ID: 1170315685

View in Genome Browser
Species Human (GRCh38)
Location 20:15039035-15039057
Sequence CCTATTAGGTCCTTTGTTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 89}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170315685 Original CRISPR CCTATTAGGTCCTTTGTTAC AGG (reversed) Intronic
901670770 1:10855319-10855341 CCTATAAGGTCCTTTCGTACTGG - Intergenic
907362414 1:53929264-53929286 CCTATTAGGCCCTTTTACACAGG + Intronic
912220390 1:107667296-107667318 CCTAGTCCATCCTTTGTTACTGG - Intronic
915505658 1:156354563-156354585 CCTATTAGGGTCTTTGATATAGG + Intronic
921114874 1:212080366-212080388 ACTAGTATGTCTTTTGTTACTGG - Intronic
924940650 1:248810837-248810859 CCTCTTACTTCCTTTGTTACAGG - Exonic
1062918022 10:1256850-1256872 CCTATTTGTTCCTTTGATATGGG - Intronic
1065001484 10:21341574-21341596 CCTATGAGGTCCTTTCTAACTGG + Intergenic
1068645241 10:59458721-59458743 AGTATATGGTCCTTTGTTACTGG + Intergenic
1069549443 10:69352611-69352633 AATATTAGGTCCTTTGTGTCTGG - Intronic
1071280535 10:84098415-84098437 CCAATTAGGTCAGATGTTACTGG - Intergenic
1080922526 11:36723258-36723280 CATACTAAGTCCTTTGTTTCAGG + Intergenic
1083122154 11:60524329-60524351 CCAATTCTGTACTTTGTTACAGG - Intronic
1085101296 11:73802569-73802591 AATATTTGGTCCTTTGTGACTGG + Intronic
1085491125 11:76918388-76918410 CCTATAACTTTCTTTGTTACTGG + Intronic
1086628194 11:88985020-88985042 TTTATTAAGTCCTTTGATACAGG + Intronic
1089976679 11:122738296-122738318 ACTATTAGGGACTTTGTTAGTGG + Intronic
1091580260 12:1782859-1782881 CCCATTAGGTCATTTGTTAAAGG + Intronic
1093688337 12:22082007-22082029 CCAATTTGGTCCTGTGTTTCTGG - Intronic
1095195794 12:39315170-39315192 CCTGTAAGGTCTTTTGATACTGG + Intronic
1096997924 12:55850887-55850909 CCTATTAGGTCCTGTCTGGCTGG - Intergenic
1097030966 12:56088986-56089008 TCTTTCAGGTCCTTTGTAACAGG - Intronic
1100413314 12:94345400-94345422 CGTATTAGGCCCTTTGTTTATGG + Intronic
1107630117 13:42334400-42334422 CCTTTGAGGTCCTTTCTTGCTGG + Intergenic
1109490422 13:63090621-63090643 CCTAATTGGTCCTTTGTTGTAGG + Intergenic
1114299704 14:21364247-21364269 CCTATGTGGTCTTTTGTGACTGG - Intronic
1115346585 14:32349020-32349042 CCCTCTAGGACCTTTGTTACTGG + Intronic
1124203914 15:27701588-27701610 TCTAATAGGTCCTATGTTAAAGG + Intergenic
1127499131 15:59540670-59540692 CCTATGTGGTCTTTTGTGACTGG - Intergenic
1132261251 15:100426935-100426957 TCAATTGGGTCCTTTGATACGGG + Intronic
1140520568 16:75577464-75577486 CCTATTAGTGCATTTGTAACTGG + Exonic
1141014358 16:80434606-80434628 CTTATTAGTTCACTTGTTACTGG - Intergenic
1141883584 16:86876094-86876116 AATATTGGGTCCTTTGTGACTGG - Intergenic
1144468753 17:15518202-15518224 CCTATTGGGTTCTCTGTGACAGG - Intronic
1146538918 17:33677981-33678003 CCTGTTAAATCCTTTGTTAAAGG + Intronic
1149750608 17:59141907-59141929 CCTGGTAGGACCTTTGCTACTGG + Intronic
1155096926 18:22565113-22565135 ACTATTTGCCCCTTTGTTACTGG + Intergenic
1165981372 19:39727107-39727129 CATATTAACTCCTCTGTTACTGG - Intergenic
930913976 2:56665187-56665209 CCTTTTAGTTGCTTTGTTAGTGG + Intergenic
931811509 2:65858927-65858949 CCTCTTAGATCCTTTCTTTCAGG - Intergenic
932122157 2:69111950-69111972 CCTATTGTTTCCTTTGTTATGGG + Intronic
932183045 2:69666728-69666750 TATATGTGGTCCTTTGTTACTGG - Intronic
932881701 2:75507850-75507872 CCTAAGAGGACCTTTGTTGCGGG + Intronic
933170426 2:79118826-79118848 CCTACTATATCCTTTGTTAACGG + Intergenic
933220710 2:79684549-79684571 CCTATGAAGTCATTTGTTATTGG + Intronic
935443958 2:103137089-103137111 CCTATCATCTCCTTTGTGACAGG - Intergenic
936723142 2:115278387-115278409 CCTTTTAGATCCGTTGTTACAGG + Intronic
