ID: 1170304838

View in Genome Browser
Species Human (GRCh38)
Location 20:14926919-14926941
Sequence CAAATTGATGATAATTATAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 546
Summary {0: 1, 1: 0, 2: 3, 3: 52, 4: 490}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170304838 Original CRISPR CAAATTGATGATAATTATAT TGG Intronic
903631250 1:24773925-24773947 CAAAGTGAGAATAATTATAAAGG + Intronic
906792718 1:48672839-48672861 GAAATTGATGATGATTCTAATGG + Intronic
906896675 1:49781001-49781023 CAAATTGATGATAAGTAAATAGG + Intronic
908872133 1:68625576-68625598 CTACCTGATGATAATTATATAGG + Intergenic
908882820 1:68751774-68751796 CTAATTATTGATAATTATTTTGG + Intergenic
908919180 1:69169587-69169609 CAAAATGCTGATAATGATATAGG + Intergenic
909020135 1:70421952-70421974 CAAAATGGAGATAATTATACCGG + Intronic
909563661 1:77031906-77031928 CAATATGATGAGAATTATAAAGG + Intronic
909754487 1:79206785-79206807 CAAATTCATGTTTATTATCTAGG - Intergenic
909877236 1:80823193-80823215 AAAATTGATTATGATTACATGGG + Intergenic
910568450 1:88673284-88673306 AAAAATGATGTTAATAATATAGG + Intergenic
910874354 1:91864324-91864346 CAAATTGCTGACAAGAATATTGG + Intronic
911064776 1:93778480-93778502 CAGATTGCTGGTAATAATATTGG - Intronic
912121607 1:106478856-106478878 CAAAATGCTGATGATGATATGGG + Intergenic
912267508 1:108173766-108173788 CAAAATGCTGATAGTAATATGGG + Intronic
913146532 1:115995671-115995693 CATATGGTTGATAAATATATAGG - Intronic
913720631 1:121589394-121589416 CATATTGAAGATACTTATAAAGG + Intergenic
913945553 1:125159978-125160000 CAATTCGATGATGATTACATTGG + Intergenic
913945866 1:125164465-125164487 TAATTTGATGATGATTACATTGG + Intergenic
913950433 1:143223918-143223940 CCAATTGATGATGGTTATTTTGG - Intergenic
913953187 1:143258560-143258582 CCAATTGATGATGGTTATTTTGG + Intergenic
916781272 1:168032848-168032870 CAAAATGAAGATAATTAACTAGG - Intronic
916995843 1:170299865-170299887 CAAATATATGTTAATAATATAGG + Intergenic
917143267 1:171859232-171859254 CAAATTCAAGATAATAATAGTGG - Intronic
917387555 1:174493512-174493534 AAAGTTGATGATAATTTTATAGG + Intronic
918694547 1:187528229-187528251 TAAATTGATGATAAAGACATAGG - Intergenic
918763097 1:188439988-188440010 CAAATTTATGGGAAGTATATAGG + Intergenic
918939316 1:190971426-190971448 CAAATTAATGATGATTTTACTGG + Intergenic
919037433 1:192332268-192332290 CAAAGAAATGAGAATTATATGGG + Intronic
919042650 1:192411681-192411703 CAAATTGGTGTAGATTATATAGG - Intergenic
919409787 1:197228546-197228568 CAAAATGCTGATAGTAATATTGG - Intergenic
920257056 1:204662707-204662729 CAAATAGCTGATAAGTATCTGGG + Intronic
920424387 1:205862395-205862417 CAAAGGGCGGATAATTATATGGG + Intergenic
921329024 1:214016854-214016876 CAAATAGATGATAAATCAATGGG - Intronic
921996673 1:221426661-221426683 CAAAATGCTGATAATGATAATGG - Intergenic
922563129 1:226583433-226583455 CAGATTGATTATAATGATAATGG + Intronic
922782136 1:228261163-228261185 CAAAATAATGATAATAATAATGG - Intronic
923263690 1:232291920-232291942 CAAATTGATTGTAGTTTTATTGG + Intergenic
923959796 1:239066369-239066391 TAAATTGATTATTAATATATTGG - Intergenic
924023831 1:239812339-239812361 CAATTTGATCATTTTTATATGGG + Intronic
924148213 1:241099551-241099573 CAAATTGCTGGTAATTCTAAAGG + Intronic
924298005 1:242608207-242608229 CAACTCCATGATAATTTTATGGG + Intergenic
924773902 1:247101804-247101826 ATAATTCATGATAATTTTATGGG - Intronic
1063587651 10:7366986-7367008 TAAATTGATCATATCTATATGGG + Intronic
1063836682 10:10022472-10022494 GAAAATGATGATCATTATCTAGG - Intergenic
1066259473 10:33715181-33715203 CATCTTAATGATCATTATATTGG + Intergenic
1066273398 10:33845185-33845207 CAAAATGCTGATAATGATATGGG - Intergenic
1066385703 10:34939603-34939625 CCAAATGAAGATAATTATGTAGG + Intergenic
1066743693 10:38582760-38582782 CCATTTGATGATGATTCTATTGG - Intergenic
1067783216 10:49224039-49224061 CAAAATGCTGATAATGATATGGG - Intergenic
1067956002 10:50791509-50791531 GAAATGGAAAATAATTATATTGG - Intronic
1068061560 10:52073879-52073901 CAAATTATTGATATTTGTATGGG + Intronic
1068280520 10:54863044-54863066 AACATTGATGATAATAATATGGG - Intronic
1069253088 10:66296323-66296345 CAAATTGATTATAACTATAAAGG + Intronic
1069941722 10:71961269-71961291 CAAAGGGTGGATAATTATATGGG + Intergenic
1070177393 10:73983483-73983505 TAGATAGATGATTATTATATAGG - Intergenic
1071393711 10:85200645-85200667 CAGAGTGATGATAATGATAATGG - Intergenic
1072368230 10:94736493-94736515 CAAATGCATGATAAGTATAAAGG - Intronic
1072754009 10:98005803-98005825 CAAATTAATCATGATCATATAGG - Intronic
1072866578 10:99068105-99068127 CAAAATGCTGATAGTGATATGGG - Intronic
1073183855 10:101603351-101603373 CAAATTAATAATAATAATAAAGG - Intronic
1078696867 11:13642802-13642824 TAAATAAATGATAAATATATAGG + Intergenic
1079707443 11:23638295-23638317 CAAATTGCTGATAGTGATATGGG - Intergenic
1079820168 11:25116518-25116540 AAAATTGCTGGTGATTATATTGG + Intergenic
