ID: 1170310523

View in Genome Browser
Species Human (GRCh38)
Location 20:14986372-14986394
Sequence CCGGTGGCTGCACATTTTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 170}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170310519_1170310523 -8 Left 1170310519 20:14986357-14986379 CCTCACCTAAGGTTCCCGGTGGC 0: 1
1: 0
2: 0
3: 6
4: 58
Right 1170310523 20:14986372-14986394 CCGGTGGCTGCACATTTTTGTGG 0: 1
1: 0
2: 1
3: 11
4: 170
1170310515_1170310523 23 Left 1170310515 20:14986326-14986348 CCAAGTGTCTGACACAGTTGAGC 0: 1
1: 0
2: 2
3: 8
4: 155
Right 1170310523 20:14986372-14986394 CCGGTGGCTGCACATTTTTGTGG 0: 1
1: 0
2: 1
3: 11
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170310523 Original CRISPR CCGGTGGCTGCACATTTTTG TGG Intronic
900828185 1:4943404-4943426 CCGCTGGCTGCTGATTTCTGTGG + Intergenic
900931258 1:5739276-5739298 CCGGTGGCTGCAGATCTGTGCGG - Intergenic
900998384 1:6134981-6135003 CCGGTGGCTTCACCTCTTGGGGG - Intronic
903360993 1:22777032-22777054 CCCGTGGCTGCAGAGCTTTGGGG + Intronic
909124433 1:71648068-71648090 CAGTTGGCTGCATATTTTTCAGG - Intronic
917791022 1:178498887-178498909 ACTGTGGCAGGACATTTTTGTGG - Intergenic
921083947 1:211769603-211769625 CTGCTGGCTGCCCATTTTTATGG + Intronic
921355656 1:214281794-214281816 CCCGTGGCTGCCCAAATTTGGGG - Intronic
922693543 1:227713608-227713630 CCGTGGGTTGCACAGTTTTGTGG - Intergenic
1063973229 10:11396068-11396090 CCAGTGGCTGCAGATATGTGGGG - Intergenic
1066162296 10:32746746-32746768 CAGGTGGGTGCACATTGGTGGGG - Intronic
1066298191 10:34074590-34074612 CCGCTGTCTGTACATTGTTGTGG + Intergenic
1067688508 10:48483345-48483367 CCGGAGGTTGCAAATTTTTGGGG - Intronic
1076371314 10:129957165-129957187 CCAGTTGCTCCATATTTTTGAGG - Intronic
1079140774 11:17807997-17808019 CTTGTGGCTGCACATTCTAGGGG - Intronic
1079717932 11:23771565-23771587 CTGCTGGTTGCACATTTTTATGG + Intergenic
1086081649 11:82909138-82909160 CTGCTGGCTGCCCATTTTTATGG + Intronic
1087119483 11:94558730-94558752 CTGCTGGTTGCCCATTTTTGTGG - Intronic
1087991402 11:104748279-104748301 CTGCTGGTTGCACATTTTTATGG - Intergenic
1088196310 11:107277785-107277807 ACAATGGCTGCAGATTTTTGAGG - Intergenic
1091125428 11:133091383-133091405 CTGGTGGCTGTACAGTTCTGTGG - Intronic
1091501774 12:1024465-1024487 CCTGTGTGTTCACATTTTTGAGG + Intronic
1092853392 12:12650959-12650981 CTGCTGGTTGCCCATTTTTGTGG - Intergenic
1093711360 12:22333780-22333802 CAGGTGTCTGCACATCTCTGGGG + Intronic
1095320457 12:40819823-40819845 CCGTGGGTTGCACATTTCTGTGG + Intronic
1098316079 12:69194576-69194598 CTGGTGGTTGCCCATTTTTATGG - Intergenic
1104216703 12:126740913-126740935 CAGGAGGCTGGACATTTTGGGGG + Intergenic
1105053851 12:133079796-133079818 CTGCTGGTTGCGCATTTTTGTGG - Intergenic
