ID: 1170296150

View in Genome Browser
Species Human (GRCh38)
Location 20:14828515-14828537
Sequence CTCCTACCACTGCTGTCTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 303
Summary {0: 1, 1: 0, 2: 3, 3: 30, 4: 269}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170296150_1170296151 2 Left 1170296150 20:14828515-14828537 CCAAGAGACAGCAGTGGTAGGAG 0: 1
1: 0
2: 3
3: 30
4: 269
Right 1170296151 20:14828540-14828562 AGATAATCCTGCTGCTTACCTGG 0: 1
1: 0
2: 1
3: 3
4: 109
1170296150_1170296155 20 Left 1170296150 20:14828515-14828537 CCAAGAGACAGCAGTGGTAGGAG 0: 1
1: 0
2: 3
3: 30
4: 269
Right 1170296155 20:14828558-14828580 CCTGGAATGTACCATGCAATGGG 0: 1
1: 0
2: 0
3: 9
4: 118
1170296150_1170296153 19 Left 1170296150 20:14828515-14828537 CCAAGAGACAGCAGTGGTAGGAG 0: 1
1: 0
2: 3
3: 30
4: 269
Right 1170296153 20:14828557-14828579 ACCTGGAATGTACCATGCAATGG 0: 1
1: 0
2: 0
3: 7
4: 133
1170296150_1170296156 23 Left 1170296150 20:14828515-14828537 CCAAGAGACAGCAGTGGTAGGAG 0: 1
1: 0
2: 3
3: 30
4: 269
Right 1170296156 20:14828561-14828583 GGAATGTACCATGCAATGGGTGG 0: 1
1: 0
2: 0
3: 5
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170296150 Original CRISPR CTCCTACCACTGCTGTCTCT TGG (reversed) Intronic
900348682 1:2224604-2224626 CTCCTACCACTGTAGACACTGGG - Intergenic
900464461 1:2818327-2818349 TTCCTACCCCTGCTCTCACTGGG + Intergenic
900746812 1:4366257-4366279 CTCCACCCACTGCTGTCTCTGGG - Intergenic
900779577 1:4609030-4609052 CTGCTCCCTCTGCTGTCCCTGGG + Intergenic
900905634 1:5555154-5555176 ATCCTACTCATGCTGTCTCTTGG - Intergenic
901024343 1:6271094-6271116 TTCCTGCCACTGCTGTCTTCTGG + Intronic
901696163 1:11009781-11009803 CTCCTATCTCAGTTGTCTCTGGG - Intergenic
901924977 1:12560438-12560460 CTCCCACCATTGCTGGCTGTGGG - Intergenic
902124346 1:14196134-14196156 CTCCAACCACCGTTGTCTCTTGG - Intergenic
902178919 1:14672830-14672852 CTGCTGTCACTGCTGTCTCTGGG + Intronic
902779923 1:18698541-18698563 CTCCTGCCACTGCTCCCTGTTGG - Intronic
902783813 1:18720540-18720562 CTCATACCCCAGCTCTCTCTGGG - Intronic
902841367 1:19076081-19076103 CACCTCCCCCTGCTGTCACTTGG + Intronic
903765015 1:25728494-25728516 CTCCAAGCACTGAAGTCTCTGGG - Intronic
904777914 1:32922960-32922982 CTCCAACCGCTGCTTTCTCCTGG - Intergenic
905836524 1:41127674-41127696 CTCCTAACAACCCTGTCTCTGGG - Intronic
907308970 1:53528683-53528705 CTCTGACCTCTGCTGTCTCATGG + Intronic
907546277 1:55262625-55262647 CTCCCAACACTGCTGACTCTAGG - Intergenic
907939920 1:59077731-59077753 CTCCTACAACAGATGTCTTTGGG - Intergenic
908394521 1:63713295-63713317 GTCCTCCCATTGCTGTGTCTTGG - Intergenic
908907275 1:69029918-69029940 AACCTACCAGTGCTATCTCTAGG + Intergenic
909324916 1:74338703-74338725 CTCTTGCCACGGTTGTCTCTAGG - Intronic
910083482 1:83371278-83371300 CTTGTACCACTGCTGTATCTAGG - Intergenic
