ID: 1170308239

View in Genome Browser
Species Human (GRCh38)
Location 20:14963530-14963552
Sequence CTGTTTCAGCACAACACAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 128}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170308239_1170308244 25 Left 1170308239 20:14963530-14963552 CCACTTGTGTTGTGCTGAAACAG 0: 1
1: 0
2: 1
3: 8
4: 128
Right 1170308244 20:14963578-14963600 AACACATTCCCTGCCGGTGGTGG 0: 1
1: 0
2: 0
3: 9
4: 106
1170308239_1170308242 22 Left 1170308239 20:14963530-14963552 CCACTTGTGTTGTGCTGAAACAG 0: 1
1: 0
2: 1
3: 8
4: 128
Right 1170308242 20:14963575-14963597 TCCAACACATTCCCTGCCGGTGG 0: 1
1: 0
2: 1
3: 7
4: 99
1170308239_1170308245 26 Left 1170308239 20:14963530-14963552 CCACTTGTGTTGTGCTGAAACAG 0: 1
1: 0
2: 1
3: 8
4: 128
Right 1170308245 20:14963579-14963601 ACACATTCCCTGCCGGTGGTGGG 0: 1
1: 0
2: 0
3: 7
4: 77
1170308239_1170308241 19 Left 1170308239 20:14963530-14963552 CCACTTGTGTTGTGCTGAAACAG 0: 1
1: 0
2: 1
3: 8
4: 128
Right 1170308241 20:14963572-14963594 GCTTCCAACACATTCCCTGCCGG 0: 1
1: 0
2: 0
3: 15
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170308239 Original CRISPR CTGTTTCAGCACAACACAAG TGG (reversed) Intronic
909507360 1:76408557-76408579 CTGTTTCATGACAACACATTGGG - Intronic
910519275 1:88100156-88100178 ATGTTTTAGCACACCACAAATGG + Intergenic
912851116 1:113125467-113125489 CTGTTTCAGTAAAAAAAAAGAGG - Exonic
916715496 1:167443645-167443667 CAGACTCAGCACAACACAAAGGG + Intronic
922182794 1:223248575-223248597 TTGTTACAACAAAACACAAGTGG - Intronic
922683514 1:227620347-227620369 CTTTTTCAGCACAATGTAAGTGG - Intronic
1065030102 10:21576929-21576951 CTGTTTCAAAACAAAACAATTGG - Intronic
1066465997 10:35650761-35650783 CTGTTGCACCACATGACAAGAGG + Intergenic
1068121180 10:52783404-52783426 CTAATTCATCACAACACAAGTGG + Intergenic
1068130105 10:52885978-52886000 CTGTTTCAGAACAAAACAGAAGG - Intergenic
1069731611 10:70619456-70619478 ATTTTTCAGTACAACAGAAGAGG + Intergenic
1070917749 10:80165668-80165690 CGGTTTAAGAACAACAAAAGTGG - Intronic
1072674611 10:97456425-97456447 CTCTCTCAGCCCAAGACAAGGGG + Intronic
1074732201 10:116391108-116391130 CTGTTACAGCCCAACAAAATGGG - Intergenic
1075177751 10:120181621-120181643 CTGTTTCAGCACAAGAAAGCAGG + Intergenic
1077888049 11:6400755-6400777 CTGGTTCAGCACCACTCACGTGG + Intronic
1081388282 11:42499227-42499249 CTGTATGAGCCCAACACAATAGG + Intergenic
1085486478 11:76868000-76868022 CTGCTGCAGCACAAGACAAAAGG + Intronic
1086770152 11:90752315-90752337 CTGTTTCTCCACCACACCAGAGG - Intergenic
1089699098 11:120233789-120233811 CTGCCTCAGCACCACACATGTGG + Intergenic
1090641341 11:128731420-128731442 CTTTTGCACCACAAAACAAGAGG + Intronic
1090929578 11:131283543-131283565 CCTTTCCAGCACAACACAGGCGG - Intergenic