1106272291 13:28166535-28166557 CTGGTGGCTGCACAGTTCTGAGG + Intronic
1110342873 13:74413627-74413649 CCTGTGGGTGCGCATGTTTGGGG + Intergenic
1115428755 14:33291625-33291647 CCGCTGGCTTTATATTTTTGAGG + Intronic
1117438913 14:55742473-55742495 CCAGTTTCTGCACACTTTTGAGG + Intergenic
1119034680 14:71219530-71219552 CTGCTGGCTGCCCATTTTTATGG + Intergenic
1119085872 14:71738430-71738452 CCGGTGCCTGCATGTGTTTGGGG + Intronic
1120865876 14:89294810-89294832 CTGCTGGCTGCCCATTTTTATGG - Intronic
1121149432 14:91618049-91618071 CTGGTGGTTGCCCATTTTTATGG + Intronic
1124032660 15:26025765-26025787 CTGCTGGTTGCCCATTTTTGTGG + Intergenic
1127977160 15:64006249-64006271 CAGGTGGCTACACATCTTGGTGG - Intronic
1128148777 15:65348192-65348214 CTGGTGGTTGCTCATTTTTATGG - Intronic
1133674401 16:8057001-8057023 CCGGTGTCTCCTCATTTTTCTGG + Intergenic
1133942962 16:10325723-10325745 CTGCTGGTTGCCCATTTTTGTGG + Intergenic
1135120320 16:19760837-19760859 CTGCTGGCTGCCCATTTTTATGG + Intronic
1135497147 16:22962651-22962673 CCGGTGGCTCTACTATTTTGGGG + Intergenic
1138292696 16:55861491-55861513 CAGGTGGTTGCACATTTCTGTGG - Exonic
1139066553 16:63322722-63322744 CTGCTGGTTGCACATTTTTATGG - Intergenic
1141403396 16:83770598-83770620 CTGCTGGTTGCCCATTTTTGAGG + Intronic
1146664397 17:34687805-34687827 CCAGTGGCTCCACACTTTTAAGG + Intergenic
1150844264 17:68639094-68639116 CTGCTGGTTGCCCATTTTTGTGG - Intergenic
1151401675 17:73859765-73859787 CCGCTGGTTGCCCATTTTTATGG - Intergenic
1151402055 17:73862199-73862221 CCGCTGGTTGCCCATTTTTATGG + Intergenic
1154155626 18:11942036-11942058 CTGGTGGTTGCCCATTTTTATGG - Intergenic
1154426504 18:14276163-14276185 CCGGAGGCTGCACAGTTTGGGGG + Intergenic
1154429243 18:14295752-14295774 CCGGAGGCTGCACAGTTTGGGGG + Intergenic
1154431515 18:14312101-14312123 CCGGAGGCTGCACAGTTTGGGGG + Intergenic
1154434196 18:14331404-14331426 CCGGAGGCTGCACAGTTTGGGGG + Intergenic
1155456726 18:26024320-26024342 GTGATGGCTGCACTTTTTTGGGG + Intronic
1155558571 18:27049968-27049990 CCGGAGCCTGCACTTTGTTGAGG - Intronic
1158445827 18:57519708-57519730 AAAATGGCTGCACATTTTTGTGG - Intergenic
1159638885 18:70839965-70839987 CTGTTGGTTGCCCATTTTTGTGG + Intergenic
1160390104 18:78523623-78523645 TCTGTGGCTGCACATTGTGGAGG - Intergenic
1161612511 19:5251056-5251078 CCGGAGGCTGCACAATTTCTTGG - Intronic
1164000132 19:21090800-21090822 CTGATGGTTGCACATTTTTATGG + Intronic
1167845663 19:52162194-52162216 CCGGTGACTCTACAGTTTTGGGG + Intronic
926245908 2:11122288-11122310 CTGCTGGCTGCACATTTTTATGG + Intergenic
928942273 2:36738490-36738512 CCTGTGGCAACACAGTTTTGGGG - Intronic
931018328 2:58012214-58012236 CTGCTGGTTGCCCATTTTTGTGG - Intronic
932819279 2:74885936-74885958 CTGCTGGTTGCACATTTTTATGG + Intronic
