ID: 1170291823

View in Genome Browser
Species Human (GRCh38)
Location 20:14778672-14778694
Sequence AGATGCAGTTAAAGTGATTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 250
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 234}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170291818_1170291823 28 Left 1170291818 20:14778621-14778643 CCTTTGCCTTGTTGGAATCACAT 0: 1
1: 0
2: 1
3: 7
4: 138
Right 1170291823 20:14778672-14778694 AGATGCAGTTAAAGTGATTTGGG 0: 1
1: 0
2: 0
3: 15
4: 234
1170291821_1170291823 0 Left 1170291821 20:14778649-14778671 CCATCAAATTATATTGCTTCTCA 0: 1
1: 0
2: 2
3: 35
4: 344
Right 1170291823 20:14778672-14778694 AGATGCAGTTAAAGTGATTTGGG 0: 1
1: 0
2: 0
3: 15
4: 234
1170291820_1170291823 22 Left 1170291820 20:14778627-14778649 CCTTGTTGGAATCACATCGGAGC 0: 1
1: 0
2: 0
3: 3
4: 58
Right 1170291823 20:14778672-14778694 AGATGCAGTTAAAGTGATTTGGG 0: 1
1: 0
2: 0
3: 15
4: 234

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170291823 Original CRISPR AGATGCAGTTAAAGTGATTT GGG Intronic
904140250 1:28347457-28347479 AGAAGCAGTTAAATAAATTTTGG + Intergenic
904329689 1:29750400-29750422 ACATGCACTGAAAGTGATATAGG - Intergenic
904635341 1:31876455-31876477 TAATGAAGTTAAAGTGTTTTGGG + Intergenic
907693730 1:56699235-56699257 AGCTGCACTTAAAGAAATTTGGG + Intronic
909191643 1:72559813-72559835 TGATGCAGTTTTCGTGATTTAGG + Intergenic
909238837 1:73185533-73185555 GGATTCAGTTTAAGTGATTATGG - Intergenic
909417264 1:75420805-75420827 AGATGAAAGTAAAGTAATTTTGG - Intronic
910791953 1:91060582-91060604 AGGTCCAGTGAAACTGATTTTGG + Intergenic
913167806 1:116204904-116204926 AGCAGAAGTTAAAGTGAATTTGG + Intergenic
914388260 1:147193359-147193381 AGATGCAGTAAAAATGATAAAGG - Intronic
916036993 1:160931137-160931159 AAATGCAGTTATAGTGGATTAGG - Intergenic
916653778 1:166854602-166854624 AGATGCAGTGTAAGTAATATTGG + Intronic
917247967 1:173024915-173024937 AGATGCAGTTAAAGCCAGTATGG - Intergenic
917265756 1:173218932-173218954 TGATGCAGCTAAAGTTCTTTTGG - Intergenic
917399036 1:174625661-174625683 AGAAGCATCTAAAGTGATTGAGG + Intronic
919104455 1:193131603-193131625 AGATGGAGTCACAGAGATTTAGG - Intronic
919184277 1:194124268-194124290 AGATGGAATAAAAGTGATATTGG + Intergenic
919300158 1:195752026-195752048 AGATGAAGTGAATGTGATCTTGG - Intergenic
921954574 1:220968570-220968592 AGAGACAGTTAAAGGGACTTAGG - Intergenic
921995922 1:221418271-221418293 AACTGCTGTTAAAGTGGTTTGGG + Intergenic
922326549 1:224533767-224533789 AGATGCGGTTAGACTGAATTGGG - Intronic
1063519921 10:6732044-6732066 AGATGGAGATAAAGAGATGTTGG - Intergenic
1064497528 10:15928725-15928747 AGATGTAGTTACTGTGACTTGGG + Intergenic
