ID: 1170293314

View in Genome Browser
Species Human (GRCh38)
Location 20:14795368-14795390
Sequence ACTTCAGAAGTGAATCTTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 1, 2: 1, 3: 18, 4: 189}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170293311_1170293314 18 Left 1170293311 20:14795327-14795349 CCAGGATCTAGGGAAGAGATAAA 0: 1
1: 0
2: 0
3: 12
4: 247
Right 1170293314 20:14795368-14795390 ACTTCAGAAGTGAATCTTGAAGG 0: 1
1: 1
2: 1
3: 18
4: 189

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170293314 Original CRISPR ACTTCAGAAGTGAATCTTGA AGG Intronic
901478414 1:9506673-9506695 GTTTCAGAAGTGAATCGAGAGGG - Intergenic
902042479 1:13502846-13502868 ACATCAGAAGTGAAAGTTGAAGG - Intronic
903131349 1:21281332-21281354 TTTTCAGAAGAGATTCTTGAGGG - Intronic
904086438 1:27912701-27912723 ACTTCAGGAAAGCATCTTGAAGG - Intronic
905429957 1:37914633-37914655 ACTCCTGAACTGAGTCTTGAAGG - Intronic
905500912 1:38435571-38435593 ACATTTGAACTGAATCTTGAGGG + Intergenic
905631722 1:39522529-39522551 AGATCAGAAGTGAATCTGCAGGG + Intronic
905666032 1:39763643-39763665 AGATCAGAAGTGAATCTGCAGGG - Intronic
906023151 1:42649085-42649107 ACTTCAGGAGTGAATCCAGCAGG - Intronic
906911392 1:49955239-49955261 ACTTCTGTGGTGAATCTAGATGG - Intronic
907881602 1:58554605-58554627 TGTTCAGAAGTTCATCTTGAAGG - Intergenic
908416088 1:63914718-63914740 ACTTCTGAACTGGTTCTTGAAGG - Intronic
909459935 1:75899494-75899516 AGTTCAGAAGTGCCTCTAGAAGG + Intronic
911127865 1:94357932-94357954 ACTGCAGAGGTGAATACTGATGG - Intergenic
911495430 1:98625301-98625323 ACTTCTTAAGAGAATCTTGATGG - Intergenic
912105811 1:106273139-106273161 ACTTAACAAGTGAATGTTGAGGG - Intergenic
912772851 1:112480714-112480736 ACTTCAGAAGTTATTCTGCAAGG + Intronic
914410504 1:147422753-147422775 ACTTCAGAAATGAATAATGCAGG - Intergenic
915205193 1:154265183-154265205 ACTTCAAAAGTGACTGTTCAAGG + Intronic
915294516 1:154910757-154910779 ACAACAGAGGTGAATCTGGAAGG - Intergenic
916723931 1:167506096-167506118 AATCCAGAAGTGGAACTTGAAGG + Intronic
916739664 1:167637114-167637136 ATTTCTGAGTTGAATCTTGAGGG + Intronic
917202058 1:172527798-172527820 AGTCAAGAAATGAATCTTGAGGG - Intergenic
918465985 1:184822186-184822208 ACTTCAGAGGAGAAGCTTGCAGG - Intronic
924422961 1:243926197-243926219 ATTCCAGGAGTGAATCATGATGG + Intergenic
924835388 1:247641882-247641904 ACTTCTGAAGTTAATTTTAATGG - Intergenic
1063486348 10:6424263-6424285 GTTACAGAAATGAATCTTGAGGG - Intergenic
1063788591 10:9413274-9413296 GCTGCAGAAGGGAATTTTGAAGG + Intergenic
1064577111 10:16757663-16757685 ACTTCAGAAGTGACTGATGAAGG + Intronic
1064785255 10:18887899-18887921 ACTTCAGAGGTGGGGCTTGATGG + Intergenic
1064927159 10:20581975-20581997 ACTTCAGAAGGACAGCTTGACGG + Intergenic
1067012950 10:42731494-42731516 ACTTCAGAAGTGACTGATGAAGG - Intergenic
1067310896 10:45112623-45112645 ATTTCAGAAGTGACTGATGAAGG + Intergenic
1067988071 10:51174835-51174857 ACTTCAAAGGTGAGACTTGAAGG - Intronic
1071152605 10:82652497-82652519 ACTTCAGAGGGAAACCTTGAGGG - Intronic
1071996768 10:91156824-91156846 ACTTCAGAAACAAATCTTGAAGG + Intergenic