910292213 1:85610430-85610452 CTCCTTCTACCTCTGTCTCTAGG + Intergenic
913663834 1:121029737-121029759 CTCCTACCTCTCCTATGTCTTGG - Intergenic
914015229 1:143813016-143813038 CTCCTACCTCTCCTATGTCTTGG - Intergenic
914162589 1:145148209-145148231 CTCCTACCTCTCCTATGTCTTGG + Intergenic
914653846 1:149721557-149721579 CTCCTACCTCTCCTATGTCTTGG - Intergenic
915724304 1:158006961-158006983 CTGCTTACACTGCTATCTCTTGG - Intronic
915991347 1:160520267-160520289 TTCCAACCACTGCTCTCTCCTGG + Intronic
916006435 1:160665459-160665481 CTCATTCCAGTGCTCTCTCTAGG + Intergenic
918410149 1:184249889-184249911 CTCCTTCCAGTGCTGTCGATTGG + Intergenic
919900024 1:202037373-202037395 CTCCTACCACTATGGTCTCTAGG - Intergenic
921082950 1:211758059-211758081 CTCCTCACCCTGCTGTATCTTGG + Intronic
922210775 1:223484805-223484827 CTCCTAGGACTGCTGTCCTTAGG - Intergenic
922271738 1:224041913-224041935 CTCTCACCTCTGCTGTCTTTTGG - Intergenic
922587795 1:226748818-226748840 CCCCTACCACTGTTCTCTCTTGG - Intergenic
922604512 1:226881142-226881164 CACCTGCCACAGTTGTCTCTGGG + Intronic
923660464 1:235952657-235952679 TTCCTGCAACTGCTGTCTCCTGG + Intergenic
923776296 1:236981647-236981669 CTCCTTCCACTGCTGCTTCTTGG - Intergenic
924866835 1:247991968-247991990 CACTCACCACTGCTGTCACTTGG - Intronic
1066295141 10:34047586-34047608 CTCCTGCCACTGCTGTTTTCTGG - Intergenic
1066381843 10:34908520-34908542 CACCTACCACTGCCCACTCTGGG + Intergenic
1066704558 10:38164054-38164076 CTCCCAACACTGCTGTCTTAGGG - Intergenic
1067048339 10:42998429-42998451 ATCCTATCACTTCTGTTTCTCGG + Intergenic
1068589779 10:58841656-58841678 CTCAGATCAGTGCTGTCTCTAGG + Intergenic
1069425416 10:68284583-68284605 CTTCTTCCCCTGCTCTCTCTAGG + Intronic
1069636754 10:69929742-69929764 AACCTCCCACTGCTGCCTCTGGG - Intronic
1069833739 10:71296093-71296115 CTCCTCCCACCCCAGTCTCTAGG + Intronic
1070165702 10:73896250-73896272 ATCCTCCCACTTCTGTCTCCTGG + Intergenic
1070481742 10:76889696-76889718 CTTCTTCCACTGCCGTCCCTTGG - Intronic
1070573041 10:77655888-77655910 AGCCTCCCAATGCTGTCTCTTGG - Intergenic
1071851014 10:89570536-89570558 CCACTCCAACTGCTGTCTCTAGG - Intergenic
1076430861 10:130401131-130401153 CTTCGCCCACTGCTCTCTCTGGG + Intergenic
1076569075 10:131420484-131420506 CTCCCAGCGCTGCTCTCTCTGGG + Intergenic
1076816958 10:132919803-132919825 CGCCTGTCACTGCTGTCACTCGG - Intronic
1077273686 11:1693638-1693660 CTCCTGCCTCTGCTGTCTCTGGG - Intergenic
1077935672 11:6783231-6783253 CTGCATCCACTGCTATCTCTAGG + Intergenic
1078013050 11:7588509-7588531 CTGCTACCACTGCCGTGGCTGGG - Intronic
1078705943 11:13744443-13744465 ATCCTCCCACTTCAGTCTCTTGG - Intergenic
1079491731 11:20996438-20996460 CTCCCACCTCTGCTGTCACTGGG + Intronic
1080792000 11:35529714-35529736 CTCCTACCACTGCTTGCTTCGGG + Intronic
1081592733 11:44436143-44436165 CTCCTTCCACCACTGTGTCTGGG - Intergenic
