ID: 1170317895

View in Genome Browser
Species Human (GRCh38)
Location 20:15062202-15062224
Sequence CAGCCTCAGGAGAAAGAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 686
Summary {0: 1, 1: 0, 2: 10, 3: 82, 4: 593}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170317892_1170317895 -7 Left 1170317892 20:15062186-15062208 CCTGAAAATAGGTAAACAGCCTC 0: 1
1: 0
2: 2
3: 9
4: 166
Right 1170317895 20:15062202-15062224 CAGCCTCAGGAGAAAGAGGCTGG 0: 1
1: 0
2: 10
3: 82
4: 593

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170317895 Original CRISPR CAGCCTCAGGAGAAAGAGGC TGG Intronic
900231396 1:1560390-1560412 CAGCCTGGGGAGACCGAGGCAGG - Intronic
900304948 1:2001147-2001169 GAGCCTGAGAAGAAAGAGGGCGG + Intronic
900875821 1:5341780-5341802 CAGGCACAGGAGAGAGGGGCTGG + Intergenic
900929325 1:5726364-5726386 CAGCTGCAGGAGCAAGGGGCAGG + Intergenic
900929432 1:5726920-5726942 CAGCTGCAGGAGCAAGGGGCAGG - Intergenic
901238063 1:7678168-7678190 AAGCCTCTCGAGAAAGAGGACGG + Intronic
901421546 1:9154538-9154560 CTGACTCAGGAGGAAGAGGAAGG - Intergenic
902395331 1:16129378-16129400 CAGCCTCTGGAGTGGGAGGCGGG + Intronic
902441561 1:16433443-16433465 AACCCTAATGAGAAAGAGGCTGG - Intronic
902512895 1:16975779-16975801 CAGCCTCAGGTGGGTGAGGCTGG - Intronic
903065330 1:20696490-20696512 CCGCCCCACGAGAAGGAGGCAGG + Intronic
903182793 1:21613497-21613519 CAGCCTCAGGATAGGGCGGCAGG + Intronic
903350913 1:22716122-22716144 GGGGCTCTGGAGAAAGAGGCAGG - Intronic
903370178 1:22830222-22830244 CAGCCTCTGGGGACAAAGGCTGG - Intronic
903670768 1:25034180-25034202 CAGCCCCAGCAGGAAGTGGCTGG + Intergenic
903770518 1:25760911-25760933 CAGCTGGAGCAGAAAGAGGCTGG - Intronic
904118656 1:28180554-28180576 CAGCCTCCGGGGCAAGAGGTGGG + Intronic
904715046 1:32461390-32461412 CAGCACTAGGAGAACGAGGCAGG - Intergenic
904766583 1:32853358-32853380 CAGCCTCAGGAGGCTGAGGCAGG + Intronic
905117934 1:35658745-35658767 CCTCCTCAGGAGACTGAGGCTGG + Intergenic
905146168 1:35888407-35888429 CAGCTACAAGACAAAGAGGCTGG - Exonic
905540960 1:38760125-38760147 CAGCCTTAGCAGAAAGAGGCTGG - Intergenic
906184478 1:43851149-43851171 CAGCTTCGGGTGGAAGAGGCGGG + Intronic
906465117 1:46071580-46071602 CAGACTCAGGAGGCTGAGGCAGG + Intronic
906574054 1:46871712-46871734 GCGACTCAGGAGACAGAGGCAGG - Intergenic
907050238 1:51325378-51325400 CAGCCTCTGAAGAGAGGGGCAGG - Intronic
907132943 1:52112966-52112988 TAGCCTCAGGAGGCTGAGGCAGG - Intergenic
907143585 1:52211591-52211613 CAGCCTCAGGAGGCTGAGGCCGG + Intronic
908233617 1:62129825-62129847 CAGCTACAGGAGGATGAGGCAGG + Intronic