1079838742 11:25367547-25367569 CAAAATGGTGATAATTATATGGG - Intergenic
1079884209 11:25966102-25966124 CAAATTAAAGATAAGCATATTGG + Intergenic
1080204986 11:29717886-29717908 CAAAATGCTGATAATAATATGGG - Intergenic
1080989990 11:37520421-37520443 CAAATTGAAAATAAATATGTAGG + Intergenic
1082733212 11:56825391-56825413 CAAAATGCTGATAGTAATATGGG - Intergenic
1083212637 11:61198174-61198196 TAAATTGATGATAACTTTTTTGG - Intergenic
1083215583 11:61217337-61217359 TAAATTGATGATAACTTTTTTGG - Intergenic
1083218467 11:61236166-61236188 TAAATTGATGATAACTTTTTTGG - Intergenic
1085189772 11:74609083-74609105 CAAATTGTTGGTAATAATACAGG - Intronic
1085975699 11:81651208-81651230 CAAATTGATCATTATTTTTTGGG - Intergenic
1086009439 11:82081916-82081938 CAAATGTATGTTTATTATATTGG + Intergenic
1087877389 11:103374582-103374604 CAAAATGCTGATAGTGATATGGG + Intronic
1088438569 11:109842602-109842624 TAAATTGATTATAATTTTGTTGG - Intergenic
1088726570 11:112642602-112642624 CAAAATCATAATAATGATATGGG - Intergenic
1089075769 11:115737285-115737307 CTAATTGCTCATAATTACATTGG + Intergenic
1091535003 12:1398313-1398335 CATATTGATAGTAATTGTATTGG + Intronic
1092907066 12:13110845-13110867 CATATGGATGATAAATAGATAGG + Intronic
1093622535 12:21309371-21309393 AAAATTCATGATAATTGTCTTGG - Intronic
1094109263 12:26843788-26843810 CAAATTGATGCTAATTAGTTGGG - Intergenic
1094421250 12:30273439-30273461 CAAAATGCTGATAGTAATATGGG - Intergenic
1094434023 12:30400877-30400899 CAAACTGATCAAAATTAGATAGG + Intergenic
1095310799 12:40693970-40693992 GAAATGGATGAAGATTATATTGG - Intronic
1095345992 12:41149041-41149063 CAAAATGCTGATAGTGATATGGG - Intergenic
1096298987 12:50409296-50409318 TAAATTGAGGACAATAATATGGG + Intronic
1097358314 12:58627693-58627715 GAAACTGAGGATAAATATATTGG - Intronic
1097405639 12:59185903-59185925 CAATTAGATGATAATGATCTTGG - Intergenic
1097627608 12:62019900-62019922 GAAATTGAAAATAATTAAATTGG - Intronic
1097628169 12:62026738-62026760 CAAAATTATGATAAATATTTTGG + Intronic
1097645320 12:62229561-62229583 AAAATTGATAATGATTAGATGGG - Intronic
1098419601 12:70280421-70280443 CGAATTGATGAAAATGATTTTGG + Intronic
1098943276 12:76560874-76560896 TATATTAATAATAATTATATAGG - Intergenic
1099487693 12:83248739-83248761 CAAAATGCTGATAGTGATATGGG + Intergenic
1099658609 12:85526953-85526975 CAAAATGCTGATAGTGATATGGG + Intergenic
1100892895 12:99145909-99145931 CGTATTGGTGAGAATTATATGGG + Intronic
1101773990 12:107777135-107777157 CAAATTTATGACAATTAAATAGG - Intergenic
1101852121 12:108411751-108411773 CAAAATGAAGATAATAATAGTGG + Intergenic
1101995091 12:109519655-109519677 TAAATTTAAGATAATTATCTTGG - Intronic
1102427603 12:112856625-112856647 CACATTGATGAGAAATTTATAGG - Intronic
1104232793 12:126901262-126901284 GAAATTGATAGTAATCATATGGG - Intergenic
1104514377 12:129410703-129410725 AAATTTGATGTTAATTTTATTGG + Intronic
1105528997 13:21201293-21201315 CAAAATGCTGATAGTGATATAGG - Intergenic
1106444368 13:29812051-29812073 CAAATTGATAAGATTTAGATGGG - Intronic
1106985346 13:35341082-35341104 TAAATTGACCATAAGTATATGGG - Intronic
1107238600 13:38203228-38203250 CAAATTGATGAAAAAAATAGAGG + Intergenic
1107766343 13:43739246-43739268 TCAATTAATGATAAATATATTGG + Intronic
1108856301 13:54797923-54797945 CAAATTTATAATATTTATGTGGG - Intergenic
1109185310 13:59260962-59260984 AAAGTTGAACATAATTATATTGG + Intergenic
1109264862 13:60186214-60186236 CAAATCAATGATATTTGTATAGG + Intergenic
1109565199 13:64104694-64104716 AAAATTTAATATAATTATATTGG - Intergenic
1109569895 13:64174351-64174373 AAAATTAAAGATAATTATTTAGG + Intergenic
1109635533 13:65110087-65110109 TAAGTTGATGATATTTACATAGG + Intergenic
1109756818 13:66771801-66771823 AATATTGATGATAATTCCATGGG - Intronic
1109864916 13:68250753-68250775 CAACTTGATCTTTATTATATTGG + Intergenic
1110116961 13:71830207-71830229 CAAATTTATCTTATTTATATAGG + Intronic
1110738428 13:78965757-78965779 CAAACTGATGATGTTTAGATTGG - Intergenic
1111003693 13:82220030-82220052 AATATTTATAATAATTATATTGG + Intergenic
1111077159 13:83251796-83251818 CAAAATGATTGTAATAATATAGG - Intergenic
1111221242 13:85207840-85207862 CAAAGTGCTGATAGTGATATGGG + Intergenic
1111647158 13:91045983-91046005 GAAAATGTTAATAATTATATTGG - Intergenic
1111785503 13:92781913-92781935 CACATTATTGATAATTATTTTGG - Intronic
1112045993 13:95598601-95598623 CAAATTGTCAATACTTATATGGG - Intronic
1112253845 13:97809412-97809434 TAAGTTGATAATAATTATATGGG - Intergenic
1112418064 13:99221204-99221226 CACATTTATGATAATTACTTTGG + Intronic
1112685478 13:101820325-101820347 CAAAATTATTAAAATTATATAGG - Intronic
1112873847 13:104011114-104011136 TATATTGATGCTAATGATATAGG - Intergenic
1113822621 13:113225837-113225859 CAAATTGTTCAAAATTATAATGG - Intronic
1114383519 14:22233166-22233188 CAAAATGCTGATAGTGATATGGG - Intergenic
1114797321 14:25731153-25731175 CAAATTGCTGATGATAATGTTGG - Intergenic
1114961278 14:27893089-27893111 CAAAATGTTGATAATCATATGGG + Intergenic