1066515009 10:36148920-36148942 AAATGCAGAGAATGTGATTTTGG - Intergenic
1068106022 10:52617796-52617818 AGATTCAGTTAAATTGATTGAGG - Intergenic
1068958132 10:62839476-62839498 ATAATCAGTTAAAGAGATTTAGG + Intronic
1069765455 10:70853955-70853977 TGCTGCAGTAAAAGTGATTCTGG - Intronic
1069811504 10:71163361-71163383 AGATGCAGTTAAGGGTTTTTAGG + Intergenic
1071181921 10:82996339-82996361 AGTTTCAGTTAAAGTAAATTTGG + Intergenic
1071195340 10:83153222-83153244 AGATGCAGTGAAAATGATATGGG + Intergenic
1073166386 10:101456692-101456714 AGATACAGTAACAGAGATTTGGG - Intronic
1073450134 10:103604245-103604267 AGATGCAGATGAAGTGACCTGGG + Intronic
1074402079 10:113150220-113150242 ATATGAAGTAAAAGTGATATAGG + Intronic
1078376911 11:10803020-10803042 AGATGCAGTAAAAGTAAGATTGG - Exonic
1078844074 11:15106284-15106306 AGAAGCAATTAAAGAGTTTTAGG + Intergenic
1080362650 11:31533787-31533809 AGAGACAGTTACAGTCATTTAGG + Intronic
1080939129 11:36894985-36895007 AGAGTCAGTTAATGTGTTTTGGG - Intergenic
1081089209 11:38841702-38841724 ACCTACAGGTAAAGTGATTTGGG - Intergenic
1082181477 11:49125493-49125515 ACATGCAGGTAAAATGTTTTTGG - Intergenic
1082792564 11:57356845-57356867 TGATGCAATTAGAGTGATCTTGG + Intronic
1086684016 11:89709351-89709373 ACATGCAGGTAAAATGTTTTTGG + Intergenic
1087755690 11:102052728-102052750 AGATGGATTTAATGTTATTTAGG - Intronic
1088663381 11:112070801-112070823 AGCTGCAGTTAAATTAGTTTGGG + Intronic
1088784470 11:113168311-113168333 AAAAGCAGTAAAAGTGAATTGGG - Intronic
1089175170 11:116543487-116543509 AGATGCAGGGAAAGTGGTGTAGG + Intergenic
1089703588 11:120260628-120260650 AGCTGCAGTTGGAGGGATTTGGG - Intronic
1090111013 11:123909135-123909157 TGATGCTGTTAAACTTATTTTGG + Intergenic
1090686319 11:129125590-129125612 ATAAGCAGTTAAAGTAAGTTGGG + Intronic
1091233637 11:134004363-134004385 TGTTGCTTTTAAAGTGATTTTGG + Intergenic
1091519554 12:1223224-1223246 AGATTCAGTTAAAGTGGTATGGG + Intronic
1091833160 12:3564700-3564722 TGATGCAGTTTTAGTGACTTGGG + Intronic
1091869489 12:3876202-3876224 AGTAGCAGTTTAAGTAATTTAGG + Intergenic
1093911619 12:24754271-24754293 TGATGCAGTTTAAGTGATGAAGG - Intergenic
1095795028 12:46209837-46209859 AAGTGCAGTTAAAATGATGTGGG + Intronic
1096160070 12:49368661-49368683 AGTTTCAATTAAGGTGATTTGGG + Intronic
1098968233 12:76818528-76818550 ACATCCAGTGAGAGTGATTTGGG + Intronic
1099146234 12:79046195-79046217 AGATGCAGTAAATGAGGTTTTGG + Intronic
1100623932 12:96309395-96309417 AGATACATATAAAGTGCTTTGGG - Intronic
1101991726 12:109491088-109491110 AGCTGCTGTTAAAGTGCCTTTGG - Exonic
1104021523 12:124995085-124995107 ACATGCAGTCAATCTGATTTCGG - Intronic
