ID: 1170293314

View in Genome Browser
Species Human (GRCh38)
Location 20:14795368-14795390
Sequence ACTTCAGAAGTGAATCTTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170293311_1170293314 18 Left 1170293311 20:14795327-14795349 CCAGGATCTAGGGAAGAGATAAA No data
Right 1170293314 20:14795368-14795390 ACTTCAGAAGTGAATCTTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170293314 Original CRISPR ACTTCAGAAGTGAATCTTGA AGG Intronic