1075634013 10:124018160-124018182 CCTCCAGGAATGAATCTTGAGGG - Intronic
1076396855 10:130145298-130145320 CCTTCACAAATGAAACTTGAGGG - Exonic
1078468478 11:11568439-11568461 CCTTAAGAAGTGAATCTTCCCGG + Intronic
1079391085 11:20022894-20022916 ACTTCAGAGGTTAATTTTGTTGG + Intronic
1080993502 11:37571315-37571337 ACTTAAGAGCTGAAACTTGATGG + Intergenic
1082747307 11:56979007-56979029 ACTTCAGAAATTAAGATTGATGG - Intergenic
1086163522 11:83750153-83750175 GCTTCAGATGGGAATCTTGGGGG - Intronic
1086721848 11:90130373-90130395 ACTTCAGAAGAGAATGTGCAGGG + Intergenic
1086874549 11:92079293-92079315 AATTCAGCAGTGAATCTTTCAGG - Intergenic
1086902163 11:92380219-92380241 ACTGCAAATGGGAATCTTGAAGG - Intronic
1088160280 11:106861480-106861502 ATTTCAGAACTGAAAGTTGATGG - Intronic
1091958627 12:4671742-4671764 AGTTCAGAAATAAATCTTTATGG + Intronic
1092879914 12:12880091-12880113 ACTTCAGATGTGAATTTTAGAGG + Intergenic
1093092162 12:14934222-14934244 ACAACAGAATTGAAACTTGAAGG - Intronic
1094413989 12:30199030-30199052 ACTACAGAAGTGCTTCTTTAAGG - Intergenic
1096614992 12:52827161-52827183 ACTTCTGAGTTGGATCTTGATGG - Intronic
1099702645 12:86107023-86107045 TCCACAAAAGTGAATCTTGAGGG - Intronic
1101206708 12:102495693-102495715 ACTTCAGATTTGGATCTTGCAGG + Intergenic
1101624395 12:106424667-106424689 CCTCCAGAAGTGAATAGTGAAGG + Intronic
1103162306 12:118739695-118739717 ACATCTGAACTGAATCTTGGAGG + Intergenic
1106133774 13:26959407-26959429 AGTGCAGAATTGAATGTTGAAGG - Intergenic
1108958478 13:56189752-56189774 ACTTCAGAAGAACAGCTTGATGG + Intergenic
1113036042 13:106050300-106050322 ACCTAAGAACTGAATCTTGTGGG + Intergenic
1118085823 14:62415593-62415615 TCATCAGAAGTAAAACTTGAAGG + Intergenic
1118408533 14:65451782-65451804 ACTTCAGAAGGACAGCTTGATGG - Intronic
1118706833 14:68487865-68487887 ACTTCACATATGAATTTTGAGGG + Intronic
1119409305 14:74419764-74419786 ACTTCTGAACTCAGTCTTGAAGG + Intronic
1119462833 14:74824021-74824043 ACTTCAGAATAGTATCATGAAGG - Intronic
1120652038 14:87146104-87146126 ACTTTTGAAGTGGATCTGGAAGG - Intergenic
1122167970 14:99844664-99844686 ACTGCACAAGGGAATTTTGAAGG - Intronic
1122641682 14:103163703-103163725 ACTTCAGAGGGGCAGCTTGATGG + Intergenic
1123126903 14:105953416-105953438 ACTTCAGAGGTGAGTCAAGATGG + Intergenic
1124072838 15:26411807-26411829 ACCTGAGAGCTGAATCTTGAGGG + Intergenic
1124504917 15:30264375-30264397 AATCAAGAAGTGTATCTTGATGG + Intergenic
1124738635 15:32274260-32274282 AATCAAGAAGTGTATCTTGATGG - Intergenic
1127914756 15:63446260-63446282 AAGTCAGAGATGAATCTTGATGG + Intergenic
1128902569 15:71437966-71437988 GCTTCAGAACTGAACCTTCAGGG + Intronic
1132031334 15:98440580-98440602 ACTGTAGAATAGAATCTTGAGGG - Intronic
1132352261 15:101147268-101147290 AATTCAGAGGTGAATCCAGAGGG + Intergenic
1132508362 16:324093-324115 ATTTCAGATGTGACTCTTGTGGG - Intronic
1138476987 16:57277028-57277050 ACTTAAAAAATGAATCTTGGGGG - Intronic
1139041895 16:63007309-63007331 ACATCAGAAGTGAACCCTAATGG - Intergenic
1140805727 16:78530462-78530484 ACTTCAGAAGAACAGCTTGATGG - Intronic