932827468 2:74955057-74955079 CTGCTGGTTGCCCATTTTTGTGG - Intergenic
933228734 2:79781111-79781133 CTGCTGGTTGCTCATTTTTGTGG + Intronic
934994518 2:98945019-98945041 CTGGAGACTGTACATTTTTGTGG - Intergenic
935596881 2:104885735-104885757 CTGCTGGTTGCCCATTTTTGTGG - Intergenic
935637039 2:105257055-105257077 CTGCTGGCTGCCCATTTTTATGG - Intergenic
935886160 2:107621699-107621721 CAGCTGGTTGCCCATTTTTGTGG - Intergenic
938092641 2:128443427-128443449 CTGCTGGTTGCCCATTTTTGTGG + Intergenic
938984414 2:136560090-136560112 CCAGTGGCTGCACATTCCTGTGG + Intergenic
940773105 2:157859399-157859421 CTGCTGGTTGCCCATTTTTGTGG - Intronic
943329141 2:186537837-186537859 CCTGTTGCTCCACATTCTTGTGG + Intergenic
944718663 2:202401345-202401367 CCAGTAGGTGCACATTTTTCTGG + Intronic
946952103 2:224887345-224887367 CCCTTTGGTGCACATTTTTGAGG - Intronic
947873148 2:233450738-233450760 CGAGTGGGTGCACATGTTTGGGG - Intronic
1170310523 20:14986372-14986394 CCGGTGGCTGCACATTTTTGTGG + Intronic
1170614366 20:17937094-17937116 CAGGTGGCTGGACATTTATCTGG - Intergenic
1170635060 20:18096973-18096995 CTGCTGGTTGCCCATTTTTGTGG - Intergenic
1172006062 20:31819828-31819850 CTGGTGGCTTCACATTTTCCTGG - Intronic
1172362320 20:34321895-34321917 CCGCTGGTTGCCCATTTTTATGG - Intergenic
1175144803 20:56887446-56887468 CTGCTGGTTGCACATTTTTATGG - Intergenic
1175572067 20:60031009-60031031 CTGCTGGTTGCACATTTTTATGG + Intronic
1176845519 21:13873665-13873687 CCGGACGCTGCACAGTTTGGGGG - Intergenic
1176848251 21:13893216-13893238 CCGGACGCTGCACAGTTTGGGGG - Intergenic
1177420768 21:20853718-20853740 TTGGTGGCTGCACATTATCGAGG - Intergenic
1178901126 21:36599785-36599807 TCAGTGTCTGCACACTTTTGAGG - Intergenic
1178904783 21:36627502-36627524 TGGGTGGCTGCACATATTTCTGG - Intergenic
1179394718 21:41028259-41028281 CCAAGGGCTGCCCATTTTTGTGG + Intergenic
1179444589 21:41422379-41422401 CTGCTGGTTGCCCATTTTTGTGG - Intronic
1180990700 22:19934055-19934077 CCTGTGGGTGCACATTTTGGGGG - Intronic
949785185 3:7732896-7732918 CCGCTGGTTGCCCATTTTTATGG + Intronic
950782464 3:15403807-15403829 CTGCTGGTTGCCCATTTTTGTGG + Intronic
958038359 3:88195955-88195977 CTGCTGGTTGCCCATTTTTGTGG + Intergenic
958896764 3:99838250-99838272 CCCGTGCCTGCCCATTTGTGTGG + Intronic
959956528 3:112244689-112244711 TCTGAGGCTACACATTTTTGGGG + Intronic
961561463 3:127733327-127733349 CTGGTGGGTGCCCATTTTTATGG - Intronic
964741847 3:159974842-159974864 CCGGAGGTTGCAAATTTTTTTGG - Intergenic
964778843 3:160312292-160312314 CAGGTGGCTGTAGATTTTTTTGG + Intronic
965142717 3:164860704-164860726 CTGCTGGTTGCCCATTTTTGTGG - Intergenic
966502293 3:180656942-180656964 CTGGTGGTTGCCCATTTTTATGG - Intronic