1114975829 14:28098164-28098186 AAAATATATTATAATTATATGGG - Intergenic
1115828728 14:37310094-37310116 CAAGTTGGCGATAATTATAATGG - Intronic
1116904509 14:50391948-50391970 CAAAGTGGAGATAATGATATGGG - Intronic
1117928060 14:60806165-60806187 CACATTGAAAATAATTATACAGG + Intronic
1118083770 14:62392900-62392922 CAAAGAGATGAAAATTATAAGGG - Intergenic
1119412042 14:74438538-74438560 CAAATTGCTAATAATTATTGAGG + Intergenic
1119462229 14:74816354-74816376 CAAATGGAAGACAATTCTATTGG - Intronic
1119588894 14:75866242-75866264 CAATTTAGTGATAATTATAATGG - Intronic
1120047916 14:79829037-79829059 TTAATTGATAATAATTATAATGG - Intronic
1120182219 14:81355425-81355447 GAAATTGATTATAGTTGTATTGG - Intronic
1120654240 14:87169935-87169957 CAAAATGCTGATAGTGATATGGG - Intergenic
1121199248 14:92104062-92104084 CAAGTTGATGATAATGGTAAAGG + Intronic
1122681285 14:103465268-103465290 TCAATTGATAATAATAATATGGG - Intronic
1123140449 14:106072517-106072539 CAAAATGCTGATAGTGATATGGG + Intergenic
1123716491 15:23036830-23036852 CAAATTGACGATAATCAGATAGG + Intronic
1124485984 15:30117021-30117043 AAAATTTATGATAATTACTTAGG - Intergenic
1124517591 15:30380248-30380270 AAAATTTATGATAATTACTTAGG + Intronic
1124541060 15:30586007-30586029 AAAATTTATGATAATTACTTAGG - Intergenic
1124547770 15:30647797-30647819 AAAATTTATGATAATTATTTAGG - Intronic
1124757598 15:32421577-32421599 AAAATTTATGATAATTACTTAGG + Intergenic
1125037227 15:35139083-35139105 AAAATTTATTATAATTCTATGGG - Intergenic
1126512954 15:49501292-49501314 CAAAATGCTGATACTGATATGGG + Intronic
1126557943 15:50010726-50010748 CATACTGATGATAATTATTCTGG + Intronic
1126825159 15:52541051-52541073 CAAAATGCTGATAGTGATATAGG - Intergenic
1126831676 15:52613549-52613571 AAAATTGATCATAATCATAAAGG - Intronic
1127406172 15:58649094-58649116 CAAATAGAAGATAATAAAATTGG - Intronic
1127420588 15:58801404-58801426 AAAAAAGATGATAATTATATAGG + Intronic
1127694436 15:61431032-61431054 CAAATACATGAAAATTAGATAGG - Intergenic
1128695839 15:69762068-69762090 TAAAGTGAGGATAATTATAATGG + Intergenic
1129529854 15:76256737-76256759 CAGATTCATTATAATTTTATGGG - Intronic
1130429903 15:83837174-83837196 AAAATTGTTTATAAATATATAGG + Intronic
1130431636 15:83853729-83853751 CAAATAGATGTTAATGACATTGG + Intronic
1130815656 15:87429609-87429631 CATATGGAAAATAATTATATTGG + Intergenic
1131782807 15:95877765-95877787 TAAAATGATGATGAGTATATTGG - Intergenic
1131885781 15:96911392-96911414 TAAATTTATGAAAATTATTTGGG + Intergenic
1133177188 16:4024343-4024365 CAAACTAATGTTAATCATATAGG + Intronic
1133852002 16:9513931-9513953 CAAATTAGTAATAATTCTATTGG + Intergenic
1135696886 16:24596093-24596115 TCAATTGATGATATTTATGTGGG + Intergenic
1135804247 16:25527794-25527816 TAAATAGTTTATAATTATATTGG + Intergenic
1136941881 16:34593488-34593510 CAATTCGATGATGATTACATTGG + Intergenic
1136944121 16:34626057-34626079 CAATTCGATGATGATTACATTGG + Intergenic
1136949571 16:34699757-34699779 CAATATGATGATTATTACATTGG + Intergenic
1136951131 16:34720310-34720332 CAATTTGATGATGATTACGTTGG + Intergenic
1136965368 16:34902487-34902509 CAATTCGATGATGATTACATTGG + Intergenic
1136969402 16:34956015-34956037 CAATTCGATGATGATTACATTGG + Intergenic
1137094413 16:36235460-36235482 CAATTCGATGATGATTACATTGG + Intergenic
1137095186 16:36245763-36245785 CAATTCAATGATGATTATATTGG + Intergenic
1137222143 16:46465956-46465978 GAATTCGATGATAATTAAATTGG - Intergenic
1137462619 16:48679371-48679393 CAAATTGATGATACTGAGGTGGG + Intergenic
1138136364 16:54526607-54526629 AAATTTTAAGATAATTATATTGG - Intergenic
1138761714 16:59552303-59552325 TAAAAAGATGATAATTAGATAGG - Intergenic
1139062452 16:63269850-63269872 AAAACTCAGGATAATTATATTGG - Intergenic
1139083983 16:63561904-63561926 CAAAATGCTGATAATGATATGGG - Intergenic
1140565787 16:76040461-76040483 CAAATTTATGAAAACAATATGGG - Intergenic
1142824585 17:2500763-2500785 CAAAATTATGATAACTATATGGG - Intronic
1145101314 17:20080230-20080252 CAAAGGGATGCTATTTATATGGG + Intronic
1147282496 17:39373840-39373862 AAAAGTGAAGATGATTATATGGG + Intronic
1147751926 17:42741070-42741092 AAAAGTGAAGATAATTAGATAGG - Intronic
1148675644 17:49443224-49443246 AAAATTGAAGATAATAATAGTGG - Intronic
1149071994 17:52554667-52554689 AAAATTGAGGTTAATTATACTGG - Intergenic
1149713452 17:58764203-58764225 CAAATACTTAATAATTATATGGG + Intronic
1150525920 17:65922572-65922594 CATTTTGATGATAATCACATGGG - Intronic
1150927425 17:69547769-69547791 CAAATTGAAGTAAATTATGTTGG - Intergenic
1150989944 17:70245553-70245575 TAAAATGATGATAATGATAATGG - Intergenic
1203185174 17_KI270729v1_random:109602-109624 CAATTCGATGATGATTACATTGG + Intergenic
1203185550 17_KI270729v1_random:114571-114593 CAATTCGATGATGATTACATTGG + Intergenic
1203186393 17_KI270729v1_random:125602-125624 CAATTCGATGATGATTACATTGG + Intergenic
1203187733 17_KI270729v1_random:143229-143251 CAATTCGATGATGATTACATTGG + Intergenic