1143967614 17:10767997-10768019 TCTTCAGGACTGAATCTGGATGG + Intergenic
1147051831 17:37800959-37800981 ACTCCAGAAGGGCATCTGGAGGG + Intergenic
1149083378 17:52684854-52684876 CCTACAAAACTGAATCTTGAGGG + Intergenic
1149974090 17:61248630-61248652 ATTTCAGAAGTGTATCATGGTGG + Intronic
1150716486 17:67576648-67576670 GCTTAAGAAGAGAATTTTGATGG - Intronic
1150938410 17:69662586-69662608 ACTGGAGAAGTGAACCTTAAGGG + Intergenic
1156490421 18:37492694-37492716 ACCTAAGAAGTGAGTCTTAAAGG - Intronic
1156713527 18:39977437-39977459 ACTTCAGAGGGACATCTTGATGG - Intergenic
1156931650 18:42651698-42651720 ATTTCTCAAGTGAATATTGAGGG + Intergenic
1159632543 18:70765572-70765594 ACTTAGGAAGTGAATATTTAGGG + Intergenic
1164614876 19:29661213-29661235 ACTTCAAAAGAGAATCTTGAGGG - Intergenic
924996489 2:366218-366240 ACCCCTGAAGTGAATCCTGATGG + Intergenic
927822481 2:26280505-26280527 ACTTGAGCAGCAAATCTTGAAGG + Intronic
929163527 2:38857694-38857716 AATTCATAAGTGAATCCTGAGGG - Intronic
929723966 2:44403925-44403947 ACATCTGAGTTGAATCTTGAAGG - Intronic
929992908 2:46804451-46804473 ACTTCCAAAGAGAATTTTGAAGG + Intergenic
930200309 2:48546418-48546440 GCTTCAGAGCTAAATCTTGAAGG - Intronic
930842169 2:55859610-55859632 CCTTCAAAAGTGAATGTTCAGGG - Intergenic
931462936 2:62463909-62463931 ACTTCAGAGGTGCAGCTTGATGG + Intergenic
933165453 2:79070147-79070169 ACTTCAGAGGGGCAGCTTGATGG + Intergenic
933296901 2:80501578-80501600 ACTTCATAAGAGAATTTTAAAGG - Intronic
936024974 2:109024556-109024578 TCTTCAGAGGTGAAGCTTGAAGG - Intergenic
936481022 2:112884897-112884919 ACTTCAGAAGAAAACCTTCATGG - Intergenic
936856087 2:116958800-116958822 AATTAAGATGTGAATCTTTAGGG + Intergenic
939596785 2:144135224-144135246 CCTTCAGTAGAGAATCTTGTAGG + Intronic
940824586 2:158396459-158396481 AGTTCAGAAGTGAAAGTTGGTGG - Intronic
942813998 2:180030117-180030139 ACTTCAGCAGTGAAGCTGTAGGG + Intergenic
943957629 2:194213076-194213098 ACTGGTGTAGTGAATCTTGATGG + Intergenic
944001370 2:194842591-194842613 ACTTCAGAGGTACAGCTTGATGG + Intergenic
946243666 2:218372787-218372809 ACACCAGAACTGAATCCTGAAGG + Intergenic
946316716 2:218920434-218920456 ACTTGAGATATGAATCCTGAAGG + Intergenic
946423609 2:219579572-219579594 ACATCAGAATTGGATCTTAAAGG - Intergenic
1168892363 20:1303284-1303306 ACATCTGAAGTGCGTCTTGAAGG - Intronic
1169590733 20:7138981-7139003 TCTTCAGAAATGATTCTCGATGG - Intergenic
1170293314 20:14795368-14795390 ACTTCAGAAGTGAATCTTGAAGG + Intronic
1172273139 20:33665784-33665806 GCTTCAGAACTGAGTCTTGCTGG + Intronic
1173104950 20:40125063-40125085 ACTTCAGATGTGATTCTTACTGG - Intergenic
1173258823 20:41415182-41415204 ACTTCAGGCGGGAATCTTGGTGG - Exonic
1174353601 20:49984244-49984266 GCTTCGGATGTGCATCTTGAGGG - Exonic
1177245458 21:18517207-18517229 ACTTCTTAAGGAAATCTTGAAGG - Intergenic
1178478041 21:32955168-32955190 CCTTCAGAACTCGATCTTGAAGG - Intergenic
1181363481 22:22356674-22356696 AATTCAGTAGTGAGTCTTGTGGG - Intergenic
1183620704 22:38970619-38970641 ACTTGGGAACTGAATCCTGAGGG - Intronic
1183767777 22:39894910-39894932 ACATCTGAATTGAATCTTAAAGG + Intergenic
