ID: 1170285638

View in Genome Browser
Species Human (GRCh38)
Location 20:14705365-14705387
Sequence GTTCCATGCTAGGCATAGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 124}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170285638 Original CRISPR GTTCCATGCTAGGCATAGAG GGG (reversed) Intronic
905355784 1:37383388-37383410 GTTCCAGCCTAGGCCTTGAGAGG - Intergenic
905879876 1:41456597-41456619 GTCCCAAGCAAGGCCTAGAGAGG + Intergenic
907514321 1:54983671-54983693 GTGCGATGCTAGGTATAAAGGGG + Intronic
919666695 1:200299646-200299668 TCTCCAGGCCAGGCATAGAGTGG + Intergenic
920974869 1:210776337-210776359 GTGGAATGCTAGGGATAGAGAGG - Intronic
923758726 1:236819561-236819583 TTTCCATGCTACTCACAGAGGGG + Intronic
1065702163 10:28436126-28436148 TTTCCATGCTACTCACAGAGGGG + Intergenic
1068045622 10:51882619-51882641 GATTCATCCTAGGGATAGAGGGG - Intronic
1071098087 10:82002629-82002651 GTCCCATGCTTGGCGTAGTGTGG + Intronic
1072880826 10:99226933-99226955 GTTTCATGCTAGACAAAGAATGG - Intronic
1073539313 10:104305572-104305594 GTACCATGCTGCGCATAGACAGG + Intergenic
1074112883 10:110434823-110434845 GATCCATGCTTGGCATAGTAAGG - Intergenic
1075678377 10:124313805-124313827 GTTACATGCCAGGCACAGGGAGG - Intergenic
1078509663 11:11976033-11976055 GATCCACGCTAGGGGTAGAGTGG - Intronic
1081082831 11:38764558-38764580 GTTCAATGCTAGGGTTATAGAGG + Intergenic
1081976571 11:47239078-47239100 GTTCCAGGCTAGATACAGAGGGG - Exonic
1082753630 11:57049603-57049625 GTTCCATTTCAGTCATAGAGTGG - Intergenic
1084072403 11:66744876-66744898 GTTCCCTGCGCGGCATGGAGGGG + Intronic
1085705949 11:78786957-78786979 GTCCCATGCTCGGCACAGCGCGG + Exonic
1090923985 11:131233627-131233649 GTTCTGTGCTAGGCACTGAGTGG + Intergenic
1091621610 12:2093356-2093378 GTCCTATGCTAGGCATTGTGAGG + Intronic
1101278192 12:103224863-103224885 TTTCCTTCCTAGGCATAGTGTGG - Intergenic
1101735322 12:107458891-107458913 TTCCCATGCCTGGCATAGAGGGG - Intronic
1102017557 12:109657661-109657683 GTTCCTTGCTCTGCAGAGAGAGG - Intergenic
1102942325 12:116954197-116954219 GTTCCATGCTAGAATTTGAGTGG - Intronic
1105738087 13:23293009-23293031 ATTTCCTGCTTGGCATAGAGAGG - Intronic
1108254268 13:48595440-48595462 TTTCCATGCAAGGCAGAGTGTGG + Intergenic
1113075770 13:106466658-106466680 TTTCAATGCTAGGCACACAGGGG - Intergenic
1113403576 13:110018137-110018159 GTTCCATGCTGGGCACAGAGCGG - Intergenic
1122347080 14:101067373-101067395 CTCCCATGCTAGGCATGGAGAGG - Intergenic
1127412208 15:58720689-58720711 GTTCCATGCTAGGCCGGGCGTGG - Intronic
1128231412 15:66038064-66038086 GTTTCAGGCTTGGCTTAGAGAGG + Intronic
1128514056 15:68331251-68331273 GTGCCATGATAGGCCAAGAGAGG - Intronic
1128623695 15:69176703-69176725 GTTAAATGCTAGGAATAAAGTGG - Intronic
1128656406 15:69465481-69465503 GTTCCATCATATGCATAGTGGGG + Intergenic
1130007459 15:80113722-80113744 GGTTCATGTTAGGCATAAAGAGG + Intronic
1131114402 15:89785108-89785130 GTGCCATGCCAGGCCTAGGGCGG + Exonic
1131948366 15:97652590-97652612 GTTGCGTGCTGGGCATGGAGGGG - Intergenic
1133438850 16:5803693-5803715 GTACCATACTAGGCACAGAGTGG + Intergenic
1134659025 16:15969883-15969905 GCTCCATGCTGGGAATCGAGCGG + Intronic
1137390158 16:48074600-48074622 GTTCCAGGCTAAGAATAGAGTGG + Intergenic
1143395468 17:6591864-6591886 GTCCCATTCTAGGCACAGTGAGG + Intronic