1083798478 11:65032387-65032409 CTCCCACCATTGCTGGTTCTGGG + Intronic
1087892288 11:103549378-103549400 TTCCTACCACTGCTCTCAATGGG + Intergenic
1091538170 12:1433294-1433316 CTCCTACCTCTGCCATCTCTTGG - Intronic
1091619219 12:2073525-2073547 CTCCCACCTGTGCTGTCTCCTGG - Intronic
1092162536 12:6323989-6324011 CTCCTTTCCCTGCTGTCTCTGGG - Intronic
1093315863 12:17648620-17648642 CTCTTTGCACTGCTTTCTCTGGG - Intergenic
1093742139 12:22700907-22700929 ATCCAACCACTCCTGCCTCTGGG + Intergenic
1094051205 12:26222566-26222588 CTCTTTCAACTTCTGTCTCTAGG + Intronic
1094267539 12:28575738-28575760 GTCCTACCACTGCCATGTCTGGG - Intronic
1097716598 12:62972590-62972612 CTCCTGCCTCTTATGTCTCTTGG - Intergenic
1098076267 12:66735444-66735466 CCCCTGCCACCGCTGTCACTGGG - Intronic
1098398296 12:70045652-70045674 CTCCTACCAGTCCTTTCTATTGG + Intergenic
1100171780 12:91983385-91983407 TTCCTTCCACTGCATTCTCTTGG + Intergenic
1100739765 12:97579120-97579142 ATCCTACCTCTGCTTGCTCTGGG + Intergenic
1101246212 12:102886181-102886203 TTCTGACCACTGCTGTCTCCAGG - Intronic
1103917832 12:124385112-124385134 CTTCTTCCACAGCTGTTTCTGGG - Intronic
1105793292 13:23824439-23824461 CTCCTACTGCTGATGTCCCTGGG + Intronic
1106121445 13:26863048-26863070 CTTCTTCCACTGGTGTCTCTGGG + Intergenic
1107060495 13:36154908-36154930 CCCCTGCCTCTGCTGTCACTCGG - Intergenic
1108831674 13:54487061-54487083 CTCCTACCTCTGCTGTCACCTGG + Intergenic
1108861288 13:54862514-54862536 CTCCTGCCACTGCCTTCTCTGGG - Intergenic
1110185451 13:72668776-72668798 CACCTACCACTACTGTCACAAGG + Intergenic
1113071528 13:106426082-106426104 CTCCTAACGCTGCTGCTTCTTGG - Intergenic
1114475236 14:22989675-22989697 CTCCTCCCACTCCTCTTTCTTGG - Intronic
1114483768 14:23050907-23050929 CTCCTCCCCATCCTGTCTCTGGG - Intronic
1114673600 14:24427704-24427726 CTCCTGCCTCTGCTGTTTCTGGG + Exonic
1115340265 14:32286384-32286406 ATCCCACCAATGCTGCCTCTTGG + Intergenic
1118814483 14:69300375-69300397 CTCCTGCCCTTGCTGTCACTGGG + Intronic
1119189684 14:72672322-72672344 ACCCTACCACTGCTGTTTCCTGG - Intronic
1119900978 14:78259516-78259538 CTCCTACCTCTGGTCTCTGTGGG + Intronic
1120884309 14:89440172-89440194 CTCCCACCAGTGCTGCTTCTTGG + Intronic
1122206985 14:100152578-100152600 CTCCCACCACTTCCCTCTCTTGG + Intronic
1122209026 14:100162980-100163002 CTCCGACGTGTGCTGTCTCTGGG - Intergenic
1122836170 14:104432154-104432176 CTCCTCTCCCTGCTGTCTGTGGG + Intergenic
1123076250 14:105668802-105668824 CTCCTCCCACGGCTTTGTCTTGG + Intergenic
1123190613 14:106565860-106565882 CGCCTACCACTGATGTCTCTGGG - Intergenic
1124354468 15:28984699-28984721 CTCCCTCCACTGCCATCTCTGGG + Intronic
1124354508 15:28984875-28984897 CTCCCCCCACTGCCATCTCTGGG + Intronic
1125024383 15:35015897-35015919 CTCCTACAGGTGTTGTCTCTTGG + Intergenic