908375974 1:63541674-63541696 CAGCCTCAGGAGGCTGAGGTAGG - Intronic
909728535 1:78866019-78866041 CTACCTCAGGAGACTGAGGCAGG - Intergenic
909800796 1:79805445-79805467 CAGCCTCAAGATTAAGAGGAGGG - Intergenic
909961317 1:81847170-81847192 CAGCCGCAGAAGAAAGATGATGG + Intronic
910421548 1:87069082-87069104 CAGGCTGAGGAGGAAGAGGTGGG + Intronic
911167405 1:94736158-94736180 CAGCCACAGGAGAATGGGGGTGG - Intergenic
911704762 1:100998395-100998417 CAGCCTCAGGAGGCTGAGGCAGG + Intronic
911742823 1:101405914-101405936 GAGGCTCAAGAGAGAGAGGCAGG - Intergenic
912302717 1:108534459-108534481 CAACCTTAGCAGACAGAGGCTGG - Intergenic
912417615 1:109520805-109520827 CAGACTCAGGAGATTGAAGCGGG - Intergenic
912550987 1:110485128-110485150 CTGCCACAGGAAGAAGAGGCGGG - Intergenic
912693144 1:111819705-111819727 CAGCCTGAGGAGACACAAGCAGG - Intronic
912950318 1:114116262-114116284 CTGCCTCAGGGGAAGGAGGGAGG + Intronic
913004567 1:114616278-114616300 GCTTCTCAGGAGAAAGAGGCAGG + Intronic
913466510 1:119148598-119148620 CCACCACAGGAGTAAGAGGCGGG + Intergenic
913582741 1:120243060-120243082 GAGGAGCAGGAGAAAGAGGCAGG - Intergenic
913625432 1:120655300-120655322 GAGGAGCAGGAGAAAGAGGCAGG + Intergenic
914245289 1:145881171-145881193 CAGCTACAGGAGACTGAGGCAGG + Intronic
914448174 1:147768009-147768031 CAGCCTCAGGAGAAATGATCAGG + Intronic
914564671 1:148854554-148854576 GAGGAGCAGGAGAAAGAGGCAGG - Intronic
914608155 1:149275688-149275710 GAGGAGCAGGAGAAAGAGGCAGG + Intergenic
914932742 1:151949472-151949494 CAGCCACAGGAGCAGGAGGCTGG + Intergenic
914998646 1:152566501-152566523 CTGCCTGAGTAGAAAGAGGATGG + Intronic
914999998 1:152580230-152580252 CAGCCTGAGTAGAAAGAGGATGG + Intronic
915471512 1:156128503-156128525 CAGCCTGAGCTGAAAGAAGCTGG - Intronic
916193015 1:162197576-162197598 AAGCCTGTGGAGAAAGAGCCTGG + Intronic
916215480 1:162389858-162389880 CAGGCTCAGGATAAAGTGGGGGG - Intergenic
916487484 1:165272468-165272490 CAGACTGAGGGGGAAGAGGCAGG - Intronic
916891709 1:169118191-169118213 CAGCCACAGGAAGAAGAGGACGG + Intronic
917812729 1:178675391-178675413 CACCCTCAGGAGGCTGAGGCAGG + Intergenic
919354358 1:196502003-196502025 CAGACTCAGGAAGCAGAGGCAGG + Intronic
919535042 1:198776886-198776908 CCACCTCATGAGAAAGAGGAAGG + Intergenic
920128038 1:203709298-203709320 CAGCCTCCAGAGAAGGAGGGAGG + Exonic
920378735 1:205523432-205523454 CTCCCTCAGGACAGAGAGGCAGG + Intronic
920408764 1:205741050-205741072 CCGCCTCAGGAGGCCGAGGCGGG + Intronic
920413697 1:205783291-205783313 AACCCTCAGGACAGAGAGGCTGG + Intergenic
920742779 1:208597288-208597310 CAGCCTCCAGAGAAGAAGGCTGG + Intergenic
