ID: 1170309482

View in Genome Browser
Species Human (GRCh38)
Location 20:14976497-14976519
Sequence GTGTAATCACTGTCATCTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 135}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170309477_1170309482 2 Left 1170309477 20:14976472-14976494 CCATGTGATAACACTGGGCCCAC 0: 2
1: 52
2: 216
3: 459
4: 767
Right 1170309482 20:14976497-14976519 GTGTAATCACTGTCATCTCAGGG 0: 1
1: 0
2: 2
3: 7
4: 135
1170309473_1170309482 16 Left 1170309473 20:14976458-14976480 CCCTTGTACAAGGACCATGTGAT 0: 1
1: 0
2: 1
3: 10
4: 181
Right 1170309482 20:14976497-14976519 GTGTAATCACTGTCATCTCAGGG 0: 1
1: 0
2: 2
3: 7
4: 135
1170309474_1170309482 15 Left 1170309474 20:14976459-14976481 CCTTGTACAAGGACCATGTGATA 0: 1
1: 0
2: 0
3: 9
4: 106
Right 1170309482 20:14976497-14976519 GTGTAATCACTGTCATCTCAGGG 0: 1
1: 0
2: 2
3: 7
4: 135
1170309472_1170309482 23 Left 1170309472 20:14976451-14976473 CCTGGGTCCCTTGTACAAGGACC No data
Right 1170309482 20:14976497-14976519 GTGTAATCACTGTCATCTCAGGG 0: 1
1: 0
2: 2
3: 7
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170309482 Original CRISPR GTGTAATCACTGTCATCTCA GGG Intronic
903683641 1:25114810-25114832 GTGTATTCAATGTAATCGCAGGG - Intergenic
903806717 1:26010899-26010921 GTTTGAACACTGTCAGCTCAGGG + Intergenic
905291697 1:36926098-36926120 GAGGAATCACTGTGATCTCAGGG - Intronic
906172230 1:43736105-43736127 GAGTTATCACTTTCATATCATGG - Intronic
909243687 1:73249262-73249284 TTGTTATCACCGTCATCTGATGG + Intergenic
909288850 1:73856529-73856551 GTTTAAACACAGTCATTTCATGG - Intergenic
910005109 1:82386965-82386987 GTGTGCACACAGTCATCTCAGGG - Intergenic
911458485 1:98158280-98158302 GGATAATAACTGTCATCTCTGGG + Intergenic
915825545 1:159072161-159072183 GTGTAGTTACTGCCATCTAAGGG + Intronic
915933925 1:160078863-160078885 CTGTCATCACCATCATCTCAGGG - Intergenic
920629002 1:207633405-207633427 GTGCAATCAATATAATCTCAAGG - Intronic
922757752 1:228105897-228105919 TTATAAGCACTGTCATCACAGGG + Intergenic
924165500 1:241277661-241277683 GTGTAAGCATTGCCATCCCAGGG + Intronic
1062787344 10:276270-276292 GTGAAATTATTGCCATCTCAAGG - Exonic
1063240828 10:4167611-4167633 GTGGAAGCACTGCCATCCCAGGG + Intergenic
1063416416 10:5876198-5876220 TTATAATCACTGCCATCTCTGGG + Intronic
1067257127 10:44652310-44652332 TTGAAATCAATGACATCTCATGG - Intergenic
1068341274 10:55706681-55706703 GTCAAACCACTGTTATCTCAAGG + Intergenic
1072333691 10:94378216-94378238 AAGTAATCACTGTCTTCTAATGG + Intergenic
1074525903 10:114262983-114263005 GTGGAATCACTGTCTGCTCTTGG + Intronic
1074550212 10:114435779-114435801 GTGAAATCACTGCCACCCCATGG + Intronic
1075340024 10:121639587-121639609 GAGTAATGACTATGATCTCAAGG - Intergenic
1075385650 10:122053539-122053561 GTGTGGTCACTGGCATCACAGGG - Intronic
1077736233 11:4794582-4794604 TTGCAATCATTGTCAGCTCAGGG + Intronic