1091975968 12:4825634-4825656 CCGTTTCTGAACAACTCAAGAGG - Intronic
1091994819 12:4985119-4985141 CAGTTTCATCACAGCATAAGAGG - Intergenic
1097152435 12:56988776-56988798 CTGAGTCAGCTCCACACAAGTGG + Intergenic
1099506536 12:83483987-83484009 TTTTGTCAGCACAATACAAGTGG + Intergenic
1107893103 13:44931279-44931301 CTGTGTCAGCAAAAAACAAAAGG + Intergenic
1108371800 13:49777289-49777311 CTGTTTCAGAAACACAAAAGGGG - Intronic
1110835239 13:80075065-80075087 CTGTTTCATAACCACACAACAGG + Intergenic
1116169181 14:41376728-41376750 ATATTTCAGCACAACACAACCGG + Intergenic
1118224481 14:63886065-63886087 CTGTGTTAGCACAACACAGGTGG - Intronic
1118535771 14:66762656-66762678 CTGTTTCAGCACTATACCTGAGG - Intronic
1120812734 14:88821062-88821084 CATTTTAAGCACAAAACAAGTGG + Intergenic
1124231109 15:27947213-27947235 GTTTTTCAGCAAAACTCAAGAGG + Intronic
1125966168 15:43877201-43877223 CTATTTCAGGGCAACAGAAGGGG - Intronic
1132032754 15:98451799-98451821 ATGCTTCTGCACGACACAAGGGG + Intronic
1132199732 15:99943250-99943272 CTGTGTCAGAACATCAAAAGGGG - Intergenic
1139562771 16:67754373-67754395 ATGTATCAGGACAACACAGGAGG - Intronic
1143165542 17:4895604-4895626 CTCTGTCAGCATACCACAAGGGG - Intronic
1144725422 17:17499506-17499528 CTGTCTCAGGACACCACAACAGG - Intergenic
1152426014 17:80219233-80219255 CTGTTTCCTCACATGACAAGCGG - Intronic
1157600148 18:48888706-48888728 CTGTGACAGCAGCACACAAGGGG - Intergenic
1158096573 18:53778818-53778840 CTCTTTCAGCAAAATATAAGTGG + Intergenic
1159256107 18:65948296-65948318 CTGTTTTTGCAAAACTCAAGTGG + Intergenic
1160579793 18:79877056-79877078 CTGTTTCAAAACAGCACAACAGG - Intronic
1168314248 19:55477141-55477163 CTGGTTTAGCTCAACAAAAGTGG + Intronic
927579428 2:24228730-24228752 CTGTGTCAGCAGAACAAAAAGGG + Intronic
943084123 2:183292019-183292041 CCTTTGCAGCACAACACAGGAGG - Intergenic
944973360 2:205019752-205019774 AAGTTTCAGCACAACAAAGGCGG + Intronic
946818787 2:223609147-223609169 ATATTTCAGCCCAATACAAGGGG - Intergenic
947005929 2:225511071-225511093 CTGTTTCATCACAGCACAAAAGG - Intronic
947333029 2:229050408-229050430 CTGTTTCACCACAGAACAAGGGG - Intronic
1170308239 20:14963530-14963552 CTGTTTCAGCACAACACAAGTGG - Intronic
1171200427 20:23236583-23236605 CTGTTTCAGAAAAACACATCTGG + Intergenic
1173365252 20:42379368-42379390 CTGTTTAATCATAACAGAAGAGG + Intronic
1174453338 20:50632932-50632954 CTGGCTCAGCACAGCACAGGAGG - Intronic
1175201783 20:57283177-57283199 CAGTTTCATCAGAACAAAAGAGG - Intergenic
1176966320 21:15216584-15216606 CTGTTTTAACACAACTCTAGTGG - Intergenic
1177027361 21:15936091-15936113 CTGTGTCATGACAACAGAAGGGG + Intergenic
1177297410 21:19194413-19194435 CTGTTTCGGCACTAGTCAAGTGG - Intergenic