1184455009 22:44605110-44605132 GCCTCAGAAGTGCATCTTGTGGG - Intergenic
951017226 3:17744033-17744055 ATTTGAGAATGGAATCTTGAGGG - Intronic
951158005 3:19378322-19378344 AAAGCAGAAGTGAATTTTGATGG + Intronic
954791465 3:53136335-53136357 GCTTTTGAAGTGAATCTTGAAGG + Intergenic
956558404 3:70546448-70546470 ACTTTATTAGTGAATCTGGAGGG - Intergenic
956645373 3:71450028-71450050 ACTTCAGAAGGAAATTTTAAAGG - Intronic
957619074 3:82571421-82571443 ACTTCAAATCTGAGTCTTGATGG - Intergenic
960237304 3:115298568-115298590 ACTTTACAAGTGATTTTTGAAGG + Intergenic
960546572 3:118921469-118921491 ACTTCATAAGAGAATAATGATGG + Intronic
961871379 3:129990965-129990987 TCTGAAGAAGTGAATGTTGATGG + Intergenic
963060142 3:141219206-141219228 GCTTCATCAGTGAATATTGATGG - Intergenic
963204924 3:142623384-142623406 ACTACAGATATTAATCTTGATGG - Exonic
963257325 3:143158844-143158866 CCTCAAGAATTGAATCTTGAGGG - Intergenic
964377704 3:156065803-156065825 AATTCAGATGTGAATCTTTCTGG + Intronic
964467373 3:157010371-157010393 CCTTCAGAAATGACCCTTGAAGG + Intronic
965654383 3:170968333-170968355 ACGGTAGAATTGAATCTTGAAGG + Intergenic
965936399 3:174118614-174118636 AATTCTGAAGTTATTCTTGAAGG + Intronic
966675522 3:182583203-182583225 ACATCACAGGTGACTCTTGAAGG - Intergenic
969551393 4:7870357-7870379 ACTTCAGAAGTGAACATTTCAGG + Intronic
970047549 4:11872809-11872831 ATTTTAAAAGTGAATCTTCAAGG + Intergenic
972230267 4:37064310-37064332 AGTTCACACCTGAATCTTGATGG - Intergenic
976478882 4:85515773-85515795 ATTTTAGAGGTGAATCTTTAAGG + Intronic
976683834 4:87788314-87788336 ACTTCAGAACTGAGTCCTGAAGG + Intergenic
977067742 4:92340390-92340412 AGATCAGAATTGAATGTTGATGG - Intronic
978436790 4:108694137-108694159 TCTGCAGAAGTGAGTTTTGAAGG - Intergenic
978453367 4:108861061-108861083 ACTTCAGAAGTTCATATTAAAGG - Intronic
979184355 4:117770404-117770426 ACTTCAGAAAAGAATCTGGCTGG + Intergenic
982038227 4:151368298-151368320 TCTTCATAGGTGAACCTTGAAGG + Intergenic
982503830 4:156193868-156193890 ACTTCAGAAGTGACAATTCAAGG - Intergenic
983613578 4:169677920-169677942 ACTTCAGAAATGTATCAGGAAGG - Intronic
987638849 5:20584920-20584942 ACAACATAAATGAATCTTGAGGG + Intergenic
991667406 5:69012920-69012942 ATTTCAAAAGTGAAAATTGATGG - Intergenic
991928105 5:71725063-71725085 ACATCAGAAGTGATACTTCAGGG - Intergenic
994091739 5:95815681-95815703 ATTTCAGAAGGGAACCGTGATGG - Intronic
994722535 5:103397669-103397691 ACTTCAGAAATGAATAATGATGG - Intergenic
995272962 5:110243542-110243564 ATTGCAGAAGAAAATCTTGAAGG + Intergenic
995452484 5:112317495-112317517 AATACAGCAGTGATTCTTGAAGG + Intronic
995741890 5:115364341-115364363 ACTTCAGAAGGACAGCTTGATGG - Intergenic
995891716 5:116961215-116961237 AATTCAGAAGTGAAGCTTTCGGG - Intergenic
997033820 5:130162781-130162803 CCCTAAGAAGTGAATCTTGAAGG + Intronic
1001963816 5:175896254-175896276 ACTTCAAAGGTGAATCAGGATGG + Intergenic
1002340335 5:178512588-178512610 GATTCTAAAGTGAATCTTGAAGG + Intronic
1003202846 6:3978210-3978232 ACTTCACAAATGAAACTTGAGGG - Intergenic
1003311270 6:4971817-4971839 ACTTCAACAGTGAATTTTGGGGG + Intergenic