1126523245 15:49620996-49621018 CTCCTCCCTCTGGTGTCTCCCGG + Intronic
1127124902 15:55802357-55802379 CACCTCCCACTCCTCTCTCTGGG - Intergenic
1127417533 15:58771728-58771750 CTCCGGCCACGGCTGTCTCCGGG - Exonic
1128638419 15:69317878-69317900 CTTGTGCCTCTGCTGTCTCTGGG + Intronic
1129895196 15:79100057-79100079 CTCCTACCAGCCCTGTCCCTAGG + Intergenic
1130527344 15:84718688-84718710 CTCCAAAAACTGCTGCCTCTAGG + Intergenic
1130844471 15:87731877-87731899 CTCATACCACTGCAGCCTTTTGG - Intergenic
1130912601 15:88281356-88281378 CCCCTACCACTGCCCTCACTTGG - Intergenic
1132014028 15:98300265-98300287 CTCCTTCCTCTGCTTTCACTTGG + Intergenic
1132601103 16:773360-773382 CAACCACCACTGCTGGCTCTGGG + Intronic
1132615472 16:839405-839427 CTCCTACTATTACGGTCTCTAGG + Intergenic
1135258277 16:20959146-20959168 GTCCCACCACTGCCTTCTCTGGG - Intronic
1138146020 16:54612513-54612535 CTCCTAACTCTGCCTTCTCTGGG + Intergenic
1140427790 16:74875291-74875313 CTCCTGCCTCTGCTGGCTTTTGG + Intronic
1140899654 16:79355947-79355969 CTTCTACAACTAATGTCTCTAGG + Intergenic
1141561229 16:84868966-84868988 GTCCTACCACTGTGGCCTCTGGG + Intronic
1142025104 16:87808386-87808408 CACCTCCCACTGTTCTCTCTGGG + Intergenic
1142318769 16:89367360-89367382 CTCCCACCACTGCTTCCACTGGG + Intronic
1144668224 17:17116537-17116559 CTCCCAGCACTGCTGTGCCTAGG + Intronic
1144729913 17:17520266-17520288 TTCCTACCCATGCTGCCTCTTGG - Intronic
1145006164 17:19339349-19339371 CCCCTAGAGCTGCTGTCTCTGGG + Intronic
1145783142 17:27577287-27577309 CTGCTTCAGCTGCTGTCTCTGGG + Intronic
1146271617 17:31488781-31488803 CTCCCACCACTGCAGCTTCTCGG - Intronic
1146522883 17:33539946-33539968 CTCTTACAAATGCTGTTTCTTGG - Intronic
1146675972 17:34774204-34774226 CTGGTACCTCTGCAGTCTCTTGG + Intergenic
1150304140 17:64070055-64070077 TTCCTTCCACTGCAGTCTGTTGG - Intronic
1150322817 17:64230618-64230640 CTCCTCCCTCTGCTGCCTCATGG - Intronic
1151886503 17:76925994-76926016 CTTCTCCCTCTGCTGTCTCCAGG - Intronic
1152431741 17:80252080-80252102 CTCCTGCGATTGCTGTCTCAAGG - Intronic
1152599896 17:81256961-81256983 CTGGCACCACTGCTGTCTCCTGG + Intronic
1152607780 17:81301709-81301731 CTCGGACCTCTGCAGTCTCTGGG + Intergenic
1154110070 18:11560081-11560103 GTGCTACCACTGCAGGCTCTCGG + Intergenic
1156222362 18:35065465-35065487 TTCCTAGCACTGCAGTCCCTGGG - Intronic
1156854741 18:41768594-41768616 CTCCTACTGCCTCTGTCTCTAGG - Intergenic
1157942087 18:51940283-51940305 CACGTACCACTCCTCTCTCTAGG - Intergenic
1160095030 18:75863510-75863532 TTCCTTCCACTCCTTTCTCTGGG - Intergenic
1161547644 19:4891519-4891541 CTCCTACAACTGCTGCCGCCAGG - Exonic
1162189708 19:8935252-8935274 CTGTTTCCCCTGCTGTCTCTGGG - Exonic
1162774836 19:12973238-12973260 ATCCTGACTCTGCTGTCTCTTGG - Intronic
1164389363 19:27804993-27805015 GGCCTACCACAGCTGCCTCTGGG - Intergenic
