ID: 1170290006

View in Genome Browser
Species Human (GRCh38)
Location 20:14758435-14758457
Sequence CATACTAAGTAGCTGGATTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 112}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170290002_1170290006 -7 Left 1170290002 20:14758419-14758441 CCTGTATTTCCACAGCCATACTA 0: 1
1: 0
2: 0
3: 14
4: 205
Right 1170290006 20:14758435-14758457 CATACTAAGTAGCTGGATTCAGG 0: 1
1: 0
2: 0
3: 10
4: 112
1170290000_1170290006 26 Left 1170290000 20:14758386-14758408 CCCTGAGCTTCACGGCTTATTAA 0: 1
1: 0
2: 2
3: 2
4: 64
Right 1170290006 20:14758435-14758457 CATACTAAGTAGCTGGATTCAGG 0: 1
1: 0
2: 0
3: 10
4: 112
1170290001_1170290006 25 Left 1170290001 20:14758387-14758409 CCTGAGCTTCACGGCTTATTAAA 0: 1
1: 1
2: 2
3: 9
4: 71
Right 1170290006 20:14758435-14758457 CATACTAAGTAGCTGGATTCAGG 0: 1
1: 0
2: 0
3: 10
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170290006 Original CRISPR CATACTAAGTAGCTGGATTC AGG Intronic
901244272 1:7716414-7716436 TAAAATAAATAGCTGGATTCTGG - Intronic
902521187 1:17017677-17017699 CCTCCTGAGTAGCTGGATTAGGG + Intergenic
903479508 1:23642993-23643015 CCTCCTAAGTAGCTGGAAACAGG - Intergenic
908896286 1:68904121-68904143 CATAGTAAGTAACTGGATTAAGG - Intergenic
912053982 1:105571150-105571172 CATATTAATTAGCTCGATTGTGG + Intergenic
915998529 1:160590680-160590702 CAGACTAAGTAGCTGGTGCCTGG + Intergenic
919516099 1:198525694-198525716 CATACTAAGTCTTTGGAATCTGG + Intronic
919772951 1:201174397-201174419 CCTTCCAAGTAGCTGGATTACGG + Intergenic
920939407 1:210467206-210467228 CATACTAAGTAGTTAAATTTAGG + Intronic
921917844 1:220632808-220632830 TATAATAAGGAGATGGATTCAGG + Intronic
1064804830 10:19119064-19119086 CATAAGATGTAGTTGGATTCTGG + Intronic
1065159699 10:22907229-22907251 CATTCTAAGTTGCTGTATTCAGG + Intergenic
1070842907 10:79500139-79500161 CCTCCCAAGTAGCTGGATTATGG - Intergenic
1071017534 10:81015730-81015752 TATAATATGTAGCTGGATTAAGG + Intergenic
1072151382 10:92687697-92687719 CATCCCAATTAACTGGATTCTGG - Intergenic
1075219947 10:120576232-120576254 CATTCAAAGAAGCTGGATTCAGG - Intronic
1077856583 11:6132180-6132202 TATACTAAGGAGCATGATTCAGG + Intergenic
1078815944 11:14822769-14822791 CCTAAGAAGTAGCTGAATTCAGG + Intronic
1080679047 11:34456718-34456740 CAAAGTAATTAACTGGATTCCGG - Exonic
1082254814 11:50022047-50022069 GATAGTAAGTGGTTGGATTCAGG + Intergenic
1083557890 11:63646757-63646779 AATAGTGAGTGGCTGGATTCTGG - Intronic
1086351707 11:85948948-85948970 CATTCCAAGCAGCAGGATTCAGG - Intergenic
1087254319 11:95937440-95937462 TTTACTAACTAGCTGGATACAGG - Intergenic
1087699030 11:101414378-101414400 CATATAAAGTAGTTGGATGCAGG + Intergenic
1087850075 11:103018011-103018033 CATCCTGAGTAGCTGGAATTAGG + Intergenic
1090330494 11:125927624-125927646 CACACTAAGGAGCTGGAGTGAGG - Intergenic
1090925176 11:131243230-131243252 CATCCTTAGTTGCTGGATTTTGG + Intergenic
1097830511 12:64219679-64219701 TATACTAAGTAGCTTGATTGTGG + Intronic
1100022593 12:90088593-90088615 CATACTAAGCAGCAGCATTCTGG - Intergenic
1103394676 12:120598473-120598495 CCTCCTGAGTAGCTGGATTCAGG - Intergenic
1108101888 13:46965702-46965724 CATACTCAGTAACTGAAATCAGG + Intergenic
1109643618 13:65223565-65223587 CATACTAAGATCCTGGACTCAGG - Intergenic