1104693274 12:130842593-130842615 ATATGCAGTCAAGGTGTTTTTGG + Intergenic
1106131229 13:26941104-26941126 GGATGCACTTGAAGTAATTTGGG + Intergenic
1106851032 13:33792189-33792211 ACAAGAATTTAAAGTGATTTAGG - Intergenic
1107224896 13:38036846-38036868 AGGAGGAGTTAGAGTGATTTCGG - Intergenic
1107653958 13:42573621-42573643 AGATGCAGAAATAGGGATTTGGG + Intronic
1109489532 13:63077701-63077723 GGGTGCTGATAAAGTGATTTGGG - Intergenic
1109810099 13:67501841-67501863 AAATGCAGGTAGTGTGATTTTGG + Intergenic
1110177858 13:72579046-72579068 AGAAGCAGATAAAGTGATCAAGG - Intergenic
1111918903 13:94390273-94390295 AAATGCAGTTAGAGTGCTTTGGG - Intronic
1112901887 13:104366734-104366756 AGAGACAGTTACAGAGATTTGGG + Intergenic
1114936012 14:27537568-27537590 AGAGACAGGTAATGTGATTTAGG + Intergenic
1115360756 14:32498820-32498842 AAATGAAGTTAAATTGTTTTTGG - Intronic
1116387121 14:44345475-44345497 AGATGCTGGTCACGTGATTTTGG - Intergenic
1116660773 14:47707916-47707938 AGATTCAGATGATGTGATTTGGG + Intergenic
1120255782 14:82117659-82117681 AGATCCTACTAAAGTGATTTTGG + Intergenic
1120492764 14:85197480-85197502 AGAAGCAGTTTAAGTGACTTCGG - Intergenic
1120764559 14:88316612-88316634 AGATGAGGTTAGAGTGAGTTAGG - Intronic
1123172949 14:106391134-106391156 GGATGCATGTAAGGTGATTTGGG - Intergenic
1126413797 15:48397568-48397590 AGATGGAGTTATAGTGATCAAGG - Intergenic
1126664231 15:51061601-51061623 ACATGAAGTTAAAGTGCTGTGGG - Intronic
1127842661 15:62844427-62844449 AGATGCAGACAAAGTGACTCAGG - Exonic
1128510085 15:68308036-68308058 AGATGCAGAAAAAGTATTTTAGG + Intronic
1128788731 15:70416977-70416999 AGAGGCAGTTAATGTGATCGTGG + Intergenic
1133483582 16:6195854-6195876 AGATTGAGTTTATGTGATTTAGG + Intronic
1139026622 16:62825489-62825511 GGATGCAGTTAAAGTGAATAAGG - Intergenic
1141359120 16:83378168-83378190 AGATGCTGTGCAAGTGCTTTCGG + Intronic
1142114775 16:88350921-88350943 GGAAGCAGTGAGAGTGATTTTGG + Intergenic
1143310021 17:5980145-5980167 AGATACAATTAAATTGATATAGG + Intronic
1143883888 17:10051881-10051903 AAAGGCAGTGAATGTGATTTGGG - Intronic
1144088777 17:11834697-11834719 AGATGCAGACAAACTGATTCAGG + Exonic
1146253830 17:31376855-31376877 AGATGCAGTTCAGTAGATTTGGG + Exonic
1147650157 17:42057470-42057492 AGAATCACTTAAAGTTATTTAGG + Intronic
1148792546 17:50181607-50181629 AGATGCAGTTAGTGTGACTGAGG - Intergenic
1149129180 17:53275631-53275653 TCATGCACTTAAAGTGAGTTTGG - Intergenic
1155005915 18:21729046-21729068 AGATGCAGTTGAAATGATTGGGG - Intronic
1156218418 18:35026673-35026695 AGATGCAGGTAAACTGTTTAGGG - Intronic
1156432918 18:37094912-37094934 AGAGGCAGTTATAGTTATATTGG + Intronic
1157441109 18:47712414-47712436 AGATGCTTTTAAAGTCCTTTTGG + Intergenic
