ID: 1170315685

View in Genome Browser
Species Human (GRCh38)
Location 20:15039035-15039057
Sequence CCTATTAGGTCCTTTGTTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170315685 Original CRISPR CCTATTAGGTCCTTTGTTAC AGG (reversed) Intronic