966539701 3:181075490-181075512 CCGGGGGTTGCACAGTTCTGTGG + Intergenic
968846287 4:3043582-3043604 CTGCTGGCTGCCCATTTTTATGG - Intergenic
969420449 4:7091292-7091314 CTGCTGGCTGCCCATTTTTATGG + Intergenic
970469856 4:16366832-16366854 GGGCTGGCTCCACATTTTTGTGG + Intergenic
971452323 4:26811670-26811692 CTGCTGGTTGCCCATTTTTGTGG + Intergenic
972612569 4:40669138-40669160 CCGGTTCCTGCACAGTTTTCTGG - Intergenic
974525737 4:63047840-63047862 CTGGTGGCTCTACATTTCTGAGG + Intergenic
974985306 4:69016902-69016924 CCTGTGTTTGCACATATTTGAGG + Intronic
976970606 4:91097127-91097149 CCGATGGTTGGGCATTTTTGAGG - Intronic
978054709 4:104249227-104249249 TTGGTGGCTGCACATTGGTGGGG + Intergenic
979863459 4:125723605-125723627 GCGGTGGCTGCACAGTGATGGGG + Intergenic
980106338 4:128592006-128592028 TGGGTGGCCCCACATTTTTGAGG - Intergenic
982707153 4:158723092-158723114 CCGGTGACTGCTCAGTTTCGCGG - Intronic
983221842 4:165051330-165051352 CTGCTGGCTGCCCATTTTTATGG - Intergenic
987715540 5:21564678-21564700 CCTTTGGGTGCACATTCTTGAGG - Intergenic
990420289 5:55625287-55625309 CTGCTGGCTGCCCATTTTTATGG - Intergenic
990600153 5:57350347-57350369 CTGCTGGTTGCACATTTTTATGG + Intergenic
992447028 5:76843483-76843505 CTGGTGGTTGCCCATTTTTATGG + Intergenic
996684840 5:126268831-126268853 CTGCTGGCTGCCCATTTTTATGG + Intergenic
996946579 5:129077716-129077738 CTGGTGGCAGCAAATTTTTAAGG + Intergenic
997341325 5:133147320-133147342 CTGCTGGCTGCCCATTTTTATGG - Intergenic
999172963 5:149610972-149610994 CAGGTGACTGCAGATATTTGAGG - Intronic
999347779 5:150839702-150839724 CTGATGGATGTACATTTTTGGGG + Intergenic
1001972705 5:175969133-175969155 CCGCTGGTTGCGCATTTTTATGG - Intronic
1002244733 5:177874649-177874671 CCGCTGGTTGCGCATTTTTATGG + Intergenic
1008911611 6:56739864-56739886 CTGCTGGTTGCTCATTTTTGTGG - Intronic
1009001186 6:57717372-57717394 CCTTTGGGTGCACATTCTTGAGG + Intergenic
1009692038 6:67047838-67047860 TCAGAGGGTGCACATTTTTGTGG - Intergenic
1009719495 6:67448890-67448912 TTTGTGGCTGCACAATTTTGGGG + Intergenic
1012070478 6:94607465-94607487 CAAGGGGGTGCACATTTTTGTGG + Intergenic
1012411531 6:98963810-98963832 CTGGGTCCTGCACATTTTTGAGG - Intergenic
1014004737 6:116405302-116405324 GCTGTGGCTCCACATGTTTGAGG - Intronic
1015632624 6:135246711-135246733 CCGCTGGTTGCCCATTTTTATGG + Intergenic
1016006324 6:139092599-139092621 CTGATGGCTGCCCATTTTTATGG - Intergenic
1017115038 6:150968120-150968142 ACGGGGGCTGCACATTCCTGTGG - Intronic
1018357223 6:163030450-163030472 GCGGTAGCTGCTGATTTTTGTGG - Intronic
1018357637 6:163034927-163034949 CTGTTGGTTGCCCATTTTTGTGG + Intronic
1018463365 6:164020204-164020226 GCGGTGGCTGCAGCTTTTCGGGG + Intergenic
1019545390 7:1571983-1572005 CTGCTGGTTGCCCATTTTTGTGG + Intergenic