1160915225 19:1493178-1493200 AGCTGCAGGAAAAGGGATTTAGG + Intronic
1163831428 19:19548917-19548939 AAATGCCCTTAAAGTGAGTTAGG - Intergenic
1164626224 19:29730140-29730162 AGATGCACTGAAATTGATTGTGG + Intergenic
925504769 2:4549715-4549737 AGAGGCAGTTCAAATGAATTTGG + Intergenic
926462815 2:13154147-13154169 AGATGCAGATAATTTGCTTTTGG - Intergenic
926666385 2:15528282-15528304 GGATGCAGATACAGTGATGTGGG - Intronic
927445017 2:23152060-23152082 AGATCCTGTAATAGTGATTTTGG - Intergenic
928563740 2:32520185-32520207 AGAGAGAGTTAAAGAGATTTGGG + Intronic
930589673 2:53312387-53312409 AGATGCTGTTCTAGTCATTTGGG - Intergenic
931295578 2:60921534-60921556 AAATACAGGTAAAATGATTTTGG - Intronic
932057246 2:68458546-68458568 AGATGAAGTTAAAGTGGTCAGGG + Intergenic
933227761 2:79770375-79770397 TGATGCACTTCCAGTGATTTTGG - Intronic
935644927 2:105326904-105326926 TGAGGCACTTAAAGTCATTTGGG + Intronic
935748970 2:106213654-106213676 TGAAGCAGTTAAAATGATATAGG + Intergenic
936618303 2:114070640-114070662 GGATGCAGTTATACTGTTTTGGG + Intergenic
937826083 2:126369901-126369923 AAATGCAGTCAAAGAAATTTGGG + Intergenic
940482201 2:154248233-154248255 AGATGTAGTATAACTGATTTAGG - Intronic
940512253 2:154631415-154631437 AAATGCAGTCAATGTGAATTGGG - Intergenic
940519396 2:154724420-154724442 AAATGCATTTAAACTGATTCAGG + Intronic
944866127 2:203864110-203864132 AGATTCAGTTAAAACAATTTTGG + Intergenic
945946497 2:216000492-216000514 AGGTGCAGTTATTGTGATGTTGG - Intronic
946055576 2:216898611-216898633 AGATGCAGTGACAGTTATTGGGG + Intergenic
946104674 2:217358730-217358752 AGGTTCAGATAAAGTGCTTTGGG - Intronic
947145532 2:227060643-227060665 AGATGCAGGGAAATAGATTTTGG - Intronic
1169872857 20:10265809-10265831 ATATGGAGATAATGTGATTTAGG + Intronic
1170291823 20:14778672-14778694 AGATGCAGTTAAAGTGATTTGGG + Intronic
1172666128 20:36601568-36601590 AAAGGCTGTTAAAGTCATTTAGG - Intronic
1175590541 20:60187412-60187434 AAATGAAGTTAAAGTGTTCTAGG - Intergenic
1181426959 22:22849953-22849975 AGAAGCAGATAAAGTGAGCTGGG + Intronic
1182113286 22:27739609-27739631 AGATGCATTCTAAGTGCTTTGGG - Intergenic
949540716 3:5030085-5030107 AGATGCAGTTACAAAGAGTTTGG - Intergenic
949969126 3:9387634-9387656 AGATACTAGTAAAGTGATTTGGG - Intergenic
951657210 3:25022996-25023018 TGCAGCAGCTAAAGTGATTTGGG - Intergenic
951715521 3:25640470-25640492 AGAAGCAGTTAAAATGAGGTGGG + Intronic
951834809 3:26971190-26971212 ACATGCATTTAAATAGATTTTGG + Intergenic
952230773 3:31428066-31428088 ATTTACATTTAAAGTGATTTTGG + Intergenic
956378539 3:68641451-68641473 AGATTCTGATAAAATGATTTGGG - Intergenic
957234995 3:77575845-77575867 AACTGCAGTGAAATTGATTTTGG - Intronic