1112382635 13:98906801-98906823 AATACTAAGAAACTGGGTTCTGG + Intronic
1112555336 13:100462886-100462908 TATACGAAGTAGAGGGATTCTGG + Intronic
1113030842 13:105992060-105992082 CATTGTGAGCAGCTGGATTCAGG - Intergenic
1113094942 13:106653557-106653579 AATACTAAGTGGGTGGATTTGGG + Intergenic
1116998655 14:51350305-51350327 CATAGCAGGAAGCTGGATTCAGG - Intergenic
1117237018 14:53788753-53788775 CATACTAAGTCAATGGATGCTGG + Intergenic
1118212486 14:63778400-63778422 CATGCTAATTAGCTTGATTGTGG + Intergenic
1125374560 15:39014760-39014782 TTTACTAAGTAGCTGGATATAGG - Intergenic
1125771519 15:42170379-42170401 CCTCCCAAGTAGCTGGATACAGG - Intronic
1127069047 15:55270406-55270428 GAGACTAATTAGCTGGATTGTGG - Intronic
1129704162 15:77785077-77785099 CATTCTAAGGAGCTGGAAACTGG - Intronic
1143074300 17:4327348-4327370 CCTCCCAAGTAGCTGGATTAGGG - Intronic
1143854570 17:9839239-9839261 CATGCTAAGGGTCTGGATTCTGG + Intronic
1151510476 17:74556239-74556261 CACACTCTGTAGCTGGATGCTGG + Intergenic
1156141141 18:34112897-34112919 CATGCTAATTAGCTTGATTGCGG + Intronic
1156726196 18:40130452-40130474 TATACTAAGTACCTGGGTTGGGG + Intergenic
1157681671 18:49612426-49612448 CATATTAAATAGCTTGATTGTGG - Intergenic
1162813043 19:13176188-13176210 CCTCCCAAGTAGCTGGACTCAGG + Intergenic
1162857039 19:13476759-13476781 AATAATGAGTGGCTGGATTCTGG - Intronic
1164462671 19:28462369-28462391 CCTCCTGAGTAGCTGGATTACGG - Intergenic
1165137630 19:33679926-33679948 CTTACTCAGTAGCTGGATGTGGG - Intronic
1165234335 19:34408450-34408472 CCTCCTGAGTAGCTGGATTACGG + Intronic
1165502977 19:36204864-36204886 CCTCCCAAGTAGCTGGATACCGG - Intronic
1167516268 19:49924791-49924813 CAGACTTAGCAGCTGGACTCAGG - Intronic
1167580841 19:50341545-50341567 CCTGCCAAGTAGCTGGAATCAGG + Intronic
928030054 2:27770440-27770462 GGTACTCAGTAGCTGGAGTCCGG + Intergenic
929344348 2:40862926-40862948 CATCCTCAGTACATGGATTCAGG + Intergenic
931897818 2:66752671-66752693 GATACTAAGTGCCTTGATTCTGG + Intergenic
932392496 2:71408536-71408558 GATTCAAAGTAGCTGCATTCTGG - Intronic
938111503 2:128569435-128569457 TATACTAATTAGCTTGATTGTGG - Intergenic
938644280 2:133315260-133315282 CATGCTAAGTTGTTGGATTCAGG + Intronic
938831191 2:135051784-135051806 CATACTAGTTACCTGGTTTCTGG - Intergenic
940850073 2:158679578-158679600 CTTACTAAGTAGGGGGATTTGGG + Intronic
942777077 2:179594926-179594948 CATTCTGAGTAGCTGGGTACAGG + Intronic
945374206 2:209060262-209060284 CATAATAAATAGCTTGTTTCTGG + Intergenic
948368133 2:237471927-237471949 CATCCTCAGGAGCTGGCTTCAGG - Intergenic
948416516 2:237810132-237810154 CATACTAAGTCTCTGAAATCTGG + Intronic
1169121894 20:3101661-3101683 CCTACTGAGTAGCTGGAATTAGG + Intergenic
1170290006 20:14758435-14758457 CATACTAAGTAGCTGGATTCAGG + Intronic
1175313036 20:58024991-58025013 CACATTAGGTGGCTGGATTCTGG + Intergenic
1175477869 20:59289535-59289557 CAAATTAAGTACCTGGACTCGGG - Intergenic
1176123486 20:63464707-63464729 CACACTGAGTGGCTGGATTCTGG - Intronic
1178370602 21:32023901-32023923 CAAACTAAGTAGTCAGATTCTGG + Intronic
1178507622 21:33175780-33175802 TATGCTAATTAGCTGGATTGTGG + Intergenic
949441051 3:4080859-4080881 CATATTAAGAATCTGGACTCAGG + Intronic