1203188378 17_KI270729v1_random:151699-151721 CAGTTTGATGATGATTACATTGG + Intergenic
1203188794 17_KI270729v1_random:157325-157347 CAATTCGATGATGATTACATTGG + Intergenic
1153153509 18:2123235-2123257 CAAATAGATGATAGATAGATAGG + Intergenic
1153176870 18:2385054-2385076 CAAAATATAGATAATTATATGGG + Intergenic
1155391408 18:25341112-25341134 CAATTTAAGGATAATGATATTGG - Intronic
1155872811 18:31048269-31048291 AAAATTGATGTCAATTATCTTGG - Intergenic
1156178196 18:34572468-34572490 CAAAAAGATGATAATAATATTGG - Intronic
1156207986 18:34906702-34906724 CAAAATGCTGATAGTGATATGGG - Intergenic
1157016832 18:43725340-43725362 TAAATTTATAATAATTATATAGG + Intergenic
1157739334 18:50078465-50078487 CAAATTCATGTTCATTATAAAGG - Intronic
1157898569 18:51491656-51491678 CAAGATGATGATGATTCTATAGG - Intergenic
1158885717 18:61825321-61825343 CCAATTGATCATATATATATAGG + Intronic
1159832138 18:73289982-73290004 CAAATTAATGATACATATTTTGG + Intergenic
1160255115 18:77241843-77241865 CAAAATGATAAAAATTAAATAGG - Intergenic
1161929846 19:7331679-7331701 GATATTGATGATGATTATAATGG - Intergenic
1164020463 19:21299418-21299440 CATATTAATTATATTTATATTGG - Intronic
1165504370 19:36215504-36215526 GAAAGTGCTGATAATTATAACGG + Intronic
1166951711 19:46432827-46432849 CAAAATAATAATAATAATATAGG - Intergenic
1168385018 19:55955933-55955955 CAACTTTATGATAATCATTTAGG - Exonic
1168702307 19:58448257-58448279 CAAAATGCTGATAATGATATGGG + Intergenic
926677345 2:15637265-15637287 AATATTGATGTTAATTCTATTGG + Intergenic
926998033 2:18759407-18759429 CAAAATTATGATAACTATATTGG - Intergenic
928019756 2:27694841-27694863 CAAATGCATGAGAATCATATGGG - Exonic
930802977 2:55461938-55461960 CATCTTGATGATAAGTATGTAGG + Intergenic
930807744 2:55508383-55508405 CAAATTAATTAAAATTAAATAGG + Intergenic
930939890 2:57000050-57000072 CAAAATGCTGATAGTGATATGGG - Intergenic
931390011 2:61833445-61833467 AAATGTGATGATAATAATATAGG + Intronic
931631032 2:64299377-64299399 CAAATTGATCTTCATGATATTGG - Intergenic
932387649 2:71351936-71351958 CAAATTGGTAATGATTAAATTGG - Intronic
933011981 2:77077283-77077305 CAGATTGATTATAGTTATTTAGG - Intronic
933674216 2:85039386-85039408 AAAATGGTTGATAATTGTATGGG + Intronic
934106383 2:88698815-88698837 CAACATGATTAAAATTATATTGG - Intronic
936616340 2:114051543-114051565 CAAAATGAAGTTAATTATCTTGG + Intergenic
936940785 2:117882293-117882315 CAAAATGCTGATAGTGATATGGG + Intergenic
939462207 2:142511706-142511728 CAAATACATAATAATAATATTGG - Intergenic
939624164 2:144456366-144456388 CAATTCGATGATAAGTATGTGGG + Intronic
939949675 2:148455174-148455196 CAGATAAATGATAACTATATTGG + Intronic
940075744 2:149739891-149739913 CAAACTTATGAAAATTATATTGG - Intergenic
940288836 2:152058427-152058449 CAAAATGCTGATAGTGATATGGG + Intronic
941578647 2:167267894-167267916 CAAAATGCTGATAATGATATGGG + Intergenic
941707288 2:168673133-168673155 AAATTTGATGATAATAATTTAGG - Intronic
941770013 2:169335321-169335343 GAAATTGATGATAAACATACAGG + Intronic
941978028 2:171426472-171426494 TAAGTTGATGATAAGTATATGGG + Intronic
941992966 2:171574970-171574992 AAAAATAATGACAATTATATAGG + Intergenic
942568909 2:177293770-177293792 CAAGTTTAGGATAACTATATTGG - Intronic
942694668 2:178627834-178627856 CAAATTCATGATTTATATATAGG - Intronic
943174933 2:184459660-184459682 CAAATCCATTATAATAATATGGG - Intergenic
943227620 2:185200116-185200138 CAAAATTATGATAGATATATAGG - Intergenic
943452468 2:188060950-188060972 CAAATTCAGGACAATTATTTAGG - Intergenic
943742283 2:191422798-191422820 CAATTTGTTGATAATTTAATAGG + Intronic
943785859 2:191877939-191877961 CAAATTGATGAAAGTTTTATGGG - Intergenic
943869299 2:192973631-192973653 TAAACTGCTCATAATTATATTGG + Intergenic
944102885 2:196047433-196047455 CAAGTTGATGATAGTTATGTTGG - Exonic
944756233 2:202764720-202764742 CAAATTGTTGAAAAAGATATTGG - Intronic
945108015 2:206335193-206335215 AAAATTAATCATTATTATATTGG + Intergenic
945443463 2:209908319-209908341 CAAATTGATCAGAATTAGATGGG - Intronic
945515967 2:210763542-210763564 CAAAATGCTGATAGTGATATGGG - Intergenic
946695227 2:222350190-222350212 AAAATTGATGGTAATTCAATAGG - Intergenic
947443079 2:230140392-230140414 CAAAATGCTGATAGTGATATGGG + Intergenic
948148420 2:235726061-235726083 CAAATTAATTATAACAATATGGG - Intronic
1170256830 20:14354074-14354096 CAAAGTGTTGATCATTAGATTGG - Intronic
1170304838 20:14926919-14926941 CAAATTGATGATAATTATATTGG + Intronic
1172194176 20:33080851-33080873 CAGATGGATGATAGATATATGGG + Intronic
1172530517 20:35627688-35627710 CAAATGGATCATTATTAAATAGG - Intronic
1172952764 20:38732402-38732424 AAAAATGATAATAATTATTTGGG - Intergenic
1173321838 20:41994696-41994718 AAAATTGATGATCAAGATATTGG + Intergenic
1174312984 20:49673781-49673803 TAAATTGTTGATAATTATCCAGG - Intronic
1176657789 21:9603282-9603304 CAAAATGCTGATAATGATATGGG - Intergenic
1176721190 21:10394748-10394770 TAAATAGATGATAAATACATAGG - Intergenic