957245148 3:77706891-77706913 AGATGAAGTTACAGAGATGTGGG + Intergenic
961105365 3:124236201-124236223 AGCTTCAGTAAAAGGGATTTGGG + Intronic
962867658 3:139460974-139460996 ATATGCAGTCCAAGAGATTTGGG - Intronic
964758007 3:160106155-160106177 AGAGGAAGTTAAAGTGATGTGGG - Intergenic
965667180 3:171107740-171107762 AGTAGCAGTTAAAGAGACTTGGG - Intronic
965867273 3:173219912-173219934 GGATGCAGTTAAAGTGTTAAAGG - Intergenic
966123694 3:176550666-176550688 AAATACAGTTAAAGTCATATAGG + Intergenic
969184855 4:5467503-5467525 AGATGAAGTCACAGTGAATTAGG - Intronic
970342960 4:15126228-15126250 AGATGCAGTCATAGTGGGTTAGG + Intergenic
970852152 4:20615375-20615397 ACATGCAGCTCAGGTGATTTGGG - Intronic
971222749 4:24723782-24723804 ATATACAGTTGAAGAGATTTGGG + Intergenic
971615810 4:28789161-28789183 AGGTGCAGTTATAGGGATGTGGG - Intergenic
971872070 4:32254287-32254309 AGATGAGGTTAAAATAATTTTGG - Intergenic
972047304 4:34682683-34682705 AGATACATTTAAATTCATTTAGG - Intergenic
972408912 4:38772367-38772389 AGATGTAGTAACAGTGGTTTGGG - Exonic
974196959 4:58587530-58587552 AGATACTTTTAAAGTTATTTAGG + Intergenic
974723739 4:65773643-65773665 ACATGCTGGTAAAGTGATGTGGG + Intergenic
975193616 4:71496291-71496313 AGATTCAGATATAGGGATTTGGG + Intronic
976371558 4:84294553-84294575 AGATCCAGTTAAATTGGATTAGG + Intergenic
976645503 4:87383383-87383405 AGAGGCAGTTACAGTGATTCAGG + Intronic
976909402 4:90282133-90282155 AGATGCAATTAAGCTGATTCAGG - Intronic
977330503 4:95631305-95631327 AGATGCAGTGAAAAATATTTTGG + Intergenic
978638313 4:110838263-110838285 AGATGCAGTTACAAAGCTTTTGG + Intergenic
979131950 4:117058073-117058095 AGATTCAGTTAAATTCATTTTGG - Intergenic
979501289 4:121443391-121443413 AGATGCAATAAAAATGATATAGG + Intergenic
979807011 4:124986532-124986554 ATATGCAGTAAAAGTAATTCAGG - Intergenic
981201903 4:141989867-141989889 AGATGCAATAAAAATGATATAGG - Intergenic
982138078 4:152291662-152291684 AGACGCTGTTTAAGAGATTTAGG + Intergenic
982748541 4:159131625-159131647 AAGTGCAGTTAAAGTTCTTTGGG + Intronic
982995080 4:162333600-162333622 AGCTGCCATTCAAGTGATTTGGG - Intergenic
983276621 4:165625399-165625421 ATCAGAAGTTAAAGTGATTTAGG + Intergenic
983617656 4:169725647-169725669 GGATTCTGTTAAAGTTATTTTGG + Intergenic
984331377 4:178324455-178324477 GAATGCAGTGGAAGTGATTTTGG + Intergenic
985078265 4:186240245-186240267 TGATGTAGTTACAGTGATATAGG + Intronic
986660919 5:10059187-10059209 AGATAGAGTGAAAGTGTTTTGGG - Intergenic
987457339 5:18163710-18163732 AGATACAGTTCAAGAGCTTTGGG + Intergenic
987884927 5:23800693-23800715 ACATGGAGTCAAAGTCATTTTGG + Intergenic
988736247 5:34024246-34024268 AGATACAGTTAAAATGAGGTAGG - Intronic