1078968918 11:16382787-16382809 GTGGAATCATTGTCAACTCCAGG + Intronic
1079024279 11:16933756-16933778 ATGTAATCAGTGGCATCTCATGG + Intronic
1083152660 11:60802309-60802331 ATGTTAACACTGTAATCTCAGGG - Intergenic
1086290062 11:85298251-85298273 GAGTAATCAGTGTGAACTCATGG + Intronic
1088956136 11:114616319-114616341 GTGTAACCACTGTTACCTGATGG + Intergenic
1093926958 12:24918173-24918195 GTTTACTTACTGTCTTCTCATGG - Intronic
1095548477 12:43402196-43402218 GTGTAATAACTATCAGCTGATGG + Intronic
1095877254 12:47094402-47094424 GTGTAATCACTGACATCATTGGG + Intronic
1098790836 12:74819848-74819870 CTTTTATCACTGTTATCTCAAGG + Intergenic
1108839001 13:54588541-54588563 CTGTAAACACTGGCATCTTAAGG - Intergenic
1110153808 13:72289001-72289023 GAGTAAACACTGTCATTTTATGG + Intergenic
1110707909 13:78616043-78616065 GGGTTATCAAAGTCATCTCAAGG - Exonic
1116071585 14:40053557-40053579 GTGTTATGAATGACATCTCAGGG - Intergenic
1122080076 14:99261023-99261045 GTGAACACCCTGTCATCTCAGGG - Intronic
1125758289 15:42080877-42080899 GTGTGATCATTGTGATCTGATGG - Intronic
1126435285 15:48631393-48631415 CTGTTATCACTGTCCTCTCTAGG - Intronic
1130095680 15:80854114-80854136 GAGGTAGCACTGTCATCTCAGGG - Intronic
1132312305 15:100866105-100866127 GTCTAAACACTGACCTCTCATGG - Intergenic
1135009439 16:18861608-18861630 GTGCAACCACTGGCTTCTCAGGG + Intronic
1135316477 16:21450533-21450555 GTGCAACCACTGGCTTCTCAGGG + Intergenic
1135369399 16:21882782-21882804 GTGCAACCACTGGCTTCTCAGGG + Intergenic
1135442414 16:22488349-22488371 GTGCAACCACTGGCTTCTCAGGG - Intronic
1136313147 16:29429243-29429265 GTGCAACCACTGGCTTCTCAGGG + Intergenic
1136325792 16:29523085-29523107 GTCTAACCACAGTCATATCAGGG + Intergenic
1136326590 16:29531011-29531033 GTGCAACCACTGGCTTCTCAGGG + Intergenic
1136440481 16:30263068-30263090 GTCTAACCACAGTCATATCAGGG + Intergenic
1136441280 16:30270996-30271018 GTGCAACCACTGGCTTCTCAGGG + Intergenic
1136475515 16:30510794-30510816 ATCTAATCACCATCATCTCAGGG - Intronic
1139392934 16:66616868-66616890 GTGTCAGCACTGTCATCCTAAGG + Exonic
1139887780 16:70223314-70223336 GTGCAACCACTGGCTTCTCAGGG + Intergenic
1146940496 17:36840854-36840876 CTGGAATCTCTGTCATCACATGG + Intergenic
1149207347 17:54264034-54264056 GAGTAATCTCAGTCATGTCAGGG - Intergenic
1153322419 18:3786104-3786126 GTGAGATCAATGTCATCTGAGGG - Intronic
1157835475 18:50898221-50898243 CTGTAATCACTGTATACTCAAGG + Intronic
1160057913 18:75503011-75503033 GAGTAAACAGTGTCATCACAAGG + Intergenic
1161588341 19:5117504-5117526 TTGTCACCACTGTCATCCCAAGG - Intronic
1162935835 19:13981064-13981086 ATGTACTCACTGGAATCTCATGG + Intronic
1167118097 19:47499888-47499910 CTATTGTCACTGTCATCTCAGGG - Intronic
1167352372 19:48983467-48983489 GTTTAATCATTTCCATCTCAGGG - Intronic
925965063 2:9057382-9057404 CTGTAATAACTGTCAATTCATGG + Intergenic
