18547537 CAGACACAAACATTTTATTCAGG + Intronic
1188067527 X:25680175-25680197 CAGCCATAACCATTTTAGACTGG + Intergenic
1188180232 X:27046123-27046145 CACACACAAGCATATATGCCAGG + Intergenic
1189817119 X:44835112-44835134 AACACACAAGTATTTTATGCAGG - Intergenic
1190945320 X:55087279-55087301 CAAAAACAAGCAATGTAGACAGG - Intergenic
1194368571 X:93040227-93040249 CACACACAAGCATTGTAACTAGG - Intergenic
1195089772 X:101447644-101447666 CAGACACAAGCATAACAGACAGG - Intronic
1196557227 X:117102008-117102030 CACACAGAAGCTTTTTAGCTTGG + Intergenic
1199529899 X:148834495-148834517 CACACACACACATCTGAGACTGG - Intronic
1199969787 X:152851347-152851369 CACAGACAAACATTTCACACAGG - Intronic
1200676772 Y:6156481-6156503 CACACACAAGCATTGTAACTAGG - Intergenic
1201728307 Y:17179525-17179547 CACCCATAGGCATTTTAGACAGG + Intergenic