920928146 1:210362354-210362376 CATGGTCAGGAGAATGAGGCAGG - Intronic
922292332 1:224218731-224218753 CCTCCTCAGGAGACTGAGGCAGG + Intergenic
922368298 1:224886350-224886372 CAGGCTAAGGAGGAAGAGGGAGG - Intergenic
922912400 1:229228594-229228616 CAGCTTCAGGAGACTGAGGGGGG + Intergenic
924403647 1:243718559-243718581 CAGCCTCGGGAGGCTGAGGCAGG - Intronic
1063176701 10:3557241-3557263 CACCTTCTGGAGCAAGAGGCTGG + Intergenic
1063412798 10:5849671-5849693 CAGCTTCAGGAGACTGAAGCGGG - Intergenic
1063445159 10:6108861-6108883 CGGCCTCAGGTGACAGAGCCAGG - Intronic
1063721679 10:8588658-8588680 CCGGCAAAGGAGAAAGAGGCAGG + Intergenic
1064803222 10:19099872-19099894 CAGCCTCGGGAGGCTGAGGCAGG - Intronic
1065478833 10:26171713-26171735 CTGCCTCAGGAGCAGGAGGCTGG + Intronic
1065542631 10:26785380-26785402 CTCCCTCAGGAGTAAAAGGCAGG + Intronic
1065708288 10:28491366-28491388 CAGCCTCAATAGAGAGAGGGAGG + Intergenic
1067662588 10:48247585-48247607 CATCCACAAGAGAAAGAGGAGGG + Intronic
1068331450 10:55576358-55576380 CAGGCTGAGGAGAAAGAGGAAGG + Intronic
1069422544 10:68260348-68260370 AAGCCCCAGGAGGATGAGGCTGG - Intergenic
1069624631 10:69860211-69860233 CAGCCTCAGGACGAAGTGTCAGG + Intronic
1070151804 10:73809981-73810003 CAGACTCAGGAGGCTGAGGCCGG - Intronic
1070379746 10:75870008-75870030 CAGCCCCAGGTGAGAAAGGCTGG - Intronic
1070774195 10:79100298-79100320 AATGCTCAGCAGAAAGAGGCAGG + Intronic
1070955568 10:80461216-80461238 CAGCCTCAAGAAAAGGAGGCAGG - Intronic
1071515302 10:86293031-86293053 CAGGCTCAGGAGTGAGAGACTGG - Intronic
1073577154 10:104636291-104636313 CTGCCTCAGGAGTCTGAGGCAGG + Intergenic
1074190014 10:111127514-111127536 CAGCCTCTGGAGAAGGAAGCAGG - Intergenic
1074583199 10:114740919-114740941 CACTCTCAGGAGGATGAGGCAGG + Intergenic
1075760185 10:124849598-124849620 AGCCCTCAGGAGAAAGAGGATGG + Intergenic
1076028679 10:127139681-127139703 CAGCATCAGGTGGAAGAGGCAGG - Intronic
1076562452 10:131376048-131376070 CAGCCTGAGGAGAAGAAGGTGGG - Intergenic
1076857936 10:133126759-133126781 CAGCCTCAGGGGAAGAAGGTCGG - Intronic
1077057603 11:602566-602588 CAGCCTCAGGAGGCTGAGGCAGG + Intronic
1079182863 11:18209175-18209197 CCACCGCAGGAGAAAGAGCCGGG - Intronic
1079237402 11:18700191-18700213 AAGCCACACCAGAAAGAGGCAGG - Intronic
1079338813 11:19595275-19595297 CATCCTCAGGAGAAAGACTCAGG + Intronic
1080052811 11:27874222-27874244 CAGCTCCAGGACTAAGAGGCAGG - Intergenic
1081629266 11:44677582-44677604 CTGCCTCAGGAGGCTGAGGCAGG - Intergenic
1081793883 11:45806449-45806471 CAGTCATAGGAGAAAGAGCCTGG + Intronic
1082053635 11:47794361-47794383 CAGCCTCAGGAGGCTGAGGCAGG + Intronic