939885907 2:147681624-147681646 CCTATTATGTCCTTTATTCGAGG - Intergenic
941000571 2:160198625-160198647 CCTATTTGGCACTTTGTCACTGG + Intronic
944848289 2:203690867-203690889 CATAAAAGGTCCTTTGTCACTGG + Intergenic
945088043 2:206153644-206153666 CCTACTAAGGCCTTTCTTACAGG + Exonic
1169330398 20:4711644-4711666 CCTATGTGGTCTTTTGTGACTGG - Intergenic
1170182192 20:13544250-13544272 CCTATGAGGTCATTTGGTACTGG + Intronic
1170315685 20:15039035-15039057 CCTATTAGGTCCTTTGTTACAGG - Intronic
1177408564 21:20701398-20701420 CACAGTAGGTCCTGTGTTACAGG + Intergenic
1180717653 22:17882702-17882724 CCCGTTAGGTTCTTTGGTACAGG - Intronic
954420330 3:50415593-50415615 CCCATCAGGTCCTCTGTTCCAGG + Intronic
955067925 3:55548362-55548384 ACTATTTGGTCAGTTGTTACAGG + Intronic
957418512 3:79937379-79937401 GATATTAGGTCCTTTTTTAATGG + Intergenic
957597842 3:82290231-82290253 CCAACTTTGTCCTTTGTTACTGG - Intergenic
959466802 3:106698294-106698316 CCTAATAGGAGCTTTGTTAGTGG - Intergenic
961855084 3:129862100-129862122 CATATGTGGTCCTTTGTGACTGG - Intronic
965433674 3:168620638-168620660 TCTATTAGGCCCTTTTTTTCTGG + Intergenic
974874399 4:67685626-67685648 CCCATTAGGTCCTACGTAACGGG - Intronic
976160355 4:82192190-82192212 CCTATTATGTCCCGTGCTACAGG + Intergenic
979025371 4:115566648-115566670 TCTATTAGCTTCCTTGTTACAGG + Intergenic
983065589 4:163206535-163206557 CCTATGAAGTCCTTTATTTCTGG - Intergenic
984950573 4:185004737-185004759 CCTCTAAGGGCCTTTGTTCCTGG - Intergenic
984994228 4:185412854-185412876 CTTATAAGGTCCTTTCTCACTGG + Intronic
986948565 5:13053423-13053445 TCTGTTGGGTCATTTGTTACAGG + Intergenic
987620076 5:20329102-20329124 GCTATTAGCTCCTTTGTTTTGGG - Intronic
988102282 5:26695738-26695760 CCTATTAGGTCCTTTTGGTCTGG - Intergenic
994604590 5:101951966-101951988 CCTGTTAGGTCCCCAGTTACTGG + Intergenic
999758936 5:154685366-154685388 CCTATTAGGTCCTTTGGCCATGG + Intergenic
999775222 5:154807074-154807096 TGTATGTGGTCCTTTGTTACTGG + Intronic
1002411871 5:179085945-179085967 GATATGTGGTCCTTTGTTACTGG - Intergenic
1008929629 6:56924994-56925016 ACTTTTCAGTCCTTTGTTACAGG - Intronic
1014140782 6:117939626-117939648 CCCTTTAGGTCCTTTTTAACTGG - Intronic
1021025765 7:15664954-15664976 ACTATTAAGTCCTTTGAAACAGG - Intronic
1023239138 7:38123789-38123811 CCAGTTAGGTCCTCTGTTTCAGG - Intergenic
1028366481 7:90038291-90038313 TCTTTTAAGCCCTTTGTTACAGG + Intergenic
1030043745 7:105475940-105475962 CATATTTGTTCTTTTGTTACTGG + Intronic
1031128062 7:117797009-117797031 GCTATTGGCTCCTTTCTTACAGG - Intronic
1031687894 7:124754772-124754794 CCTATTATGTCAGTGGTTACAGG + Intronic
1032303664 7:130712909-130712931 CCTATTAGTTCCTTTTTCTCTGG + Intergenic
1033384267 7:140856163-140856185 CCTATTAAGTATTATGTTACTGG - Intronic
1038583732 8:28771466-28771488 CTTATTAGGTGCTCTGTTGCTGG + Intronic
1043101407 8:76052031-76052053 ACTATGAGGTCATGTGTTACTGG - Intergenic
1043293243 8:78630426-78630448 CCTCCTCTGTCCTTTGTTACAGG - Intergenic
1050364028 9:4857359-4857381 ACTATCTGGTCCTTTGTGACTGG + Intronic
1053191352 9:36072729-36072751 CCTATTAGGTCCTGCAGTACTGG + Intronic
1055194743 9:73575467-73575489 CCTTTTAGCTACTTTATTACAGG + Intergenic
1187939485 X:24367884-24367906 CCTACTTGGTACTTTGATACAGG + Intergenic
1191011736 X:55767156-55767178 CCTAATCGGTCCTTTCTGACAGG + Intergenic
1193061374 X:77211738-77211760 CCCATTAGATTCTTTTTTACTGG + Intergenic
1193180888 X:78455228-78455250 CCACTCAGGTCCTTTGTTACTGG - Intergenic
1195725301 X:107909037-107909059 CCTATCAGGTAATTTTTTACTGG + Intronic
1197898667 X:131344389-131344411 CCTATTAGGTACTTTATTAATGG - Intronic