1143803871 17:9409030-9409052 GTACCATACTTGGAATAGAGAGG - Intronic
1146746649 17:35336793-35336815 TTTCCATGCTTGGGATACAGAGG + Intergenic
1147445804 17:40474664-40474686 GTTCCATGCTGGGCCAAGCGGGG + Intergenic
1150540859 17:66097449-66097471 GTTGGGTGCTAGGGATAGAGTGG - Intronic
1157163885 18:45340131-45340153 GTTCCATGCTGGCCATAGATGGG - Intronic
1166909434 19:46141469-46141491 GTTCCATCCTAGACATGGTGGGG - Intergenic
1167036602 19:46998705-46998727 ATTCCATGATAGGCAAAGTGTGG + Intronic
1168190573 19:54735595-54735617 GTTCCATGACAGGCAGAAAGTGG + Intronic
1168192794 19:54751991-54752013 GTTCCATGACAGGCAGAAAGTGG + Intronic
1168194881 19:54766819-54766841 GTTCCATGACAGGCAGAAAGTGG + Intronic
1168197133 19:54783261-54783283 GTTCCATGACAGGCAGAAAGTGG + Intronic
1168202928 19:54829703-54829725 GTTCCATGACAGGCAGAAAGTGG + Intronic
1168205490 19:54847526-54847548 GTTCCATGACAGGCAGAAAGTGG + Intronic
926451071 2:13004776-13004798 GTTCTGTGCTAGTCATAGAATGG - Intergenic
930464660 2:51732145-51732167 GTTTCATGCAAGGCATAAAAGGG + Intergenic
932431552 2:71678307-71678329 ATTCCATTCTAGGCATATACGGG - Intronic
935728763 2:106047332-106047354 CCTCCATGCTGGGCACAGAGGGG - Intergenic
937463532 2:122109945-122109967 CTCCCATGCTAGGCACAGACAGG + Intergenic
940905041 2:159161324-159161346 GTTCCAGGCTAGGGAGATAGGGG - Intronic
944410641 2:199439107-199439129 GCACCATGCTAGGCATGGAGGGG + Intronic
947015760 2:225618054-225618076 GTGCCATGGAAGGCATAGGGTGG + Intronic
947455737 2:230252372-230252394 GTGCCTTAATAGGCATAGAGTGG + Intronic
948155671 2:235778924-235778946 GATCCATGTGAGGCACAGAGAGG - Intronic
1169593744 20:7175094-7175116 GATACATGCTAGGCAGAGGGTGG + Intergenic
1170285638 20:14705365-14705387 GTTCCATGCTAGGCATAGAGGGG - Intronic
1172580252 20:36041766-36041788 GTTCCATGCTTGGCATGGCTAGG + Intergenic
1180723448 22:17926729-17926751 GTACCATGCTAAGCATGGTGGGG + Intronic
1183521006 22:38296010-38296032 TTTCCATGCTTGGGATACAGAGG + Intronic
1183784624 22:40022215-40022237 ATTCCAGGCTTGGCATGGAGGGG + Intronic
950131925 3:10553329-10553351 GTTCCATGCCTGACACAGAGAGG + Intronic
951126933 3:18995676-18995698 GTTACATCCTAGGCACAGTGGGG + Intergenic
953600635 3:44360379-44360401 GTTCGATGCTATGAATAGATGGG - Intronic
955986344 3:64577442-64577464 ATCCCATGGCAGGCATAGAGTGG - Intronic
957535883 3:81502971-81502993 GTCCTCTGCTAGGCATAGGGAGG - Intronic
963503536 3:146158337-146158359 TTTCCATGCTAAGAATAAAGTGG + Intronic
967521963 3:190442179-190442201 GTGCCATGTTAGGCATAGTGAGG - Intronic
977798910 4:101201916-101201938 ATCCCATGCTAGGCAGTGAGAGG + Intronic
979147965 4:117269760-117269782 TTTCCATGTTAGGAATAGTGAGG + Intergenic
979200657 4:117974128-117974150 GTTCCTTGCTATGCTCAGAGAGG + Intergenic
979661722 4:123263415-123263437 GTGCTATGCTAGGCATTGTGAGG - Intronic
981613828 4:146625113-146625135 GTCCCACGCTAAGCAAAGAGGGG + Intergenic
982106911 4:152019178-152019200 GTTGCCTGCTAGGGATGGAGTGG - Intergenic
982330640 4:154178412-154178434 ATTCCATGCTAGGGATTGGGTGG + Intergenic
984701395 4:182820807-182820829 TCTCCATGCCTGGCATAGAGGGG + Intergenic
985171129 4:187151420-187151442 ATTCCATGCAAGTCATAGAATGG - Intergenic
988126741 5:27049321-27049343 GTTACCTGCTTGGCATATAGTGG + Intronic
988425278 5:31056598-31056620 GTTCCATGCTTGACAAAGATTGG - Intergenic