953992716 3:47496615-47496637 CCTCCCAAGTAGCTGGATTATGG + Intronic
960264591 3:115605916-115605938 CTTACAAAGTAGATGCATTCAGG - Intergenic
960700153 3:120431405-120431427 CATACTAAGTCTTTGGAATCTGG + Intronic
963545124 3:146647486-146647508 CTCATTAAGTTGCTGGATTCTGG + Intergenic
965438217 3:168678939-168678961 CATCCTATGTAGCTGTATTTGGG + Intergenic
967017225 3:185493281-185493303 CAGACTAAGTAGCTCGCTGCAGG + Intronic
971353302 4:25871895-25871917 CCTACCAAGTAGCTGGATACAGG - Intronic
972504629 4:39708812-39708834 CATAATAAGTAGTTGGTTTTTGG + Intronic
977724461 4:100279244-100279266 CATACGAATTAGCTTGATTGTGG - Intergenic
978261153 4:106760991-106761013 CATACTAAGTCTCTGAAATCTGG + Intergenic
979073142 4:116237331-116237353 CATAAGAAGTAACTGGATTGAGG - Intergenic
988060070 5:26154997-26155019 CATATTAATTAGCTTGATTATGG + Intergenic
990113542 5:52359044-52359066 TATACTAATTAGCTTGATTTTGG - Intergenic
992877801 5:81075171-81075193 CAGTATAAGTAGTTGGATTCTGG + Intronic
994572542 5:101532673-101532695 CATACGAGGTATCTGGTTTCAGG - Intergenic
998759223 5:145413461-145413483 GATACTCAGTAGTGGGATTCTGG - Intergenic
1001395456 5:171416444-171416466 CATTCTTAGTAGCTGGAGTAAGG - Intergenic
1002249716 5:177919911-177919933 TATACTTAGCACCTGGATTCAGG + Intergenic
1004062583 6:12212343-12212365 CCTCCTGAGTAGCTGGATACAGG - Intergenic
1004306060 6:14502829-14502851 CATATTAAGTAGATGGATGGAGG - Intergenic
1004815206 6:19304893-19304915 CATACTAAGTAGCTGCGATAGGG - Intergenic
1007065427 6:38986103-38986125 TATACTCAGGAGCAGGATTCTGG - Intronic
1014930473 6:127329634-127329656 CATACTAAGTCTCTGAAATCTGG - Intronic
1017062686 6:150500110-150500132 CACACAAGTTAGCTGGATTCTGG + Intergenic
1019559027 7:1646785-1646807 CTTACTGAGTCTCTGGATTCTGG + Intergenic
1022753236 7:33254461-33254483 AATATTAATTAGCTTGATTCTGG - Intronic
1023109281 7:36793646-36793668 CATACTGACTAGGGGGATTCAGG + Intergenic
1023301417 7:38776213-38776235 GATTCTAAGTAGCTTGATTATGG - Intronic
1025270158 7:57503721-57503743 TATACTAATTAGTTTGATTCTGG - Intergenic
1028617378 7:92783816-92783838 CATCCTAAATAGCTTGTTTCAGG - Intronic
1033702125 7:143850076-143850098 TATACTCAGTAGTGGGATTCTGG - Intergenic
1034081086 7:148278221-148278243 CATACTTAGGAGGTGGATGCAGG + Intronic
1036424068 8:8627138-8627160 CATACTAAAGAGCTGGTGTCTGG - Intergenic
1041694586 8:60721950-60721972 CATACAAAGTAGTTGGGTTGGGG + Intronic
1046815390 8:118577562-118577584 CACACTAAGGAGCTGGAACCAGG + Intronic
1051223812 9:14877946-14877968 AGTAAGAAGTAGCTGGATTCTGG - Intronic
1061518999 9:131106420-131106442 CATCCTAAGGAGCTGGATAAGGG + Intronic
1189537955 X:41955969-41955991 GAGAAGAAGTAGCTGGATTCTGG - Intergenic
1191634554 X:63361838-63361860 TTTACTAAGTAGCTGGATATAGG + Intergenic
1192087473 X:68114941-68114963 TCTACTAAGAAGCTGGATGCAGG + Intronic
1192789759 X:74369821-74369843 CAGATTAAGTAGCTGGCTTCTGG + Intergenic
1194751546 X:97690444-97690466 CATACTAAGTTTCTGAAATCTGG - Intergenic
1194940440 X:100002925-100002947 TATATTAAGTAGCTTGATTATGG + Intergenic
1196362055 X:114873738-114873760 CATTTTAAGTAGCTTGATTGTGG - Intronic
1199528837 X:148824454-148824476 CATATTAATTAGCTTGATTATGG + Intronic
1201674279 Y:16561775-16561797 CATGCTAATTAGCTTGATGCTGG + Intergenic