ID: 1170286221

View in Genome Browser
Species Human (GRCh38)
Location 20:14712465-14712487
Sequence CAGGGCATTCAACGTGTATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 41
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 39}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170286221_1170286225 -2 Left 1170286221 20:14712465-14712487 CCTGATACACGTTGAATGCCCTG 0: 1
1: 0
2: 0
3: 1
4: 39
Right 1170286225 20:14712486-14712508 TGCATACCTATAGTTCTTAAGGG 0: 1
1: 0
2: 0
3: 7
4: 100
1170286221_1170286224 -3 Left 1170286221 20:14712465-14712487 CCTGATACACGTTGAATGCCCTG 0: 1
1: 0
2: 0
3: 1
4: 39
Right 1170286224 20:14712485-14712507 CTGCATACCTATAGTTCTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170286221 Original CRISPR CAGGGCATTCAACGTGTATC AGG (reversed) Intronic
908934726 1:69361027-69361049 AAGGTCATTGAATGTGTATCAGG - Intergenic
912274796 1:108244865-108244887 CAGGGCATTGAACGCTTCTCAGG + Intergenic
912286469 1:108374993-108375015 CAGGGCATTGAACGCTTCTCAGG - Intergenic
912293422 1:108449476-108449498 CAGGGCATTGAACGCTTCTCAGG - Intronic
916568185 1:166000806-166000828 CAGGGCAATGAGCGTGGATCTGG + Intergenic
922797091 1:228345574-228345596 CAGGGCATTCAACTGGCTTCTGG - Intronic
1065954862 10:30684448-30684470 CAGGGGACTCAAAGGGTATCAGG - Intergenic
1087409079 11:97767589-97767611 CAGGGGACTCAACCTGTAACAGG + Intergenic
1089331082 11:117689500-117689522 CAGGGTATGAAACGTGTTTCTGG + Intronic
1094032884 12:26033775-26033797 CCTGGCATTCAACCTTTATCTGG - Intronic
1095272717 12:40238837-40238859 CAGGGAATTCAACAGTTATCAGG - Intronic
1096589312 12:52646874-52646896 CAGGTCATTCAACTTGTTCCTGG + Exonic
1097448701 12:59709662-59709684 CAGGGCTGTCAAAGTGTACCTGG - Intronic
1109208754 13:59510517-59510539 CAGGGCAGTCAACGTCTGTTTGG - Intergenic
1115073418 14:29355927-29355949 GAGGGCATTTAACTTGGATCAGG + Intergenic
1121827780 14:97024817-97024839 CAGGGCATGCAACTTGGTTCAGG - Intergenic
1134227580 16:12403508-12403530 AAATGCATTCCACGTGTATCAGG + Exonic
1139299652 16:65934221-65934243 AAGAGCAATCAACATGTATCCGG + Intergenic
1147783112 17:42958100-42958122 CATGGCATACAAGCTGTATCTGG - Intronic
1153671193 18:7414162-7414184 CAAGACATTCAACGTACATCAGG - Intergenic
1156847133 18:41679253-41679275 CAAGGCCTTCAATTTGTATCTGG + Intergenic
925027820 2:623494-623516 CTGGGCATTCAACGTGAGACCGG + Intergenic
937611807 2:123870765-123870787 CAGCATATTCACCGTGTATCTGG + Intergenic
938068108 2:128292691-128292713 CAGGGCATTCAGTGTGCAGCAGG + Intronic
943610305 2:190025286-190025308 CAGAGCATACAAGGTGTTTCAGG + Intronic
947734380 2:232447104-232447126 CAGGGCATTCATCCTGGAGCAGG + Intergenic
1170286221 20:14712465-14712487 CAGGGCATTCAACGTGTATCAGG - Intronic
1181167084 22:20989615-20989637 CATGTCATTCAACCTGTATTAGG - Exonic
1185367933 22:50445504-50445526 CAAGGCACTCAATGTGTAGCTGG - Exonic
959008721 3:101049635-101049657 CAAAGCACTCAATGTGTATCAGG + Intergenic
960503311 3:118463977-118463999 CAGGGCATTCACTGTGTGTCGGG + Intergenic
962035625 3:131648434-131648456 CAGGACATTCAAAGTGTAATGGG - Intronic
977650858 4:99467696-99467718 CAGGGCAGTCAACTTGTTTAAGG + Intergenic
981485383 4:145280773-145280795 CAAGGCATTTAACCTGTCTCAGG - Intergenic
993306515 5:86281640-86281662 CAGGGCATTGAACGCTTCTCAGG - Intergenic
993314752 5:86387654-86387676 CAGGCCATTCAATGTGGATTTGG + Intergenic
1008823889 6:55667956-55667978 CAGGGCATTCAAAAGGTATTGGG - Intergenic
1022319059 7:29271246-29271268 CAGGGCCTTGAACTTGTCTCCGG - Intronic
1042503940 8:69539666-69539688 CAGGGCATTCCTCGAGTCTCGGG + Intronic
1055947352 9:81703580-81703602 CAGGGCCTTCAACATGCCTCAGG - Intergenic
1185520776 X:736783-736805 CGTGGCATTCAATGAGTATCAGG + Intergenic