1177234527 21:18370402-18370424 GATATTGATCATCATTATATTGG + Intronic
1177340492 21:19793421-19793443 CAAAATAATGATAAATATATTGG - Intergenic
1177628697 21:23699757-23699779 CAAAATGCTGATAGTGATATGGG + Intergenic
1177688695 21:24475083-24475105 CGAATTTATGATAATTGTAAAGG - Intergenic
1177917457 21:27107468-27107490 CAACTTGATGACAAGTTTATTGG + Intergenic
1178891876 21:36526754-36526776 AAGATTAATGATAATTAAATAGG - Intronic
1179037444 21:37770847-37770869 TTAATAGATGATAATTAGATAGG - Intronic
1179156464 21:38855975-38855997 CAAAATGCTGATAATAATAGGGG + Intergenic
1180302381 22:11047538-11047560 TAAATAGATGATAAATACATAGG - Intergenic
1180527718 22:16311844-16311866 CAATTCGATGATGATTACATTGG + Intergenic
1180529662 22:16337926-16337948 CAATTCAATGATGATTATATTGG + Intergenic
1183013715 22:34968949-34968971 CTAAGTGATAATAATTATTTTGG - Intergenic
1183042008 22:35188265-35188287 CAAATAAATGGTAAATATATGGG + Intergenic
1183810318 22:40251350-40251372 CAAATTGAAAATACTTGTATTGG + Intronic
1203319986 22_KI270737v1_random:47885-47907 CAATTCAATGATGATTATATTGG - Intergenic
1203322081 22_KI270737v1_random:75279-75301 CAATTCGATGATGATTACATTGG - Intergenic
1203327252 22_KI270738v1_random:37188-37210 CAATTCGATGATGATTAAATTGG - Intergenic
1203327884 22_KI270738v1_random:45450-45472 CATTTTGATGATGATTACATTGG - Intergenic
1203329626 22_KI270738v1_random:68272-68294 CAATTCGATGATGATTACATGGG - Intergenic
1203330157 22_KI270738v1_random:75203-75225 CAATTCGATGATGATTACATTGG - Intergenic
950972369 3:17202083-17202105 CAAAATGCTGATAGTGATATAGG + Intronic
951977147 3:28524705-28524727 CAAATTAATTATAAAAATATTGG + Exonic
952026485 3:29088517-29088539 CAAATTGGTGAACAGTATATAGG + Intergenic
952577883 3:34796511-34796533 CAAATTGAAGACAAAAATATTGG + Intergenic
953312737 3:41895413-41895435 ATAATTTATGATAATTATTTAGG + Intronic
954842655 3:53525641-53525663 CAAATATATGGGAATTATATAGG - Intronic
955990791 3:64625234-64625256 CATATTGATGATACCTGTATTGG + Intronic
956419099 3:69066891-69066913 CAAATTGGCCATACTTATATGGG + Intronic
956902799 3:73734288-73734310 TAAATTGATGATAAGTAAACAGG - Intergenic
957618070 3:82558056-82558078 CAACTAGATTATAAATATATTGG - Intergenic
958175210 3:89988865-89988887 CAAAATGCTGATAGTGATATGGG + Intergenic
958455950 3:94331467-94331489 GAAATTAATGAGAATGATATTGG - Intergenic
958940383 3:100306178-100306200 CAATGTGATGATAACTGTATAGG - Intronic
959229615 3:103631667-103631689 CAAAATGCTGATAGTGATATGGG + Intergenic
960352817 3:116613850-116613872 CAAAGTGAAGATTATTATGTGGG + Intronic
960915574 3:122690987-122691009 CATATTAAGGATATTTATATTGG + Intronic
961159409 3:124710270-124710292 AATATTGATTATAATTCTATTGG + Intronic
962272683 3:133989537-133989559 CAAATTGATTTTAATTCCATAGG - Intronic
962946354 3:140174337-140174359 CAAAATGCTGATAGTGATATGGG - Intronic
963201707 3:142592874-142592896 TAAATTGAGGATAATTTCATAGG + Intergenic
963352185 3:144165629-144165651 CAAATTGATGACAACTTGATTGG + Intergenic
963539566 3:146567790-146567812 CAAAATGATGATAGTGATATGGG - Intergenic
963570259 3:146985797-146985819 AAATATGATGATAATTATTTAGG - Intergenic
963628204 3:147700471-147700493 CAAACTGATAATATTTATAAGGG - Intergenic
963650125 3:147968875-147968897 TAAATTGATAAAAATTAAATAGG - Intergenic
963880442 3:150522551-150522573 CAATTTCATTATAATTTTATAGG + Intergenic
964764574 3:160167346-160167368 AACATTTATTATAATTATATGGG + Intergenic
965143746 3:164870851-164870873 CCACTTGAAGATAATTATTTAGG - Intergenic
965687866 3:171324567-171324589 CTAATTGTTGGTAATTAGATGGG + Intronic
965811683 3:172597665-172597687 GAAATTGATGAAAATAATGTTGG - Intergenic
966741890 3:183241868-183241890 CAAAATGCTGATAGTGATATGGG + Intronic
969152176 4:5178814-5178836 CAAAATGCTGATAGTGATATGGG - Intronic
970344116 4:15136635-15136657 CAAAATGCTGATAGTGATATGGG - Intergenic
970659329 4:18266179-18266201 CAAAATGCTGATAGTGATATTGG - Intergenic
970898972 4:21136610-21136632 TAAGTTGATGATAATTCTCTTGG + Intronic
971505013 4:27357144-27357166 CACATTGATGATTAATATCTAGG + Intergenic
971546205 4:27890522-27890544 CAAAATGTTGATAGTGATATGGG + Intergenic
971567991 4:28169369-28169391 CAAATTAGTTATAATTATATTGG - Intergenic
971773959 4:30935969-30935991 TAAATAAATTATAATTATATTGG + Intronic
972101759 4:35428874-35428896 CAAATTGAATATAATTCTGTAGG - Intergenic
972521610 4:39863156-39863178 TAAAAAGAAGATAATTATATGGG + Intronic
972616938 4:40707983-40708005 GAAATAGATGATATTTTTATAGG - Intergenic
972780670 4:42284442-42284464 CAAATTTAGGATAATTTAATAGG - Intergenic
972896022 4:43620928-43620950 CAAAATGCTGATAGTAATATGGG - Intergenic
973537881 4:51902153-51902175 CAAATAGATAAAAATTATACAGG - Intronic
973542180 4:51945708-51945730 CAAAATGCTGATAGTGATATGGG + Intergenic
973805490 4:54522087-54522109 CAAAATGATAAGAATTACATTGG + Intergenic
974124612 4:57680459-57680481 CAATTCTATGATAATTCTATTGG + Intergenic
