ID: 1170286513

View in Genome Browser
Species Human (GRCh38)
Location 20:14715596-14715618
Sequence AGAGGTTCTCTGCATTTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 162}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170286513_1170286517 25 Left 1170286513 20:14715596-14715618 CCACCCAAATGCAGAGAACCTCT 0: 1
1: 0
2: 1
3: 10
4: 162
Right 1170286517 20:14715644-14715666 CTGTCCCATCTGTTCAGACATGG 0: 1
1: 0
2: 2
3: 16
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170286513 Original CRISPR AGAGGTTCTCTGCATTTGGG TGG (reversed) Intronic
900102820 1:970013-970035 ACAGGTTCTGTGCCTGTGGGGGG + Intronic
900102828 1:970068-970090 ACAGGTTCTGTGCCTGTGGGGGG + Intronic
900102836 1:970123-970145 ACAGGTTCTGTGCCTGTGGGGGG + Intronic
901582022 1:10252361-10252383 AGAGGTTCTTTGTTTTTGTGGGG + Intronic
904770407 1:32878098-32878120 AGATGCTCTCTGCATCTGAGTGG + Intergenic
906293873 1:44637134-44637156 AGAAGTTCTCTGCCTTCGTGGGG + Intronic
907650276 1:56288166-56288188 AGAGGTTTACTTAATTTGGGGGG + Intergenic
907865744 1:58397578-58397600 AGAGGATCTCTGCATTGGATAGG - Intronic
908321094 1:62979675-62979697 AGAGATTCTATGCATGTAGGTGG + Intergenic
908493968 1:64675963-64675985 ACCGGTTCTCTGCATTGGTGAGG - Exonic
908976966 1:69910253-69910275 AGAGGTGCTCTGCTTTTTAGAGG + Intronic
909169396 1:72275593-72275615 AGAGGATTTCTGAATTTGGAAGG - Intronic
909604170 1:77492404-77492426 AGAGGTTATTAGCATTTCGGAGG - Intronic
910516224 1:88063418-88063440 AGAGGTTGTGTGCATCTGTGTGG - Intergenic
914340284 1:146754358-146754380 AGGCCTTCTCTGCCTTTGGGAGG - Intergenic
915278015 1:154802944-154802966 AGAGGCTCTCTGTCTTTGTGAGG + Intronic
915996518 1:160569465-160569487 ACAGATTCTCTGCCTTTCGGGGG + Intronic
917971284 1:180209612-180209634 AGAGATTCTATGCATATGGATGG + Intergenic
918530482 1:185514971-185514993 AGAGGTTTACTGATTTTGGGAGG - Intergenic
919232656 1:194794565-194794587 AGAGGATCTCTGGTTTTGGCAGG + Intergenic
921175172 1:212586979-212587001 AGAGCTTCTCTGCACCTGGAGGG - Intronic
1062791168 10:307576-307598 TGAGATTCTCTGCAGTGGGGGGG + Intronic
1064159519 10:12931884-12931906 AGAGGATTTGTGTATTTGGGTGG + Intronic
1064348608 10:14556327-14556349 AGATCTTCTGTGCATTTGGGAGG - Intronic
1065828499 10:29593901-29593923 AGTGGTTCTCTGGGGTTGGGAGG + Intronic
1067407636 10:46037408-46037430 AGAGGTTAGATGGATTTGGGGGG + Intronic
1071273802 10:84034165-84034187 TGATTTTCTCTGCTTTTGGGGGG + Intergenic
1073710456 10:106031291-106031313 AGATGGTCTCTGCATTGGGATGG + Intergenic
1073718856 10:106141895-106141917 ATAGGTACTCTGGATTTGTGTGG - Intergenic