928399642 2:30968629-30968651 TTGTAGCCACTGTCATCTGAAGG - Intronic
931598024 2:63971613-63971635 ATGTAATCACTGTCAACTCTAGG + Intronic
937924250 2:127155334-127155356 GTTCAATCCCTGTCTTCTCAAGG - Intergenic
938875482 2:135527829-135527851 GTGTAAACAGTGGCATCTCTTGG + Intronic
938903826 2:135820303-135820325 TTGTAATCACTGGCTTTTCAGGG + Intronic
939077400 2:137620539-137620561 GTCAAATCACTGTCCTTTCATGG - Intronic
940348666 2:152656397-152656419 TTGTAATCAATGTCTTTTCAGGG - Exonic
941281393 2:163556082-163556104 GCGAAATCACTGTCATCTTGGGG - Intergenic
941555125 2:166969069-166969091 GTGTAGTCACTTTCTCCTCATGG + Intronic
945607539 2:211954214-211954236 CTGTAATCACTTTAATCTTAAGG - Intronic
947295606 2:228627262-228627284 GTCAAATCCCTGTCATCCCATGG - Intergenic
948084183 2:235232682-235232704 GTGACAACATTGTCATCTCATGG - Intergenic
1170309482 20:14976497-14976519 GTGTAATCACTGTCATCTCAGGG + Intronic
1173659598 20:44724213-44724235 CTGTCATCACTGTCAGGTCAGGG - Intronic
1179532937 21:42032506-42032528 CTGTAACCAGTGACATCTCATGG - Intergenic
1182009531 22:26989003-26989025 GTGTATTAACAGTTATCTCATGG - Intergenic
1182180920 22:28347508-28347530 GTGTAAACGCGGTGATCTCAGGG - Intronic
949689745 3:6621938-6621960 TTTTAATCACTGTATTCTCAGGG - Intergenic
950095227 3:10325139-10325161 TTGTAATTACTGTCCACTCAGGG - Exonic
955825350 3:62940427-62940449 CTGTAATCACTGACACCTCTAGG + Intergenic
956353165 3:68361035-68361057 CTTTAATTACTGTCATCTAAAGG + Intronic
956585974 3:70865422-70865444 GTGGAACCACTGTAATCACAAGG - Intergenic
956858155 3:73296112-73296134 GTATAATCACTGTCAGCCCAAGG + Intergenic
959519459 3:107308821-107308843 CTGAAATCACTGTCAAATCAGGG - Intergenic
961434471 3:126907057-126907079 GTGGAAACACGGTCATCTGATGG + Intronic
965190925 3:165528642-165528664 GTGTGAGCACTGGAATCTCATGG + Intergenic
965813721 3:172615808-172615830 GTGAAATCACTGATATTTCATGG - Intergenic
967455712 3:189684116-189684138 GAGTAATCTCTGTAATCTTAAGG - Intronic
969863137 4:10053291-10053313 GTGGATCCACTGTCATCACAAGG + Intronic
969957248 4:10903513-10903535 GTGAAGTTACTGTGATCTCAGGG + Intergenic
970059918 4:12021204-12021226 GTATTATCAATTTCATCTCATGG + Intergenic
973174771 4:47191603-47191625 GTGAAAACACTGTTATCTAAGGG - Intronic
976372913 4:84310856-84310878 GGGTCATGACTGTAATCTCATGG + Intergenic
979350570 4:119639888-119639910 GCGTAATCACTTTCATATTATGG + Intergenic
979666014 4:123311810-123311832 CTGTAATCACTGGAACCTCAGGG - Intronic
986252947 5:6077590-6077612 GTGTAATTTCTGTCAAGTCATGG - Intergenic
990572130 5:57089660-57089682 TTGCAATCACAGTCAGCTCAGGG + Intergenic
991599321 5:68336685-68336707 GTGAAATCAATGTAATCACAAGG + Intergenic
993191759 5:84692175-84692197 GTTTAAGAACTGTCTTCTCAAGG + Intergenic
993525337 5:88958647-88958669 GTGAAATAACTGTCATTTGAAGG - Intergenic
993942731 5:94080359-94080381 GTGTTATTACTGTTATTTCATGG - Intronic