974384018 4:61181312-61181334 CAAATATATTATAATTATTTAGG + Intergenic
974954211 4:68618731-68618753 CAAATCAAAGATAATTGTATTGG + Intronic
975163854 4:71154440-71154462 CAAATCCATGATAATTTTAGAGG + Intergenic
975176118 4:71290970-71290992 TAAATTGATATTAATTATTTTGG - Intronic
977378230 4:96236707-96236729 CAAAATGCTGATAGTGATATGGG + Intergenic
977576122 4:98675749-98675771 CAACTTGATAATATTTATTTTGG - Intergenic
977717864 4:100203152-100203174 CTAATTTATTATAATTTTATGGG + Intergenic
978099404 4:104819174-104819196 AAAGTTGATGAAAATAATATTGG + Intergenic
979171428 4:117603931-117603953 AAAATTAATAATTATTATATGGG + Intergenic
979469665 4:121079870-121079892 AAAATTGGTGATTATTATATAGG - Intergenic
979996393 4:127436788-127436810 CATATTTATGATAAATATAGTGG - Intergenic
980627612 4:135393653-135393675 CAAATTCATGATAACTTTACAGG - Intergenic
980649489 4:135693099-135693121 GAAATTTATGTTAATAATATGGG - Intergenic
981111849 4:140943888-140943910 CTAATTGGTGATAATGCTATAGG + Intronic
981174130 4:141660802-141660824 CAAATTTATGATAATTCATTAGG + Intronic
981904546 4:149906133-149906155 GAAATTGAGGTTAATGATATAGG - Intergenic
982544919 4:156722368-156722390 CATATTGATCATTATTATACTGG - Intergenic
982720884 4:158858754-158858776 CAAATTGATGATATTTAGGAAGG - Intronic
983320427 4:166190070-166190092 GAAAATGCTGATAATGATATGGG + Intergenic
983660360 4:170125563-170125585 TAAAATGCTGATAATGATATTGG + Intergenic
983766276 4:171488843-171488865 CAAAATGCTGATAGTGATATGGG + Intergenic
983823053 4:172220926-172220948 CAAATTAAACATATTTATATAGG + Intronic
984094409 4:175415962-175415984 TATATTGATTATAAATATATAGG + Intergenic
984131358 4:175879139-175879161 CAAAATGCTAATAATGATATGGG - Intronic
984202385 4:176741353-176741375 AACATTGATGAAAATTATATTGG + Intronic
984524128 4:180836532-180836554 CAAATAGATAAGAATTATCTTGG - Intergenic
985256445 4:188074898-188074920 CAAATTAATTATACTTGTATTGG + Intergenic
985417621 4:189752804-189752826 CAAAATGCTGATAATGATATGGG + Intergenic
986035781 5:3936233-3936255 TTAATTGATTATAATTATGTGGG + Intergenic
986537426 5:8805375-8805397 CAAAATGCTGATAGTAATATGGG + Intergenic
986911693 5:12565592-12565614 CAAAATGTCGATAATGATATTGG - Intergenic
987525186 5:19039689-19039711 AAAATTAATAAAAATTATATTGG + Intergenic
987738225 5:21871944-21871966 CAAGTAGATAATAATGATATTGG + Intronic
987810879 5:22834303-22834325 CTAATTTATAATAATTATAGAGG + Intronic
988038849 5:25861985-25862007 CAAAATGCTGATAGTAATATGGG - Intergenic
988366120 5:30302324-30302346 GAAATTGAATATAATTATTTTGG + Intergenic
989346425 5:40435470-40435492 TATAATGATGACAATTATATGGG - Intergenic
990194591 5:53300376-53300398 AAAATTGATAACAAATATATTGG + Intergenic
990484143 5:56241635-56241657 CAAAATGCTGATAGTGATATGGG + Intergenic
990933762 5:61123977-61123999 CAAAATTATAATAATTATTTGGG + Intronic
991021181 5:61981807-61981829 CTTATTGATGGTGATTATATGGG - Intergenic
991471446 5:66973221-66973243 AAAATTGAACATCATTATATGGG + Intronic
991762427 5:69932129-69932151 ATAATTGATAAGAATTATATGGG - Intergenic
991784898 5:70185977-70185999 ATAATTGATAAGAATTATATGGG + Intergenic
991841655 5:70807179-70807201 ATAATTGATAAGAATTATATGGG - Intergenic
991877345 5:71186372-71186394 ATAATTGATAAGAATTATATGGG + Intergenic
992044673 5:72874329-72874351 CATATTGATGAAAAGTTTATTGG + Intronic
993001036 5:82380593-82380615 CAAAATGCTGATAATGATATGGG - Intronic
993143807 5:84069389-84069411 CAAATTGTTCAAGATTATATAGG - Intronic
993241593 5:85394993-85395015 CATATTGGTTTTAATTATATTGG - Intergenic
993986026 5:94598761-94598783 CAGATCCATGATAATCATATGGG + Intronic
994215201 5:97130044-97130066 AAGATTGATGATAAGGATATTGG - Intronic
994283608 5:97937540-97937562 CAAAATGCTGATAGTGATATGGG + Intergenic
994414583 5:99453063-99453085 CAAAGAAATGATAAATATATGGG + Intergenic
994682528 5:102907069-102907091 GAAATTGATGTTCAATATATAGG + Intronic
994877808 5:105447830-105447852 CAATTTGCTGATAAATATTTGGG + Intergenic
995044944 5:107635064-107635086 CAAATTGATGAAAACTCTAGGGG + Intronic
996020417 5:118585389-118585411 CAAATTATTCATATTTATATTGG - Intergenic
996295209 5:121906161-121906183 TAAATGGATGGTAATTAAATGGG + Intergenic
997958407 5:138298890-138298912 CAAATTTATGAAAATTAAATAGG + Intronic
998546924 5:143036913-143036935 TAAATTGAAGATAATTTTACAGG + Intronic
998686589 5:144534035-144534057 CAATATCATGAAAATTATATTGG + Intergenic
1000487446 5:161865170-161865192 AAAATTGAAGAGACTTATATGGG + Intronic
1000705900 5:164511699-164511721 CTAATTCATTATAATTTTATTGG - Intergenic
1000890563 5:166796781-166796803 ACAATAGATGATAATTATAGGGG - Intergenic
1004450479 6:15740449-15740471 CAAATTGATTAGAAATAAATGGG + Intergenic
1004594197 6:17083738-17083760 CAAGTTGATAATATGTATATTGG - Intergenic
1005112264 6:22295249-22295271 TAATTTGATGATAATTACAAAGG - Intronic
1005176364 6:23049466-23049488 TATATTGATGAAAATTTTATAGG + Intergenic
1005471871 6:26169047-26169069 CAAATTAATGAAATTTAAATTGG + Intronic