1164951187 19:32338439-32338461 CTCCTTCCACTCATATCTCTAGG - Intergenic
1165743795 19:38218645-38218667 CTCCAGCAACTGCTGTTTCTGGG + Exonic
1167192739 19:48003016-48003038 CTGCCACCGCTGCTGTTTCTTGG - Intronic
1167726831 19:51220472-51220494 CTGCTCCTACTTCTGTCTCTGGG + Intergenic
1167759038 19:51432345-51432367 TTCCTCCCTCTGCTGACTCTAGG + Intergenic
927207845 2:20621258-20621280 CTCCTTCCACAGCTGGCTCCAGG - Intronic
927487873 2:23501419-23501441 CTATTTCCACTGCTGTCTCTCGG - Intronic
927600265 2:24434703-24434725 CTCCTTACACTGCTGGCTCCAGG + Intergenic
931789339 2:65649968-65649990 CTCCAACCACTTCTAACTCTTGG + Intergenic
932814110 2:74848086-74848108 CTTTTCACACTGCTGTCTCTAGG + Intronic
933970101 2:87463259-87463281 CTGCTGTCGCTGCTGTCTCTTGG - Intergenic
936146660 2:109984919-109984941 CTCTTCCCACTGCTGTCCCTGGG + Intergenic
936198032 2:110386560-110386582 CTCTTCCCACTGCTGTCCCTGGG - Intergenic
936323681 2:111487237-111487259 CTGCTGTCGCTGCTGTCTCTTGG + Intergenic
938681034 2:133690064-133690086 GACCTACCCCTGTTGTCTCTTGG + Intergenic
940908639 2:159190998-159191020 GTCCTAACACTGCTGTTTCATGG - Intronic
945454337 2:210032724-210032746 CTTCTACCACTGCTGTTTATGGG - Intronic
946093462 2:217250808-217250830 CTCCCACCACTTTTGTCTCTGGG - Intergenic
948710109 2:239820062-239820084 CTCCAAGCACATCTGTCTCTTGG - Intergenic
1168969737 20:1922808-1922830 CTCTTACCAGTGGTGACTCTTGG - Intronic
1169241534 20:3985511-3985533 CTGCTACCATTGTTTTCTCTGGG + Intronic
1170296150 20:14828515-14828537 CTCCTACCACTGCTGTCTCTTGG - Intronic
1170530785 20:17288733-17288755 CTTCTCACACTGCTGTCTGTGGG - Intronic
1172434038 20:34915575-34915597 CTCCTCCTCCTCCTGTCTCTCGG - Intronic
1173186716 20:40845931-40845953 CTGCTTCCACTTCTTTCTCTTGG - Intergenic
1174142485 20:48425665-48425687 CTCCTGCCACTGGTGGCTCATGG - Intergenic
1174740202 20:53005480-53005502 GTCTTACCACTGCTGTCCCCAGG + Intronic
1175274243 20:57756713-57756735 CCCCTGCCACTGCTGTAACTGGG - Intergenic
1175292056 20:57882518-57882540 CTCCTCCCAGTGCGGTCCCTGGG - Intergenic
1175293342 20:57892839-57892861 CTCCGTCCACTGGTGTCTTTGGG + Intergenic
1175691086 20:61066478-61066500 CTCCTGGCACTGCTGCCTCTGGG - Intergenic
1175692648 20:61076556-61076578 CTTCTACCACCGATGGCTCTTGG + Intergenic
1175740926 20:61419321-61419343 CTCCCATCACGGCTGTTTCTGGG + Intronic
1175758835 20:61547556-61547578 CTCCTGCCACTGTTGACCCTGGG + Intronic
1175815385 20:61880809-61880831 CGCCCACCACTGCTGTCTCAAGG + Intronic
1176216817 20:63951932-63951954 CTCCTACCATGGGTTTCTCTTGG + Intronic
1176305206 21:5119576-5119598 CTCCTTCCACTGTTGCCCCTGGG - Intronic
1177755228 21:25338626-25338648 CTCCGCCCACTGCCCTCTCTTGG + Intergenic
1179022658 21:37654489-37654511 CTCCTAAAACTGCTGTATTTGGG - Intronic
1179851848 21:44142454-44142476 CTCCTTCCACTGTTGCCCCTGGG + Intronic