1073748707 10:106499533-106499555 GCAGGTTGTCTGCACTTGGGAGG - Intergenic
1076111584 10:127863767-127863789 GGAAGTTTTCTGCATTTTGGGGG - Intergenic
1076835963 10:133021097-133021119 GGAGGTTCTGAGCATTTGGTTGG - Intergenic
1079004612 11:16782975-16782997 AGAGGTTCTCAACATTTTGAGGG + Intronic
1080400096 11:31926516-31926538 AGAAGCTCTCTTCATTTGAGGGG - Intronic
1084317241 11:68352740-68352762 GGAGGTGCTCTGCACTTGGTTGG + Intronic
1084708296 11:70828887-70828909 TGAGGCTCTGTGCTTTTGGGAGG - Intronic
1088029677 11:105231356-105231378 AGAGGTTTTCTGCATTCTGCAGG + Intergenic
1088268837 11:108013034-108013056 ACAGGTTCTATACAATTGGGTGG - Intronic
1093689080 12:22089180-22089202 GGAGGTGCTCTGCTTTTGGAGGG - Intronic
1095789875 12:46154175-46154197 AGTAGTTCTGTGAATTTGGGCGG + Intergenic
1095850281 12:46796503-46796525 AGAGCTTCTCTGAAATTGTGTGG + Intronic
1097246143 12:57608825-57608847 AGTGGTTCTCTCCAGTTAGGAGG - Intronic
1098446892 12:70575333-70575355 AGAGGTTCTTAGCTTTTTGGAGG + Intronic
1098674649 12:73273706-73273728 AGAGGTTCTTTGCATTTAAATGG + Intergenic
1105054236 12:133082224-133082246 AGAGGTTCTCTGAGTTTTGCTGG + Intronic
1110277951 13:73660895-73660917 AGAGGTTCACTGGATTATGGAGG + Intergenic
1110915527 13:81016128-81016150 CCAGGTTCTCTGCATTGGGATGG + Intergenic
1111158913 13:84367231-84367253 AGAGTGTCTCTTCAATTGGGAGG - Intergenic
1112046287 13:95601624-95601646 AGCTGTTCTCTGCACTTGGCAGG + Intronic
1112988193 13:105478288-105478310 AGAGGATTTCTGCAATTGTGTGG + Intronic
1116288586 14:43004382-43004404 AGATGTTTTCTACAGTTGGGAGG + Intergenic
1118393480 14:65316096-65316118 AGAGTTTCTCTGACTTAGGGAGG - Intergenic
1119658563 14:76434740-76434762 AGACATTGTCTGCATTTTGGGGG + Intronic
1124089230 15:26582139-26582161 AGAGGTTCTCTCCATGTGTGAGG - Intronic
1125964361 15:43861599-43861621 AGCTGTTCTCTGCAGGTGGGAGG + Intronic
1131149675 15:90039343-90039365 AGATGTTCTCTTCATTTCGTGGG + Intronic
1132482010 16:171416-171438 AGAGTTTCACTGCATTAGCGAGG + Intergenic
1133127343 16:3655539-3655561 AGAGCTCCTCTGCTTTTGGGGGG - Intronic
1133654142 16:7843365-7843387 AGTGATTCTCTGACTTTGGGTGG - Intergenic
1134345808 16:13390414-13390436 ACTGGTTCTCTGCATCTGGGTGG + Intergenic
1136120414 16:28129412-28129434 AGATGTCCTGTGCTTTTGGGGGG - Intronic
1138939809 16:61776608-61776630 AGAGATTCTCTGGATTAGGTTGG + Intronic
1139994003 16:70963050-70963072 AGGCCTTCTCTGCCTTTGGGAGG + Intronic
1140971372 16:80016275-80016297 AGAAGGTCATTGCATTTGGGTGG + Intergenic
1142516025 17:429692-429714 AGAGTTTCTTTTCCTTTGGGTGG - Intergenic