1008674162 6:53801751-53801773 CATATTAATAATAATTATAATGG + Intronic
1009635004 6:66253751-66253773 CCAAATGCTGATAATGATATGGG - Intergenic
1009638849 6:66303880-66303902 AAAATTGCTGATAATATTATAGG + Intergenic
1009684553 6:66939187-66939209 AAAATTGATAATAGTTATGTTGG + Intergenic
1010068704 6:71717088-71717110 CAAATTGATTACAATAATAGAGG - Intergenic
1010226169 6:73491441-73491463 CAAACTGATAAAAATGATATAGG - Intronic
1010293875 6:74172965-74172987 CAAGCAGATAATAATTATATTGG + Intergenic
1010631899 6:78208182-78208204 CAAAATGCTGATAGTGATATGGG - Intergenic
1010898661 6:81398728-81398750 TAAATTGATGGTAATGATTTGGG - Intergenic
1010962579 6:82163469-82163491 AAAATTAAAGATAATTATATAGG - Intergenic
1010962739 6:82165068-82165090 AAAATTAAAGATAATTATACAGG + Intergenic
1011389994 6:86841608-86841630 CTAATTAATGATAAGTATACTGG - Intergenic
1012035029 6:94125011-94125033 CATATTGAAGATGATTATACAGG + Intergenic
1012056505 6:94418906-94418928 CAAAATAATGATAAATATATGGG - Intergenic
1012569001 6:100699691-100699713 CAAAATGCTGATAATGATTTGGG + Intronic
1012900876 6:105004720-105004742 CATATTAATGATACTTACATGGG - Intronic
1013890608 6:115021850-115021872 CAAAATGCTGATAATGATATGGG - Intergenic
1013967578 6:115973202-115973224 CTATTTGATGATTATTATATAGG - Intronic
1014046063 6:116888575-116888597 GAAATGGATAATAATCATATAGG + Intronic
1014066200 6:117128953-117128975 CAAATTCATGATGACTATCTTGG - Intergenic
1014579575 6:123120468-123120490 CAATTTCTTGATAATTATTTAGG + Intergenic
1015024192 6:128513778-128513800 CCAGATGATGCTAATTATATTGG + Intronic
1015239511 6:131007621-131007643 CAAAATGCTGATAGTAATATGGG + Intronic
1016512799 6:144862650-144862672 CAAGTTTATGATAATTAGGTTGG + Intergenic
1017163137 6:151384072-151384094 TAAATTGATGAGAATTTTTTAGG - Intronic
1018274150 6:162112316-162112338 GAAACTGATAATAATTTTATAGG + Intronic
1018312143 6:162521848-162521870 CAAATTGATCATAAATATTAGGG + Intronic
1018353373 6:162986690-162986712 CAAAAATATGATAATTAGATAGG + Intronic
1019044117 6:169129627-169129649 CAAATTGCTTATAATTTAATAGG - Intergenic
1019098759 6:169610087-169610109 CAAAATGCTGATAGTGATATGGG - Intronic
1020389392 7:7642089-7642111 CAAGTTGATGTGCATTATATAGG + Intronic
1020933269 7:14427337-14427359 CAAACTGCTGATAGTGATATGGG - Intronic
1021371289 7:19851064-19851086 AAAATTGATAAAAATTCTATAGG + Intergenic
1022967904 7:35490830-35490852 CAACATGATGATAACTATAAAGG + Intergenic
1023466788 7:40464889-40464911 CAATTTAATGATAGTTTTATTGG + Intronic
1024327250 7:48118668-48118690 CAAATTGAAGATAATGTAATTGG + Intergenic
1024383614 7:48726149-48726171 CAATATGCTGATAATGATATGGG - Intergenic
1025316420 7:58036538-58036560 CAATTTGATGATGATTACATTGG - Intergenic
1025316685 7:58039985-58040007 CCATTTGATGATGATTCTATTGG - Intergenic
1025322870 7:58116442-58116464 CAATTCGATGATGATTACATTGG + Intergenic
1025475506 7:60915190-60915212 CAATTCGATGATGATTAAATTGG + Intergenic
1025486333 7:61053832-61053854 CAATTTGATGATGATTACTTTGG - Intergenic
1025555746 7:62306018-62306040 CAATTTGATGATGATTAATTTGG - Intergenic
1025559586 7:62354530-62354552 CAATTCGATGATGATTACATTGG - Intergenic
1025567508 7:62454865-62454887 CAATTAGATGATGATTACATTGG + Intergenic
1026482633 7:70791285-70791307 CAATTGGATGATAATTGTAGCGG + Exonic
1026615544 7:71899620-71899642 CATCTTGATGATATTTATTTTGG + Intronic
1026649430 7:72202334-72202356 AAAATTTATTATATTTATATTGG - Intronic
1027748141 7:82104985-82105007 GAAATTGATGACAAATATTTTGG + Intronic
1028032988 7:85941411-85941433 TATATGCATGATAATTATATTGG - Intergenic
1028181337 7:87728984-87729006 CAAATTAATGAAAATAAAATTGG - Intronic
1028864967 7:95698389-95698411 CAAATTTATAATACTTATATGGG - Intergenic
1028994282 7:97083119-97083141 CAAACTGATGATCACTAGATTGG - Intergenic
1030276958 7:107731707-107731729 CAACTTCATTATAATTTTATGGG + Intergenic
1030465530 7:109898632-109898654 CAAAGAGATGATATTTATGTAGG + Intergenic
1030628256 7:111867588-111867610 CAACTTGAGAATCATTATATTGG - Intronic
1030777932 7:113559103-113559125 TAAATTAATGGTAACTATATTGG + Intergenic
1031226421 7:119043281-119043303 AAAAATCATGATAATTATATTGG - Intergenic
1031259927 7:119506034-119506056 CAAATTAATGAAAATAAAATTGG - Intergenic
1031287355 7:119886618-119886640 CAAAATGCTGATAGTGATATGGG - Intergenic
1031331237 7:120467189-120467211 CAATATGATGAGAATAATATAGG + Intronic
1031649203 7:124265156-124265178 TAAATAAATGATAATTATGTTGG + Intergenic
1032187386 7:129738584-129738606 CACATTGAGCATAATTATTTAGG + Intronic
1033669139 7:143473141-143473163 AAAATTGTTGATAGTTTTATGGG - Intergenic
1034151502 7:148919934-148919956 TATATTAATGATAATAATATTGG + Intergenic
1034510823 7:151533198-151533220 CAAAATGCTGATAATGATATGGG - Intergenic
1035704168 8:1662195-1662217 CAAATCAATGAAAATTATTTTGG - Intronic
1036455239 8:8900968-8900990 AAAATTGAAGAATATTATATTGG + Intergenic
1036689186 8:10931594-10931616 CCAATTGGCCATAATTATATGGG - Intronic