989306002 5:39956736-39956758 AGCTGCAATTCAAGAGATTTTGG - Intergenic
989843720 5:46112716-46112738 AGAGGCAGTTAAAGTCATCTAGG + Intergenic
989996790 5:50843788-50843810 AAACACAGTTGAAGTGATTTGGG - Exonic
993129895 5:83883205-83883227 AGATGCTGTTTAAGTCAATTTGG - Intergenic
994402201 5:99295398-99295420 AGATGCATTTAATGAGGTTTTGG + Intergenic
994478941 5:100308591-100308613 AAATGCAGATAAAGTTATTCTGG + Intergenic
995299593 5:110563035-110563057 AAAAGCAGTTATATTGATTTAGG - Intronic
996129801 5:119768664-119768686 AGATGCTGTTAAAGAGATGATGG + Intergenic
996591744 5:125155624-125155646 AGCTGCATTTCAAGAGATTTGGG + Intergenic
997041194 5:130256678-130256700 AAATGCAGGGAAAATGATTTAGG - Intergenic
999035088 5:148339728-148339750 AGATGCATTAAAAGATATTTTGG - Exonic
1000466550 5:161585624-161585646 AGTTGGAGATAAAGTGAATTAGG - Intronic
1000658786 5:163914751-163914773 AGATAGAGTTAACATGATTTAGG + Intergenic
1001270598 5:170308513-170308535 AAATGCTTTCAAAGTGATTTTGG - Intergenic
1002165471 5:177341811-177341833 AAATGGAGTTAAAGTGTGTTAGG + Intronic
1005075979 6:21908038-21908060 ATATGCAGTCAAAGAGCTTTTGG + Intergenic
1008477711 6:51950023-51950045 AAATACCGTTAAAGTGATTCTGG - Intronic
1008551391 6:52635368-52635390 AAATCTAGTTAAAGTTATTTAGG - Intergenic
1009376809 6:62981162-62981184 AGATACAGTTAAAGTTGCTTGGG - Intergenic
1009604877 6:65854686-65854708 AGACACAGCTAAAGTGACTTGGG + Intergenic
1009811468 6:68673005-68673027 AGATTCAGTTTAAGGAATTTTGG - Intronic
1009939955 6:70280284-70280306 AGATGCACTTGAAGTGAGTGGGG - Intronic
1010068590 6:71715680-71715702 ATATGCAGTAACATTGATTTTGG + Intergenic
1011001266 6:82590856-82590878 AGATTCAGTTAATGGGGTTTGGG + Intergenic
1011021107 6:82813638-82813660 AAATGGATTTGAAGTGATTTGGG + Intergenic
1011896561 6:92234462-92234484 AGTTTCAGCTAAAGTGATTAGGG - Intergenic
1011936607 6:92786586-92786608 AGATGAAGTTATACTGAATTAGG + Intergenic
1015272426 6:131350902-131350924 AGATGCAGTTAAAATAATGCAGG + Intergenic
1015327817 6:131943829-131943851 AAAAGCAGTTAAATTGTTTTTGG + Intergenic
1015364458 6:132381865-132381887 AGATGTAGTGAAAATGATGTAGG - Intronic
1015699824 6:136023469-136023491 TGATACAGTTAATGTGATATGGG - Intronic
1015710428 6:136133381-136133403 AGATGCACTTATAATCATTTAGG + Intronic
1015799667 6:137047270-137047292 AGATGCAGTGAAGCTGATTCTGG - Intergenic
1020768086 7:12351335-12351357 AGCATCATTTAAAGTGATTTCGG - Intronic
1021827279 7:24567968-24567990 AGATGCAATTAAAGTGCTACAGG + Intergenic
1021935499 7:25626923-25626945 ATATGAAGTCATAGTGATTTTGG + Intergenic
1022249838 7:28596220-28596242 ATATTTAGTAAAAGTGATTTGGG - Intronic
1023212761 7:37825561-37825583 AGATGGAGATAAAGGGATTTTGG - Intronic