1143803865 17:9409012-9409034 AGAGGTTCTGAGCAGTAGGGGGG - Intronic
1146175042 17:30660552-30660574 TCAGGGTCTCTGCCTTTGGGAGG + Intergenic
1146348496 17:32076576-32076598 TCAGGGTCTCTGCCTTTGGGAGG + Intergenic
1147286442 17:39406047-39406069 AGAAGTTCTCAGTATTTGGAGGG - Intronic
1149563709 17:57627340-57627362 AGAGGTGGGCTGCATTTGCGGGG + Intronic
1149620505 17:58041240-58041262 AGAGGTCCCCAGCAATTGGGGGG - Intergenic
1151303035 17:73242617-73242639 AGAGTTTTTCTGGCTTTGGGAGG - Intronic
1152206330 17:78976515-78976537 AGAGGGTGTCTGCAGTTTGGGGG + Intronic
1152258369 17:79253367-79253389 AGAGGTTTTTTTCATCTGGGCGG - Intronic
1156496134 18:37526278-37526300 AGAGGTGACCTGCATTTGCGTGG + Intronic
1159131161 18:64281592-64281614 AGAGGTTTGCTGCAGGTGGGAGG + Intergenic
1160350876 18:78177163-78177185 TGAGGTTCTATGGATTAGGGTGG - Intergenic
1161218231 19:3105376-3105398 CAAGGTTCTGTGGATTTGGGGGG + Intronic
925430307 2:3786284-3786306 AGAGGTTCACTGCACGTGGAGGG - Intronic
927486389 2:23491250-23491272 AGAGGCCCTCTGCAGGTGGGTGG + Intronic
927886607 2:26722577-26722599 AGAGGATCTCTGCAGTTTAGTGG - Intronic
930594175 2:53365758-53365780 TGAGGATATCTGTATTTGGGTGG + Intergenic
935377963 2:102419985-102420007 TGATGTACTCTGCATTTTGGTGG + Intronic
935849721 2:107205208-107205230 ACAGGTTCTCTCCATTTTGCTGG - Intergenic
936619656 2:114082323-114082345 AGAGGTTCTCTTCATATTAGTGG + Intergenic
937409660 2:121662572-121662594 AATGGTTCTCTGCATTTGGATGG - Intergenic
937758332 2:125568112-125568134 TAACGTTTTCTGCATTTGGGTGG + Intergenic
940109067 2:150130584-150130606 AGAATTTCTCTGATTTTGGGGGG + Intergenic
942606928 2:177701849-177701871 AAAAGTTCTCTGGATTTGGAGGG + Intronic
946122128 2:217525236-217525258 AGTGATTCTCCGCACTTGGGTGG + Intronic
947359418 2:229332565-229332587 AGAGGTGCTGTGAATTTGGTGGG - Intergenic
1168758278 20:330782-330804 CAAGGTTCTGTGCAGTTGGGAGG + Intergenic
1169347258 20:4838598-4838620 AGGAGATATCTGCATTTGGGTGG + Intergenic
1170286513 20:14715596-14715618 AGAGGTTCTCTGCATTTGGGTGG - Intronic
1171315829 20:24193897-24193919 CGAGCTTCTTTGAATTTGGGAGG + Intergenic
1173940426 20:46906352-46906374 AAAGGTTCTGGGTATTTGGGTGG - Intronic
1177401159 21:20606525-20606547 AGAGATTCTGTGTGTTTGGGAGG + Intergenic
1177745277 21:25205192-25205214 AGAGGTTTTCTTCTCTTGGGTGG - Intergenic
1178365416 21:31985778-31985800 AGAGGTTGCATGGATTTGGGGGG + Intronic
1179527184 21:41988008-41988030 TGATGTTCTTTGCATTTGTGGGG - Exonic
1179551389 21:42146136-42146158 AGAGGACCTCTGCATGTGGAAGG + Intergenic