1180072543 21:45443530-45443552 CTCCTTGCACTGTGGTCTCTCGG + Intronic
1180285685 22:10742322-10742344 CTCCTAGCACTTTTCTCTCTTGG + Intergenic
1181364811 22:22367729-22367751 CTCCATCCACTTCTGTCTCCAGG - Intergenic
1181638670 22:24185835-24185857 CTTCTATTACTGCTGCCTCTGGG + Exonic
1181672175 22:24430814-24430836 CTCCCACCACGGCCCTCTCTAGG - Intronic
1182292044 22:29287708-29287730 CTGCTAGCCCTGCTGTCTTTGGG + Intronic
1183004770 22:34891956-34891978 CTCCAACAACTGTTGTCTGTGGG - Intergenic
1183044980 22:35212269-35212291 CTCCTGCCAAAGCTGCCTCTAGG + Intergenic
1184107505 22:42376748-42376770 CTCCTGCCTCAGCTGCCTCTAGG - Intergenic
1184982848 22:48106539-48106561 CTCATGCCACTTCTGGCTCTAGG + Intergenic
1185335328 22:50268721-50268743 TCCCTCCCACTTCTGTCTCTTGG + Intronic
950081345 3:10224418-10224440 CACCTAGCACTTCTGTCTCTGGG + Intronic
950443327 3:13022431-13022453 CTGCAGCCACTGCTGTCTCCTGG - Intronic
950722179 3:14891264-14891286 CTTCTGCCACAGCTGGCTCTGGG - Intronic
951066626 3:18274404-18274426 CTCCTACTGCTGCTGTTGCTAGG + Intronic
951227155 3:20133772-20133794 CCCCTACCATTGCTGGCACTGGG + Intronic
952446468 3:33385548-33385570 TTCCTGCCACTGCTGTCGGTGGG - Exonic
952665385 3:35897886-35897908 CTCCTAACACTGCTGCCTACTGG - Intergenic
952726468 3:36591723-36591745 CTCCTACCATTGATATCTATGGG + Intergenic
954920525 3:54187064-54187086 CTCCTGCTGCTGCTGTCCCTGGG + Intronic
956592271 3:70927294-70927316 CTCCAACCCCTGCTCTATCTGGG + Intergenic
957909910 3:86607546-86607568 CTGGTACCACTACTGTATCTTGG - Intergenic
959531082 3:107434124-107434146 TTCCTTCCACACCTGTCTCTTGG + Intergenic
960291521 3:115891238-115891260 CCCCTCCCACTTCTGACTCTAGG + Intronic
962522777 3:136212519-136212541 CTATTACCAGTGCTGTCCCTTGG - Intergenic
964810045 3:160653867-160653889 CTCCTACCACTTATCTCTGTTGG + Intergenic
966573047 3:181468398-181468420 CTCCTAGCACCCCTGTCACTAGG + Intergenic
967874254 3:194256043-194256065 CTCCTTACACTGGTGTCCCTGGG + Intergenic
967941289 3:194768517-194768539 CTCCTGCCCCTTCTGTCTCCAGG - Intergenic
968471236 4:783357-783379 CTCCTCCTCCTGCTGCCTCTGGG - Intergenic
969630896 4:8335409-8335431 CTCCTACAACAGCTGCCTCTTGG - Intergenic
970160151 4:13180083-13180105 CTCTTACCACTACTGACTCTTGG - Intergenic
970817882 4:20179221-20179243 CCCCTAGCAGTGCTGGCTCTCGG - Intergenic
973344203 4:49036807-49036829 CTGCTTCCTCTGGTGTCTCTGGG + Intronic
973929360 4:55774522-55774544 TAGCTACCACTGCTGTCTTTGGG - Intergenic
980876221 4:138665055-138665077 CAGCTTCCACTGCTGCCTCTTGG + Intergenic
982638806 4:157930794-157930816 AACCTACCACAGCTGTCTTTGGG + Intergenic
982754058 4:159197873-159197895 CTTGTCCCACTCCTGTCTCTAGG + Intronic
989134157 5:38136539-38136561 CTGCCACCACTGTTGGCTCTGGG + Intergenic
990677405 5:58203088-58203110 CTCCCACTTCTGCTTTCTCTAGG - Intergenic
991459644 5:66844431-66844453 TTCCTACTACTGTTGTCTCTTGG + Intronic