989525583 5:42449973-42449995 GTTTCATACTAGGGATATAGTGG - Intronic
991642851 5:68771745-68771767 GTACCATGCTAGGCACTGAGAGG + Intergenic
992081288 5:73235611-73235633 GGTCCCTGCTAGGAATAGATTGG + Intergenic
995306200 5:110653773-110653795 GTGCCATTCTGGGCATAGAGAGG + Intronic
995319515 5:110817267-110817289 AAACCATGCTAGGCATCGAGGGG - Intergenic
997362391 5:133303424-133303446 GTCCCTGGCTAGGCAGAGAGAGG - Intronic
1001389231 5:171365519-171365541 TCTCCATGCTACCCATAGAGGGG + Intergenic
1001550365 5:172598282-172598304 GTTTCATGCCAGGCAGAGGGAGG - Intergenic
1005390097 6:25324190-25324212 ATCCCATGCTAGGCGTGGAGAGG + Intronic
1008448245 6:51618844-51618866 GTTCAATGCTAGGCAAATAATGG - Exonic
1009975227 6:70664857-70664879 GTTATATGCTAGACATAGTGAGG - Intergenic
1011949785 6:92951576-92951598 TTTCCCTGCTAGACTTAGAGAGG + Intergenic
1013152613 6:107460249-107460271 GCTCCAGGCTAGGCATAAAGAGG - Intergenic
1014878360 6:126689170-126689192 GTTTCATACTAGGGATACAGGGG + Intergenic
1015807829 6:137129873-137129895 GTTTCATGCTAGGGATGCAGGGG - Intergenic
1015937827 6:138420422-138420444 GGACCATGGCAGGCATAGAGCGG + Exonic
1016196122 6:141343454-141343476 TTGACATGCTAGGAATAGAGAGG - Intergenic
1016709529 6:147153937-147153959 GTTCCATGCTAGGCACCCAAGGG - Intergenic
1021759527 7:23890156-23890178 ATTCCAAGCTTGGCATACAGTGG - Intergenic
1024615175 7:51105779-51105801 GTTCCCTCCTAGGCTGAGAGAGG + Intronic
1029253367 7:99252464-99252486 GTACCATGCAAGCCAGAGAGAGG + Intergenic
1033628797 7:143137513-143137535 GTGCCATGCTAGGCATGCAACGG + Intronic
1035739263 8:1913931-1913953 GGTCCCTGCTGAGCATAGAGAGG + Intronic
1037929227 8:22867717-22867739 GTTCCAAGCTGGAAATAGAGGGG + Intronic
1038184106 8:25257248-25257270 GCTCGATGCCTGGCATAGAGAGG - Intronic
1040758059 8:50804803-50804825 GTTCCAGCCTGGGCATGGAGCGG - Intergenic
1042224283 8:66503507-66503529 CTTCCTTGCTGGTCATAGAGAGG - Intronic
1043724890 8:83598722-83598744 CTTTCATAATAGGCATAGAGTGG - Intergenic
1044695604 8:94919605-94919627 GTTCCATCCCAGGGACAGAGAGG + Intronic
1046662049 8:116958226-116958248 GTTCCATTCTAGGAATGTAGTGG + Intronic
1048316987 8:133369905-133369927 TTTCCATGCCAGGCAGAGACAGG + Intergenic
1050786531 9:9410576-9410598 ATTCCTTGCTAGGAAAAGAGGGG + Intronic
1051794552 9:20850833-20850855 GTTTCATACTAGATATAGAGGGG - Intronic
1056059948 9:82874451-82874473 GCTCCATGCAAGGCATTGTGAGG - Intergenic
1059057687 9:111001416-111001438 GTTCCAGGCTAGACATTCAGAGG + Intronic
1060173035 9:121477111-121477133 GATCCTTGCTAGGCACAGTGAGG - Intergenic
1062472054 9:136710421-136710443 GTTCTATGCCAGGTATAGAAAGG - Intergenic
1190904670 X:54714981-54715003 ATTCCATGATAGACATAGAAAGG - Intergenic
1192207096 X:69103614-69103636 GTTCAGTGCCAGGCAGAGAGGGG - Intergenic
1192601208 X:72466268-72466290 GTTACATGCTGGGCACACAGTGG - Intronic
1195112915 X:101665465-101665487 GCGACATGCTTGGCATAGAGGGG + Intergenic
1196046953 X:111266467-111266489 GCTCAATGCTAGGCAATGAGAGG - Intronic
1196291197 X:113943345-113943367 GGACCATGCTAGGGACAGAGGGG + Intergenic
1197351852 X:125391035-125391057 TTTCCTTCCTAGGCATAGTGTGG - Intergenic
1199826893 X:151509314-151509336 GTTCCTGGCTAGGCATGCAGAGG + Intergenic
1200858052 Y:7960385-7960407 GTTCCAAGATAGGCAGAGGGAGG + Intergenic