1082170051 11:48992880-48992902 CAGCTTCAGGAGAAAGAAAGAGG - Intergenic
1082607829 11:55263871-55263893 CAGCTTCAGGAGAAAGAAAGAGG + Intronic
1083505743 11:63156113-63156135 CACCCTCAGGAGAAGGATACAGG - Intronic
1083962283 11:66021080-66021102 CAGCACCAGGATACAGAGGCAGG + Exonic
1084031665 11:66484825-66484847 CAGGCTCTGGAGAAAGAGGGAGG + Intronic
1084583125 11:70036927-70036949 CAGCCTCGGGAGAGAAAGGCAGG - Intergenic
1086578586 11:88369839-88369861 TAGACTCAGGAGAAAGAGGTTGG - Intergenic
1086695772 11:89843747-89843769 CAGCTTCAGGAGAAAGAAAGAGG + Intergenic
1086710382 11:90000736-90000758 CAGCTTCAGGAGAAAGAAAGAGG - Intergenic
1087253331 11:95927906-95927928 CAGCTTCTGGAGACTGAGGCAGG + Intergenic
1087330869 11:96778107-96778129 CTGCCTCAGGTGAAAAAGGAAGG - Intergenic
1088759205 11:112913228-112913250 CAGAGGCAGGAGAAAAAGGCTGG + Intergenic
1088984139 11:114890556-114890578 TAGTCTCAGGAGAAAGAGTTTGG + Intergenic
1089233851 11:117005796-117005818 ATGCTTCAGCAGAAAGAGGCAGG + Intronic
1089578057 11:119460525-119460547 CAGTCTCTGGAGACTGAGGCAGG + Intergenic
1089746472 11:120620910-120620932 GAGCCTCAACAGTAAGAGGCGGG - Intronic
1089854677 11:121532795-121532817 CAGACTCAGGAGGCTGAGGCAGG - Intronic
1090020959 11:123127923-123127945 CAGACTCAGGAGGCTGAGGCAGG + Intronic
1091225428 11:133954193-133954215 CAGCCTCTGGAGAGAGCGGGTGG - Intronic
1091737663 12:2936452-2936474 AAGACTCAAGAGTAAGAGGCCGG + Intronic
1092234779 12:6799883-6799905 CAGAAGCAAGAGAAAGAGGCAGG - Intronic
1092393247 12:8100522-8100544 CAGCTTCAGGAGGCTGAGGCAGG - Intergenic
1092525970 12:9310629-9310651 CAGCCTAAGGTGTGAGAGGCGGG - Intergenic
1093429603 12:19069770-19069792 TAGCCTCAGGAGGCTGAGGCAGG + Intergenic
1094056867 12:26277261-26277283 CTAGCTCAGGAGAATGAGGCAGG - Intronic
1096113089 12:49040467-49040489 AAGCTTCAGCAGACAGAGGCCGG + Exonic
1096528715 12:52230166-52230188 CAGCCTCAGGGGAGAGAGGCAGG + Intergenic
1098225691 12:68320529-68320551 CAGCCTCTGGGGGAAGGGGCTGG - Intronic
1099107427 12:78514161-78514183 CAGACTCAGGAGTCTGAGGCAGG + Intergenic
1099429619 12:82566807-82566829 CAGGCTCAGGAGCAAGAGTGAGG - Intergenic
1101331529 12:103761499-103761521 CAGTCTCTGGAGGAAGAGGGAGG - Intronic
1101667328 12:106831182-106831204 CAGCCTGTGGAGAAAGAAGGTGG - Intronic
1102573895 12:113844019-113844041 TAGGCTCAGGTGGAAGAGGCTGG - Intronic
1103406622 12:120680478-120680500 CAGCCCCAGCTGAAAGAGGTGGG + Intergenic
1103799636 12:123529401-123529423 ACGCCTCAGGAGGCAGAGGCAGG - Intronic
1104801261 12:131556504-131556526 CAGCCTCAACAGCAATAGGCAGG + Intergenic