991705130 5:69350297-69350319 TTTCTTCCACTGCTCTCTCTTGG - Intergenic
992004441 5:72463576-72463598 CTTCTTCCACTGCTGCCTCAGGG + Intronic
993010014 5:82470368-82470390 CTGCTACCAGTGCTGACTCATGG + Intergenic
993434261 5:87872107-87872129 CTCCCACCAGTTCTATCTCTGGG + Intergenic
1002101103 5:176858063-176858085 TGCCTACCGCTGCTGCCTCTGGG - Intronic
1004744016 6:18492056-18492078 CTATTAACAATGCTGTCTCTTGG + Intergenic
1006269424 6:32952366-32952388 CTTCTCCCATTGCTGTCTTTGGG - Intronic
1006296835 6:33173555-33173577 CTCCCCCCACCTCTGTCTCTAGG - Exonic
1006477108 6:34263344-34263366 CTCCTTCCGCTGCTGCTTCTTGG + Intergenic
1006988334 6:38192189-38192211 CTCATACAACTGCTGTCACTTGG + Intronic
1007998091 6:46329934-46329956 CTGCTACCACAGCTTCCTCTGGG - Intronic
1008429102 6:51393912-51393934 CTCCTACAACAGCTGAGTCTGGG + Intergenic
1011187827 6:84698538-84698560 CTCCTTCCACTACTGGCTTTGGG - Intronic
1012289498 6:97435213-97435235 CAACAACCACTGCAGTCTCTTGG - Intergenic
1012558940 6:100554637-100554659 CACATTCCACTGCTGTCTTTTGG + Intronic
1013343218 6:109235839-109235861 CCCCAACCACTCCTGTCTTTTGG - Intergenic
1013664255 6:112330415-112330437 GTCCTTTCATTGCTGTCTCTGGG + Intergenic
1017750520 6:157486959-157486981 CACCTACCAATGCTGTAGCTGGG - Intronic
1019438283 7:1032779-1032801 CTCCGACCAGTGTTTTCTCTTGG - Intronic
1020510163 7:9046489-9046511 CTCCTTCCACTGCTGTGACCTGG + Intergenic
1021189359 7:17602480-17602502 CTGCTACCACTGCAGTTTTTTGG + Intergenic
1021550489 7:21866226-21866248 CTCCTGCCATTGCTTTCTGTTGG + Intronic
1022134559 7:27435200-27435222 CTCCCTCCACTGGTGACTCTGGG - Intergenic
1022412806 7:30152397-30152419 GTCCTACCACCCCTGGCTCTTGG + Intronic
1022519284 7:30995430-30995452 CTCCTGCCCCTTCTGCCTCTTGG + Intergenic
1022657638 7:32335011-32335033 CTCCTATCACTGTTCTCTCCCGG + Intergenic
1023584481 7:41715162-41715184 CGGCTACCACAGCTGTCTGTTGG + Intergenic
1025638727 7:63348704-63348726 GGCCTACCACAGCTGCCTCTGGG - Intergenic
1025643969 7:63399385-63399407 GGCCTACCACAGCTGCCTCTGGG + Intergenic
1026006841 7:66606777-66606799 CTCCTTCCGCTGCTGCTTCTTGG + Intergenic
1026473940 7:70718078-70718100 CTCCCACCACAGCTGTTTCGTGG + Intronic
1026969564 7:74459809-74459831 ACCCTACAACTGCTGCCTCTGGG + Intronic
1027300312 7:76827419-76827441 CTTGTACCACTGCTGTATCTAGG - Intergenic
1029634061 7:101772168-101772190 CTCCTACCACCTCTGCCTCCTGG + Intergenic
1032203966 7:129845514-129845536 CTGTTACCACTGTTATCTCTAGG + Intronic
1035217634 7:157380670-157380692 CTTCTTCCTCTTCTGTCTCTTGG + Intronic
1036642398 8:10592592-10592614 CCCCTCCCAGGGCTGTCTCTGGG + Intergenic
1036815587 8:11900306-11900328 CTCCTTCCACCTCTATCTCTAGG + Intergenic
1038074412 8:24055439-24055461 CTCCTAACACTGCATTCCCTAGG + Intergenic
1039344010 8:36684043-36684065 CTCCTCCCAGTGTTGTCTTTAGG - Intergenic