1019810148 7:3159159-3159181 CTGCTGGTTGCCCATTTTTGTGG + Intronic
1020804571 7:12772675-12772697 CCGCTGGTTGCCCATTTTTATGG + Intergenic
1021593574 7:22291054-22291076 CCTGTGGCTGCTCATCATTGTGG - Intronic
1021820616 7:24494382-24494404 CAGCTGACTGCACTTTTTTGAGG - Intergenic
1023245588 7:38199943-38199965 CCCGTGGCTGCAGGTTCTTGAGG - Intronic
1024484814 7:49906066-49906088 CCACTGGCTGCCCATTTTTATGG - Intronic
1026293144 7:69026792-69026814 CCTGTGTCTGCCCATTTTTAGGG - Intergenic
1026861271 7:73791566-73791588 CTGCTGGTTGCCCATTTTTGTGG - Intergenic
1032928299 7:136635554-136635576 CCAGTGACTGTACTTTTTTGAGG - Intergenic
1033154458 7:138944930-138944952 CCTGTGGCTGCACACTACTGTGG + Intronic
1033351508 7:140566016-140566038 CTGCTGGTTGCCCATTTTTGTGG - Intronic
1034064987 7:148127504-148127526 CCGCTGCCTGCACATTTTTGTGG - Intronic
1035924850 8:3716377-3716399 CCGCTGGTTGCCCATTTTTATGG + Intronic
1037367608 8:18139692-18139714 CTGCTGGTTGCTCATTTTTGTGG + Intergenic
1038645714 8:29360160-29360182 CTGCTGGCTGCCCATTTTTATGG - Intergenic
1038655585 8:29448179-29448201 CTGCTGGCTGCCCATTTTTATGG - Intergenic
1041403771 8:57473616-57473638 CTGATGGCTCCACATTTCTGGGG + Intergenic
1042309605 8:67367106-67367128 CCGCTGGTTGCCCATTTTTATGG - Intergenic
1044038671 8:87337627-87337649 CTGTTGGTTGCACACTTTTGTGG + Intronic
1044280864 8:90354478-90354500 ACTGTGGCTGCACATTTTCTAGG + Intergenic
1045253150 8:100497924-100497946 CTGCTGGCTGCCCATTTTTATGG + Intergenic
1045290567 8:100829032-100829054 CCGCTGGTTGCCCATTTTTATGG - Intergenic
1047572423 8:126114033-126114055 CCTGTGACTGCCCATTTGTGTGG - Intergenic
1049199287 8:141331995-141332017 CCTGTTGCTGCCCATTCTTGTGG - Intergenic
1053200167 9:36146886-36146908 CCGGTAGCTCCACAGTTCTGGGG + Intronic
1053666107 9:40318805-40318827 CCGCAGGCTGCACAGTTTGGAGG + Intronic
1054518502 9:66057478-66057500 CCGCAGGCTGCACAGTTTGGAGG - Intergenic
1056469892 9:86895067-86895089 CTGCTGGTTGCCCATTTTTGTGG - Intergenic
1056739488 9:89241849-89241871 CTGCTGGTTGCACATTTTTATGG - Intergenic
1057642273 9:96835934-96835956 CTGGTGGCTCTACAATTTTGGGG - Intronic
1058118963 9:101117562-101117584 CTGCTGGCTGCCCATTTTTATGG - Intronic
1186299670 X:8186249-8186271 TCAGTGGCAGCTCATTTTTGAGG + Intergenic
1186564524 X:10647966-10647988 CCTGTGGCTGGAGATTATTGAGG - Intronic
1190815157 X:53923333-53923355 CTGCTGGTTGCACATTTTTATGG - Intergenic
1194539446 X:95153045-95153067 CTGGTGGCTGTACAATTCTGAGG + Intergenic
1195879182 X:109574987-109575009 CCGGTGGCTCTACAATTCTGGGG - Intergenic
1196829599 X:119765754-119765776 CTGGTGGCTGCACTATTCTGTGG - Intergenic
1197974130 X:132147267-132147289 CCAGTGGCTGTACATCATTGGGG + Intergenic
1198577626 X:138027065-138027087 CTGCTGGTTGCCCATTTTTGTGG - Intergenic