1180785499 22:18544924-18544946 CTGTGTCAACACAGCAAAAGGGG - Intergenic
1180945630 22:19691287-19691309 ATGTTTCATCAAAACACCAGAGG + Intergenic
1181129085 22:20718966-20718988 CTGTGTCAACACAGCAAAAGGGG - Intronic
1181242404 22:21484277-21484299 CTGTGTCAACACAGCAAAAGGGG - Intergenic
1184518901 22:44980684-44980706 CACTTTCCACACAACACAAGTGG + Intronic
952263907 3:31767204-31767226 CTGCATGAGCAAAACACAAGAGG - Intronic
953080405 3:39611385-39611407 ATGTATTAGAACAACACAAGGGG + Intergenic
954220963 3:49153708-49153730 GTGTGTCAGCACAACACAGCTGG - Intergenic
959783674 3:110267395-110267417 CTGTTTCAGAAAAACATATGTGG - Intergenic
961653096 3:128426975-128426997 CTATTTCAGCTCAATACAAAAGG - Intergenic
961808172 3:129504063-129504085 CTGTTTCTGGACCACAGAAGCGG - Intronic
962100577 3:132337946-132337968 CATTTTCAGCACAATACAAAAGG + Intronic
965689839 3:171343882-171343904 TTGTTTCAGTAAAACAAAAGGGG + Intronic
972751848 4:41996735-41996757 CTGTCTCAGAAAAACACAGGTGG + Intronic
974264731 4:59570373-59570395 ATTTTTCAGCACAACACAAGTGG + Intergenic
977713756 4:100157449-100157471 CTATTTCAGCTCAACTCAAAAGG + Intergenic
978387587 4:108191439-108191461 ATGTTTAAGCACAGCACAAGCGG - Intergenic
980132785 4:128832163-128832185 CTGGTTCAACTCAATACAAGGGG + Intronic
980459510 4:133089373-133089395 TTTGTTCAGCACTACACAAGAGG + Intergenic
982303405 4:153903425-153903447 ATGTCTCAGCACATCAAAAGTGG - Intergenic
985119089 4:186621798-186621820 ATGTTACAGAAAAACACAAGGGG + Intronic
987236788 5:15950644-15950666 CTGTTTCAGCACAAAGTCAGAGG - Intergenic
988854997 5:35219850-35219872 CTGTTTTAGTTCAAAACAAGGGG + Intronic
989384301 5:40839034-40839056 CTGTTTCAAAACAAAACAAAAGG + Intergenic
992141609 5:73802766-73802788 GTGTTTCAACACAAGAAAAGGGG - Intronic
995676518 5:114668534-114668556 CTCTTTCAGAACAAAAAAAGTGG + Intergenic
996437347 5:123449472-123449494 CTCTTACAGGACAACACAAATGG + Intergenic
997092221 5:130871228-130871250 CCAGTTCAGCACAGCACAAGTGG + Intergenic
1000201060 5:159011544-159011566 CTGTTTCAGCAGAATGGAAGCGG + Intronic
1003048264 6:2755900-2755922 CTTTTTCAGAACATCACAAAAGG + Intergenic
1008554982 6:52665306-52665328 CTGTTTCACCACAATTGAAGAGG + Intergenic
1010183651 6:73117725-73117747 CTGTGTCATCACAACATTAGAGG + Intronic
1010670679 6:78682634-78682656 CTTTTGCAGCAGAACACAATTGG - Intergenic
1013678984 6:112501738-112501760 TTGCTTCAGTACATCACAAGAGG + Intergenic
1014992433 6:128098045-128098067 ATTTTTCAGAACAACATAAGAGG - Intronic
1015803335 6:137082908-137082930 CTGTTTCAACAGAACAGAAAAGG - Intergenic
1016405120 6:143721584-143721606 TTGTTTCAGGCCAACACAAAAGG - Intronic
1016407266 6:143743682-143743704 CACTTTCAACACAAGACAAGTGG + Intronic
1017503829 6:155049132-155049154 CTGTTTAAACACAAAACCAGAGG + Intronic