1180191744 21:46168597-46168619 GGAGGATGTCTGCAGTTGGGAGG + Exonic
1181589180 22:23872683-23872705 AGAGCTTCTTTCCATTTTGGAGG - Intronic
1181662533 22:24362954-24362976 AGAGGATCTTTGAATTTTGGTGG + Intronic
1181681062 22:24495938-24495960 AGAGGCTGTCTGCATTTAGTTGG + Intronic
1182623442 22:31630235-31630257 GGAGGTTCCCTGTCTTTGGGCGG - Intronic
1183014098 22:34971784-34971806 AGAGGTGCTCTGGGTCTGGGTGG + Intergenic
951255047 3:20439028-20439050 AGAGAATCTGTTCATTTGGGGGG + Intergenic
951758486 3:26118320-26118342 AGCTGTGCTCTGCAATTGGGGGG - Intergenic
954861143 3:53691394-53691416 AGAGGTATTCTTCAATTGGGAGG - Intronic
955638637 3:61057713-61057735 AAAGGTTCACTGCACTCGGGTGG + Intronic
955878738 3:63521802-63521824 AGAGATTCTCTGCAAATGTGTGG + Intronic
955902804 3:63775191-63775213 AAAGGTTCTATGAATTTGGTAGG + Intergenic
958421095 3:93932671-93932693 ATATGTTCTCTTCATGTGGGGGG + Intronic
960458605 3:117904498-117904520 ATAGGTTCATTCCATTTGGGGGG + Intergenic
961096588 3:124161825-124161847 TGAGGGTCTCTGCATTTCTGAGG + Intronic
962105150 3:132382214-132382236 AAAGGTTCTCTGATTTGGGGCGG + Intergenic
965784286 3:172319665-172319687 AGGGACACTCTGCATTTGGGTGG - Intronic
969784351 4:9442498-9442520 AAAGGTTCACTGCATTCTGGGGG - Intergenic
970594062 4:17584010-17584032 AGAGGATCTCTTCATCTGTGTGG - Intronic
970941584 4:21640677-21640699 TGAGTTTCTTTGGATTTGGGAGG + Intronic
972191496 4:36597356-36597378 AGAGTTTCTCTGCAATTGACTGG + Intergenic
972797006 4:42431054-42431076 AGAAAATCTCTGCCTTTGGGAGG - Intronic
974535585 4:63169583-63169605 AGAGGTTCTCTAGTTTTGTGTGG + Intergenic
976407565 4:84677454-84677476 TGAGGCTCTCTGGATTTTGGTGG + Intronic
980870825 4:138609123-138609145 AGGGGTTCTCTGAGTTTGGCTGG + Intergenic
980896353 4:138864318-138864340 AGAGGGTCTCTTTTTTTGGGTGG - Intergenic
991303553 5:65152395-65152417 AGAGAATCTCTGCATCTGTGAGG + Intronic
992096999 5:73372217-73372239 AGAGAGTCTCTGCATTAGTGAGG - Intergenic
992777824 5:80103719-80103741 AGAAGCTCTCAGCATTTAGGAGG + Intergenic
997767565 5:136520106-136520128 CCCGCTTCTCTGCATTTGGGAGG - Intergenic
1000170368 5:158696564-158696586 AAAGGTTATCTGAATTTGCGTGG - Exonic
1000443256 5:161287533-161287555 AGAGTTTCTCTGCCTTTGAGAGG + Intergenic
1001505056 5:172272453-172272475 AGTGGTTATCTTCATTTGGGGGG - Intronic
1002075581 5:176706332-176706354 AGAGGATCCCTGCATTCTGGTGG + Intergenic
1004475624 6:15968463-15968485 AAAGGTTCTGTGCATTTTGTTGG + Intergenic
1006518726 6:34559181-34559203 CAGGGTTCTCTGGATTTGGGAGG - Intergenic
1010418623 6:75645183-75645205 AGAGCTTCTCTGCCTCTGGTTGG + Intronic