1007104066 6:39271347-39271369 GCTTGAGAGCTGAATCTTGAAGG + Intergenic
1008642274 6:53476167-53476189 AGTTCAAAAATGAATTTTGAGGG + Intergenic
1010131361 6:72497474-72497496 ACATTAGAGCTGAATCTTGAAGG - Intergenic
1010940997 6:81917537-81917559 ACTTCAGAAGTAATTCTAGGAGG + Intergenic
1012867114 6:104631915-104631937 CATTCAGAAGAGAATATTGAAGG + Intergenic
1013492355 6:110660687-110660709 ACTTCAGAAGGACAGCTTGATGG - Intronic
1013908191 6:115240886-115240908 ACTTCAGGAGTGAAGCTTTGTGG + Intergenic
1014285581 6:119493791-119493813 AATTTAGAACTGAGTCTTGAAGG - Intergenic
1017155253 6:151317049-151317071 ACTTCAAATGTGAATTTTGTGGG + Intronic
1020345464 7:7157673-7157695 ACTTCAAAAGAGTATCTTTAGGG - Intronic
1021150115 7:17140352-17140374 AATGCAGATGGGAATCTTGAAGG + Intergenic
1021443008 7:20700701-20700723 TCTTGAGAAGTGAGTCTTGGGGG + Intronic
1024449864 7:49527274-49527296 GCTTCAGCAGTGCATTTTGAGGG - Intergenic
1027470094 7:78562900-78562922 AGTTCTAAAGTGAAGCTTGAAGG + Intronic
1027758188 7:82243348-82243370 ACTGCAGAATTGAATTTTAAAGG - Intronic
1028046859 7:86130955-86130977 ACTTCAGAAGGACAGCTTGATGG - Intergenic
1028652185 7:93162088-93162110 ACTTCAGAAGGACAGCTTGATGG - Intergenic
1031451866 7:121931326-121931348 GTTTCAGAAGTGAAACTAGAAGG + Intronic
1031840647 7:126735084-126735106 AGTGCAGAGGAGAATCTTGATGG + Intronic
1031900377 7:127402618-127402640 ACATCTGAGGTGGATCTTGAAGG - Intronic
1032318065 7:130859442-130859464 AATTCAGAAGTGAACCTGGCAGG - Intergenic
1037007002 8:13794545-13794567 ACTTAAGCAGTGAATCTTATTGG - Intergenic
1042454869 8:68989406-68989428 AGTGCAGAGGTGAATCATGAAGG - Intergenic
1044612123 8:94102170-94102192 CCTTCACATCTGAATCTTGAAGG + Intergenic
1045441367 8:102215643-102215665 AATTCAAAAGTTAATCTGGAAGG + Intronic
1048650067 8:136466105-136466127 ACTGAGGATGTGAATCTTGAGGG - Intergenic
1050111725 9:2223824-2223846 AATTCAGCAGTGAACCCTGATGG + Intergenic
1051821246 9:21171900-21171922 ACTTTAGAAGAAAATCTTCAGGG + Intergenic
1052086000 9:24266804-24266826 ATTGCAGAAGCGAATTTTGAGGG - Intergenic
1053463402 9:38287986-38288008 ATTTCAGAGTTGAGTCTTGAGGG + Intergenic
1055426220 9:76199802-76199824 TCTACAGGTGTGAATCTTGAGGG - Intronic
1057960577 9:99452469-99452491 ATTTCAGCAGTGGATATTGAGGG + Intergenic
1059934182 9:119291245-119291267 ACTGCACAACGGAATCTTGATGG - Intronic
1060561124 9:124544555-124544577 ACTTCTGAACTGAGTCTTAAAGG + Intronic
1187883980 X:23871599-23871621 ACTTCTGAAGTGAATCTTGAAGG - Intronic
1191754912 X:64582494-64582516 ACTTCAGAAGTGACCCTGGAAGG - Intergenic
1194821492 X:98512162-98512184 ACTTCAAAAGATAATATTGAAGG - Intergenic
1195010619 X:100729813-100729835 ACTTTAGAACTCAATCTTGAGGG + Intronic
1196941425 X:120780089-120780111 ACTTCAGAATTGACTCTTAATGG + Intergenic
1198613256 X:138425415-138425437 ACTTCAGAGGGAAAGCTTGATGG + Intergenic
1198660509 X:138963376-138963398 TCCACAGAAGTGAATCCTGAAGG + Intronic
1199106081 X:143870342-143870364 ACTTCAGAAGTAATTCATAAAGG + Intergenic
1201508743 Y:14734194-14734216 ACTTCAGAAGTACATCGTGATGG - Intronic