1036893878 8:12615122-12615144 CAAAATGCTGATGGTTATATGGG - Intergenic
1037064876 8:14565989-14566011 CAAATGGATAATAAATCTATGGG + Intronic
1038342913 8:26702997-26703019 AAAATTGATGCTAACTCTATAGG - Intergenic
1039247803 8:35628888-35628910 TAAAATTATAATAATTATATAGG + Intronic
1041778503 8:61551514-61551536 CATATTCATGATAATTAAGTTGG + Intronic
1042729487 8:71915935-71915957 CAAATTAATAATAATGAAATTGG - Intronic
1042756333 8:72216650-72216672 AAATTTGCTGATAATCATATTGG - Intergenic
1042803235 8:72743958-72743980 GAAATTGGTGAAAAATATATAGG - Intronic
1043296638 8:78671661-78671683 GAAATATATGATAATCATATAGG - Intronic
1043737056 8:83761612-83761634 CAAATTGATCATAATGTTCTGGG + Intergenic
1044006066 8:86938238-86938260 CAAAATGCTGATAGTGATATGGG - Intronic
1044395764 8:91709263-91709285 CCAATAAATGATAAATATATAGG + Intergenic
1046527203 8:115395757-115395779 AAAATTGATGATAAATATATGGG - Intergenic
1046571603 8:115973137-115973159 AAAAGTGCTGATAATCATATAGG + Intergenic
1048699932 8:137077441-137077463 CAAAATGTTGATAATGATATGGG + Intergenic
1048806452 8:138245905-138245927 CAAATTGCTGATAGTGATATGGG + Intronic
1050468219 9:5955466-5955488 CAAGATGATTATATTTATATAGG - Intronic
1050470311 9:5981577-5981599 TTAATTGATGATAAATAGATTGG - Intronic
1050666423 9:7942624-7942646 CAAATTGAATACAATTTTATAGG + Intergenic
1050897368 9:10900201-10900223 CAAAATGATGATAGTGATATGGG - Intergenic
1051419793 9:16877657-16877679 CAAATTCATTATAATTTTAGAGG + Intergenic
1052220715 9:26018288-26018310 TAAAATGCTGATAATGATATGGG - Intergenic
1052595959 9:30558700-30558722 CAAATGCATGAGAATCATATGGG + Intergenic
1052676142 9:31627692-31627714 CTAATTGATAATAAAAATATTGG - Intergenic
1053374987 9:37598357-37598379 CATATTGATGGTAATTCTTTTGG + Intronic
1053947866 9:43331996-43332018 CAATTCGATGATGATTACATGGG + Intergenic
1053948799 9:43344998-43345020 CAATTTGATGATGATTACATTGG + Intergenic
1055174510 9:73300395-73300417 CAAAATGCTGATAATGATACGGG - Intergenic
1057285435 9:93749742-93749764 CAAACTGCTGATAGTGATATGGG - Intergenic
1057525792 9:95799483-95799505 TAAATTGATGATAGATGTATGGG - Intergenic
1058257213 9:102782154-102782176 ACAGTTGATGATATTTATATCGG - Intergenic
1058722156 9:107773933-107773955 CAAAATGCTGACAGTTATATGGG - Intergenic
1058779687 9:108320420-108320442 CAAAATGAAGATAGCTATATTGG + Intergenic
1059323877 9:113490730-113490752 TAACTTAATTATAATTATATTGG + Intronic
1059570175 9:115425833-115425855 CTAACTGCTGATAATGATATGGG - Intergenic
1059581816 9:115557151-115557173 CAAAATGCTGATAGTGATATGGG - Intergenic
1059582435 9:115566408-115566430 CAAAATGCTGATAATGATACAGG + Intergenic
1059586134 9:115608691-115608713 CAAAATGAAGTAAATTATATTGG + Intergenic
1060701416 9:125752837-125752859 ACAAAAGATGATAATTATATTGG - Intronic
1203590996 Un_KI270747v1:60554-60576 CAATTCGATGATGATTACATGGG + Intergenic
1203591979 Un_KI270747v1:73199-73221 CAATTTGATGATGATTACATTGG + Intergenic
1203635517 Un_KI270750v1:106856-106878 CAAAATGCTGATAATGATATGGG - Intergenic
1186765044 X:12762094-12762116 GAAATTAGTGATAATTATCTAGG - Intergenic
1187280956 X:17858463-17858485 CAAATTTATGATAAGAAAATAGG - Intronic
1188053064 X:25510192-25510214 CAAAATGCTGATAATGATAATGG - Intergenic
1188191578 X:27177237-27177259 GAAATATATGAGAATTATATAGG - Intergenic
1188348019 X:29092086-29092108 CAAATTGATGAAAATGAGAAGGG - Intronic
1188749163 X:33884559-33884581 CAAAATGCTGATGGTTATATGGG + Intergenic
1189637292 X:43024275-43024297 CAAAATGCTGATAATGATATGGG - Intergenic
1191052379 X:56207635-56207657 CAAAATGCTGATAGTGATATGGG - Intergenic
1191225335 X:58036276-58036298 CAATTTTATGATAATCAAATTGG + Intergenic
1191750011 X:64532336-64532358 GAAATTGAAGACAATTGTATGGG + Intergenic
1191760806 X:64646452-64646474 CAAAATGTTGATAGTAATATGGG + Intergenic
1192302264 X:69917291-69917313 CCAATGGATGATATTTATTTGGG - Intronic
1192412657 X:70948204-70948226 CAAAATGCTGATAGTGATATGGG + Intergenic
1192866881 X:75143376-75143398 CAAAATGCTGATAATGATAATGG - Intronic
1192934990 X:75849954-75849976 AAAAATGCTGATAATGATATGGG - Intergenic
1193273263 X:79554184-79554206 CAAAATGCTGATAGTGATATGGG + Intergenic
1193455122 X:81722457-81722479 CATATTGATTATATTTATGTAGG - Intergenic
1193629391 X:83863615-83863637 TAAATTGAAGATAATTATTATGG - Intronic
1194397788 X:93407249-93407271 CAAATAGTTTATTATTATATAGG - Intergenic
1194611163 X:96047564-96047586 AAAATTGCTGATATTTGTATTGG - Intergenic
1194866018 X:99068189-99068211 CAAATTTGTGATGATTATCTAGG + Intergenic
1197385343 X:125795037-125795059 CAAAATGCTGATAGTAATATGGG + Intergenic
1197486968 X:127064237-127064259 CTAATATATGATAATTTTATAGG - Intergenic
1197497950 X:127209011-127209033 CAAATTTGTGATAATTTTTTAGG - Intergenic
1199264195 X:145811122-145811144 CAAAATGCTGATGATTATTTTGG - Intergenic
1199557907 X:149128940-149128962 CAAATTCATCATAATTAACTAGG + Intergenic
1201664830 Y:16439220-16439242 AAGATTGATGATAATTTCATGGG - Intergenic