1013182623 6:107731069-107731091 GGAGGTTCTCTACATTTCAGGGG - Intronic
1015166013 6:130200750-130200772 AGGGCCTCTCTTCATTTGGGAGG + Intronic
1015997648 6:139010936-139010958 AGAGGTTCTCTGCCCTTGAGGGG + Intergenic
1024548140 7:50539273-50539295 CCAAGCTCTCTGCATTTGGGAGG + Intronic
1030066615 7:105664277-105664299 AGAGCTTCTCTTCACTGGGGTGG + Intronic
1033619093 7:143046261-143046283 AGAGGATATCTGGCTTTGGGAGG + Intergenic
1033851215 7:145497913-145497935 AGAGGTTTTCTGGATTGGGAGGG - Intergenic
1035627828 8:1086520-1086542 AGAGGTTCACTTCATTTTGAAGG + Intergenic
1036722141 8:11186251-11186273 AGAGGTAGACTGCATTTTGGTGG - Intronic
1037797143 8:22005363-22005385 AGGGGTTCTCCCCACTTGGGTGG - Exonic
1039376772 8:37042416-37042438 AGAAGTCATCGGCATTTGGGAGG + Intergenic
1043062616 8:75524291-75524313 AGAATTTCTTTGAATTTGGGAGG + Intronic
1047087194 8:121530917-121530939 AGATGTTCTCTGCCTCTGTGGGG - Intergenic
1048319244 8:133385666-133385688 AGATGCTCTCTGCACTTGGCTGG - Intergenic
1050149934 9:2609272-2609294 TGTGGTTATCTGGATTTGGGGGG - Intergenic
1050732887 9:8729416-8729438 AGAGGTTATCAAAATTTGGGTGG - Intronic
1051473927 9:17481535-17481557 AGATGTACGCTGCAGTTGGGTGG - Intronic
1054891365 9:70256109-70256131 AGAAGCTCTCTGCATTAGAGAGG + Intergenic
1055176398 9:73323263-73323285 AGAGGATATCTGCATTAGTGAGG - Intergenic
1055787170 9:79883663-79883685 AGGGGATGTCTGGATTTGGGAGG - Intergenic
1057693821 9:97309888-97309910 AGAGCTTTTCTGCCATTGGGGGG - Intronic
1058038135 9:100275194-100275216 AAAAGTTCTCTGCATGTGAGTGG + Intronic
1058979099 9:110152685-110152707 AGAGGTCCTCTCCATTAGGACGG - Intronic
1061009474 9:127946511-127946533 ACAGGTTCTCTGCATATGGGGGG + Intronic
1185444875 X:252577-252599 AGGTGATCTCTGCATGTGGGTGG + Intergenic
1185444899 X:252705-252727 AGGTGATCTCTGCATGTGGGTGG + Intergenic
1186695633 X:12028650-12028672 AGTGGTTCTCAGGAGTTGGGGGG - Intergenic
1189745162 X:44161427-44161449 AGAGGCTCTTTGCATATGGCTGG - Intronic
1190831696 X:54064512-54064534 AGGGGTTCTCTGCATGTGGTCGG - Intergenic
1194052586 X:89090208-89090230 AGAGTTTCTCTCCATGTGGCAGG + Intergenic
1195134099 X:101886327-101886349 AGAAATTCTCTGCATTTGTATGG + Intronic
1196152984 X:112394139-112394161 GGAGGTTCTCTGGGTTTGGGAGG + Intergenic
1197560158 X:128011256-128011278 ACATCTTCTCTTCATTTGGGAGG - Intergenic
1198946849 X:142025511-142025533 AGAGGTTCTCTGAAGTAGGTAGG - Intergenic
1199761108 X:150904739-150904761 AGCCCTACTCTGCATTTGGGAGG - Intergenic
1200238875 X:154483292-154483314 AAAGGATCTCAGCATTGGGGGGG + Intergenic