1025778847 7:64581665-64581687 AGATGCAGTTAAAGTTAAAATGG + Intergenic
1025815442 7:64906728-64906750 AGATGCAGTTAAAGTTAAGATGG + Intronic
1026331846 7:69358934-69358956 ATATGCAGTTACAGACATTTAGG + Intergenic
1026332047 7:69360642-69360664 ATATGCAGTTACAGACATTTAGG - Intergenic
1028076520 7:86523356-86523378 AAATGTAATTAGAGTGATTTTGG - Intergenic
1029945645 7:104529885-104529907 AGATGCAGGTAAAATGAGTCAGG + Intronic
1030148041 7:106376294-106376316 AAATGTAGTTAATGTGATTATGG + Intergenic
1031679814 7:124658249-124658271 AAATACAGTTAACGAGATTTGGG - Intergenic
1031698550 7:124893186-124893208 AAATGCAATTTAAGAGATTTTGG + Intronic
1031701114 7:124928194-124928216 AGAGGCAATTACAGTAATTTAGG - Intronic
1033793429 7:144819273-144819295 AGATGTAGTTGTAGTGGTTTGGG - Intronic
1033971208 7:147041883-147041905 AGATTTAATTCAAGTGATTTTGG + Intronic
1036987344 8:13549929-13549951 AGAAACAGTTAAATTCATTTAGG + Intergenic
1037248212 8:16861620-16861642 AAAAGCAGATAAAGAGATTTGGG - Intergenic
1038548654 8:28446150-28446172 AAATGCATTTAAAGTAACTTTGG - Intronic
1039564842 8:38543982-38544004 AGATATAATTAAAGTGATATTGG + Intergenic
1040025366 8:42776951-42776973 AGAGGCAGTTAAACTAATTATGG + Intronic
1041723682 8:60998823-60998845 AGTTGCAGGTAAAGTGGCTTGGG + Intergenic
1042150245 8:65774545-65774567 ATATAAAGTTAAAGTTATTTGGG - Intronic
1042457835 8:69025957-69025979 ACATGCAGCCAAAGTGTTTTAGG - Intergenic
1045740275 8:105350263-105350285 AGAGTCTGTTAAAGTGATTCAGG + Intronic
1050609704 9:7338912-7338934 ACATGCAGTTTAAGTTTTTTAGG + Intergenic
1051808159 9:21020088-21020110 AGAAACAGTTTATGTGATTTGGG + Intronic
1052706635 9:32001217-32001239 AGATGGAGTTAAAGTGAATAAGG + Intergenic
1055503576 9:76925933-76925955 ACATTTAGTTAAAGTGATTTGGG + Intergenic
1059204743 9:112453883-112453905 TAATGCATTTAAAGTCATTTTGG + Intronic
1061686154 9:132281009-132281031 ACATGAAGTTAAATTAATTTTGG - Intronic
1187992840 X:24894714-24894736 AGACGAAGTTACAGTGAATTAGG - Intronic
1189064705 X:37795079-37795101 AGATACAGTAAAAGTGATCCAGG - Intronic
1189150416 X:38700612-38700634 AGTCTCAGTTAAAGTGACTTTGG - Intergenic
1190284048 X:48950471-48950493 GGATGCAGTGAAACTGATTGTGG + Intronic
1192117902 X:68429118-68429140 AGACGAAGTAAAAGTGATTTGGG + Intronic
1192563924 X:72146867-72146889 GGATGCAGTTCATGGGATTTGGG - Intergenic
1192957335 X:76086354-76086376 AGATGCAATAAAAATGATATAGG - Intergenic
1194789934 X:98135372-98135394 AGATGCAGATAAAATATTTTGGG + Intergenic
1197112509 X:122793276-122793298 TGATGAAGTTAAAGTGCTTGAGG - Intergenic
1197570684 X:128147181-128147203 ACATGCAGGCAAAGTGATGTGGG - Intergenic
1198194706 X:134348495-134348517 AAATGAAGTTAAAGAGCTTTTGG + Intergenic