995023843 5:107396960-107396982 GTGTCATCACTGTCATGTCTGGG - Intronic
997202500 5:132020103-132020125 GTGTCATCACTGAGAGCTCATGG - Intergenic
997925304 5:138025258-138025280 TTGTAATCACTGTTATCTCATGG - Intronic
998980227 5:147694345-147694367 GTGGAGTCACAGTCATATCATGG + Intronic
1005571908 6:27153473-27153495 GTGAAATCACAGCCAGCTCATGG + Intergenic
1008299884 6:49823323-49823345 GTCTAATTTCTGTCATCTCTAGG - Intergenic
1008451090 6:51651704-51651726 TTGTGATCACTTTCATTTCAGGG - Intronic
1015906424 6:138122044-138122066 GTGTAATCACTGACATCCCAGGG + Intergenic
1016020447 6:139231444-139231466 TTGTAACCACTGTCATTCCAGGG + Intergenic
1017006438 6:150030863-150030885 GTGTGATCACTGCCCTCCCATGG + Intergenic
1018483458 6:164215316-164215338 CTGTACTCACTGTCCTCACATGG - Intergenic
1019138113 6:169924688-169924710 TTGTCATCACTGTCATCACCAGG + Intergenic
1021792345 7:24218170-24218192 TTGGACTCACTGTCATCTAATGG + Intergenic
1022811978 7:33878579-33878601 CTGGGTTCACTGTCATCTCACGG - Intergenic
1026322174 7:69277463-69277485 GCATAATCACTTTCATCCCAGGG - Intergenic
1027630706 7:80601550-80601572 GAGTAATAACTTTCATCACAGGG + Intronic
1027991164 7:85362045-85362067 TTGTAATCACTTTCACATCATGG - Intergenic
1037317756 8:17615083-17615105 GTCTCATCATTGCCATCTCACGG + Intronic
1037621055 8:20563796-20563818 CTGGAATCACTGTCTTCTCCAGG + Intergenic
1038992904 8:32888941-32888963 CTGTACCCACTGTCCTCTCATGG + Intergenic
1044226874 8:89729276-89729298 GTGTAATCTAGGTCATCACAGGG - Intergenic
1049606282 8:143530614-143530636 GAGTCATGCCTGTCATCTCAGGG + Intronic
1050962949 9:11760144-11760166 CTGTAATCTGTATCATCTCATGG + Intergenic
1052120103 9:24703804-24703826 CTAAAATCACTGTCATCACAAGG + Intergenic
1053370834 9:37560372-37560394 GTTTAGTCACTGGCCTCTCAGGG + Intronic
1055842389 9:80520342-80520364 GTGTGCTCAATGTAATCTCAAGG + Intergenic
1058175352 9:101729558-101729580 GTGTACTCAATGTCATCACAAGG - Intronic
1058981601 9:110175500-110175522 GTATAGTCACTGCCCTCTCATGG - Intergenic
1186509453 X:10119537-10119559 GTGTAGACACTGCCATCTCGTGG + Intronic
1187098043 X:16167564-16167586 GTGTACTCAGTGTCCTCTCCGGG - Exonic
1188137153 X:26504696-26504718 GAGTAAGCACTGTCATGCCAGGG - Intergenic
1188867337 X:35329074-35329096 CTGAAATCACTGTCATCTTAGGG + Intergenic
1189558924 X:42172774-42172796 GGGTAATCAATTTCAACTCAGGG + Intergenic
1190796956 X:53754893-53754915 CTAAAAGCACTGTCATCTCATGG - Intergenic
1191252015 X:58264291-58264313 GGGAAATCACGGTCATCTGAGGG - Intergenic
1193124510 X:77856858-77856880 GTCTAATCACTCTAATCTAATGG + Exonic
1195526075 X:105890866-105890888 ATTTTATCACTGTCATCTCCAGG - Intronic
1198801608 X:140453447-140453469 CTGAAACCACTATCATCTCAGGG - Intergenic
1200010106 X:153114360-153114382 GTGTCTTCACAGACATCTCAGGG - Intergenic
1200029494 X:153285562-153285584 GTGTCTTCACAGACATCTCAGGG + Intergenic