1040712191 8:50202358-50202380 CTCCTTCCCCTGATCTCTCTTGG + Intronic
1041281396 8:56213414-56213436 CGTCTTCCACTGCTGTCGCTTGG + Intronic
1043617095 8:82139297-82139319 CTCCTACCTCTTCTTTCTCCAGG + Intergenic
1044528126 8:93275417-93275439 CACCTGCCACTGGTGTCTATGGG + Intergenic
1044779734 8:95731877-95731899 TTACTTCCACTGCTGTCTCATGG + Intergenic
1046024231 8:108702980-108703002 CCCCTTCCAGTGCTCTCTCTAGG - Intronic
1046192081 8:110809529-110809551 TTACTTCCACTGCTCTCTCTTGG + Intergenic
1047037428 8:120955247-120955269 CTCCATCCAGTTCTGTCTCTGGG + Intergenic
1047422941 8:124722198-124722220 CTCCTTCCTGTGCTGCCTCTTGG - Intronic
1047634747 8:126748841-126748863 CTGCTAAAACTGCTGGCTCTAGG - Intergenic
1047711741 8:127559379-127559401 CTCCAACAACTGGTGTCTCTGGG - Intergenic
1049234576 8:141506102-141506124 CTGTTACCACTGCTGTGCCTGGG - Intergenic
1049579938 8:143406650-143406672 CTCCTACCTCTGCCTTCTCCAGG - Intergenic
1049715099 8:144086054-144086076 CTCTTCCCACTGCTGTCCCTGGG + Exonic
1049911069 9:268672-268694 CTCCTGCGACTGCTGTGTCCAGG - Intronic
1050454793 9:5823920-5823942 CTCCTACACCTGCTGCCTCTAGG + Exonic
1051122340 9:13764862-13764884 CTCTTTCCTCTGCTGTCTCATGG + Intergenic
1054783115 9:69184465-69184487 CTGCTACTGCTGCTGTCTGTAGG + Intronic
1054864685 9:69987921-69987943 ATTCTACCAATGTTGTCTCTAGG - Intergenic
1057123044 9:92594364-92594386 CTGCTTCCACTTCTGGCTCTGGG + Intronic
1057585397 9:96324099-96324121 CTCCAACCACTGCTGTCGTCAGG + Exonic
1057872175 9:98726572-98726594 CTCTCCCCACTGCTGTCCCTGGG + Intergenic
1058101012 9:100917653-100917675 CTCCTCCCAGGGCTGTGTCTGGG + Intergenic
1058588221 9:106532896-106532918 CTGCTAACACTGCTGTCCATTGG - Intergenic
1059670175 9:116483866-116483888 CTGCTACTACTTCTGCCTCTGGG - Intronic
1059710285 9:116861668-116861690 CTCCAAGCATGGCTGTCTCTGGG + Intronic
1059719189 9:116942832-116942854 CTTCTGCCATTGCTGCCTCTGGG - Intronic
1059951194 9:119464105-119464127 CTCATGCAACTGCTGTCCCTGGG - Intergenic
1060597678 9:124857957-124857979 CTCCTTCCGCTGCTGCTTCTTGG + Exonic
1062181858 9:135195226-135195248 CTCAGACCCCTGCTCTCTCTGGG - Intergenic
1186265144 X:7824508-7824530 TTCCCACCATTGCTGTCCCTTGG + Intergenic
1188132898 X:26459700-26459722 CTCCTAATAGTGCTTTCTCTTGG - Intergenic
1189494894 X:41499928-41499950 CTCCTGCCACAGGTGTCTGTGGG - Intergenic
1190103600 X:47542537-47542559 CTCCAACCCCAGCTGTCACTTGG + Intergenic
1191076724 X:56461281-56461303 CTCCTTCCTCTCCTCTCTCTTGG + Intergenic
1193191633 X:78578387-78578409 CTCCTACATCCACTGTCTCTGGG - Intergenic
1193628709 X:83853326-83853348 CTACTTCCACTTCTTTCTCTGGG - Intergenic
1193824751 X:86209727-86209749 CTCCTACCACTTGTGTATCATGG + Intronic
1194461321 X:94172811-94172833 CTCCTATCACAGGTGACTCTAGG - Intergenic
1194972735 X:100362164-100362186 CTCCCTCCACAGCTCTCTCTTGG + Intronic