1018898705 6:168039819-168039841 CTGTTTCAGAACAAAATCAGAGG - Intronic
1020482066 7:8673900-8673922 CTGTTTGAGCCTAAAACAAGGGG + Intronic
1021594660 7:22302298-22302320 CTGTTTCAGCAGAAGCCATGTGG + Intronic
1027450564 7:78326620-78326642 TTGTTTCAGAACGACAGAAGGGG + Intronic
1031328587 7:120434241-120434263 CAGTTTGAGTAAAACACAAGAGG + Intronic
1034255448 7:149722399-149722421 CTGTTGCAGGAGAAGACAAGAGG - Intronic
1037344632 8:17885768-17885790 CTGTTTCATCACAAAAACAGAGG + Intronic
1038681922 8:29676603-29676625 CTGTTACAGCACAAGAAAATGGG - Intergenic
1043074577 8:75682311-75682333 CTGTGTCTGCACAGCAGAAGGGG - Intergenic
1044066338 8:87704212-87704234 CTGATCCAGCACAATACCAGTGG + Intergenic
1045764637 8:105652181-105652203 CTGTTTCAGCTCTTCACTAGGGG + Intronic
1047024902 8:120813676-120813698 CTGATTCTGCACATCACAAAGGG - Intergenic
1050254309 9:3778272-3778294 CTGTTTCAGAAAAACACAACTGG + Intergenic
1056171378 9:83988306-83988328 CTGTTTCAAAACAAAACAAAAGG - Intronic
1059790759 9:117639539-117639561 CTGATTCAGCCCTACAAAAGAGG - Intergenic
1203734973 Un_GL000216v2:128606-128628 CTGTTGTAGCATAACTCAAGAGG - Intergenic
1186027739 X:5332172-5332194 CTGTGTCAGCAATACAGAAGTGG - Intergenic
1187342129 X:18430742-18430764 CTGTATTAGCACACAACAAGCGG - Intronic
1189075991 X:37915103-37915125 CTGTCTCAGCACAGCACACAGGG + Intronic
1192304888 X:69948665-69948687 CTGTGACAGCACTACACAATAGG - Intronic
1194527087 X:94990105-94990127 CTGTTTTAGCAAAAGACTAGTGG - Intergenic
1194555316 X:95351321-95351343 CACTTTCATCACAACACAACTGG + Intergenic
1195849047 X:109263730-109263752 CTGACTCAGCACAGCACTAGTGG - Intergenic
1196594772 X:117532516-117532538 CTGTTTCAGTAAAAGAAAAGGGG - Intergenic
1196986433 X:121277965-121277987 CTGTTTCAGCTGAATACAACAGG - Intergenic
1197230050 X:123993987-123994009 CTGTTACAGCAAAACACAAATGG - Intronic
1197297912 X:124741752-124741774 CTATTTCAGCTCACCACATGTGG - Intronic
1197583438 X:128313313-128313335 CTGTTTCCTCACAACAGCAGGGG - Intergenic
1199753845 X:150846317-150846339 CTGTTCCAGGGCAACACATGAGG + Intronic
1200684983 Y:6250062-6250084 GTGTGTCTGCACAAGACAAGGGG + Intergenic
1200990513 Y:9341332-9341354 GTGTGTCTGCACAAGACAAGGGG + Intergenic
1200993175 Y:9361649-9361671 GTGTGTCTGCACAAGACAAGGGG + Intronic
1200995829 Y:9381920-9381942 GTGTGTCTGCACAAGACAAGGGG + Intergenic
1200998493 Y:9402272-9402294 GTGTGTCTGCACAAGACAAGGGG + Intergenic
1201001003 Y:9470802-9470824 GTGTGTCTGCACAAGACAAGGGG + Intronic
1201003670 Y:9491130-9491152 GTGTGTCTGCACAAGACAAGGGG + Intergenic
1201006326 Y:9511411-9511433 GTGTGTCTGCACAAGACAAGGGG + Intergenic
1201008984 Y:9531721-9531743 GTGTGTCTGCACAAGACAAGGGG + Intergenic
1202626057 Y:56859942-56859964 CTGTTGTAGCATAACTCAAGAGG + Intergenic