1104872196 12:132007899-132007921 TAGCTTAAGGAGAGAGAGGCAGG + Intronic
1104959942 12:132483877-132483899 CAGACTGAGGAGGCAGAGGCGGG - Intergenic
1105011745 12:132761345-132761367 CAGCCTCCGGGGAAGGCGGCGGG - Intronic
1105292979 13:19064656-19064678 CCGGCTGAGGAGAAAGAGCCGGG - Intergenic
1105325157 13:19364176-19364198 CAGCCTCAGGAGACTGAGGTGGG + Intergenic
1105430751 13:20335068-20335090 CAGCCTGAGGAGTCACAGGCTGG - Intergenic
1106335271 13:28777974-28777996 GAGGCTCAGGAGAAGGTGGCAGG + Intergenic
1106391462 13:29339037-29339059 GAGGCTCAGGAGAAGGTGGCAGG + Intronic
1107040263 13:35940544-35940566 CAGCCTCAGGACAAAGCAGCAGG + Intronic
1107045145 13:35985695-35985717 CAGGCTCAGGAGAGACTGGCTGG + Intronic
1107058536 13:36131352-36131374 CCTCCTCTGGAGAGAGAGGCTGG - Intergenic
1107644628 13:42481005-42481027 CAGCTTCAGGAGGCTGAGGCAGG + Intergenic
1108210522 13:48135263-48135285 CAGCCTCGGGAGGCTGAGGCAGG - Intergenic
1111467049 13:88627336-88627358 CACTCACAGGAGAAAGAGGAAGG + Intergenic
1112261798 13:97884256-97884278 CAGACTCAGGGGAAAGTGGCTGG + Intergenic
1113201573 13:107872081-107872103 CTGCCTCAGTAGAACTAGGCTGG + Intergenic
1113464096 13:110501890-110501912 CAGACTCCGGTCAAAGAGGCAGG + Intronic
1113472660 13:110557905-110557927 CAGGCTGATGAGAAAGCGGCTGG - Intronic
1113892421 13:113743427-113743449 AACCCTAAGGAGAAAGAAGCAGG + Intergenic
1115223894 14:31084276-31084298 AAGCCTCTGGAGAAAAAGACAGG - Intronic
1115359456 14:32484945-32484967 CCGCCGCAGGAAAAAAAGGCGGG - Intronic
1115475574 14:33810148-33810170 CATCTGCAGGTGAAAGAGGCAGG + Intergenic
1117253170 14:53954811-53954833 CAGCCTCAGGAAAGGGAGGTCGG - Intronic
1117662475 14:58021700-58021722 CAGCCAGAGGAGAAAGGGCCAGG + Intronic
1117720195 14:58621647-58621669 AAGCCTCAGCACAGAGAGGCAGG + Intergenic
1117794636 14:59379695-59379717 GAGCCTTATGAGAAAGAGACAGG + Intergenic
1118028181 14:61791989-61792011 CAGGCTCAGGAGGCAGAGGCAGG + Intronic
1118168673 14:63363018-63363040 CAGCCTCAGCAGATTGAGACAGG - Intergenic
1118191265 14:63582788-63582810 CATGCTCAGGAGACTGAGGCAGG + Intergenic
1118355933 14:65013792-65013814 GAGCCTCAGGAGGCTGAGGCAGG - Intronic
1119335432 14:73829522-73829544 CAGCCACAGAAGAAAGGGGCGGG - Intergenic
1120450845 14:84665444-84665466 CATCCCCAGGAGAAAGGGGAGGG - Intergenic
1120811791 14:88811561-88811583 CTGCCTCAGGAGACTGAGGCAGG - Intergenic
1120940076 14:89939488-89939510 CAGCAACAGGAGCAGGAGGCGGG + Intronic
1121063264 14:90937254-90937276 CAGCCTCAGCAGATGGTGGCGGG + Intronic
1121272286 14:92645838-92645860 CAACCTCAGGAGGTTGAGGCAGG + Intronic
1121408896 14:93735801-93735823 CAGCCTCAGGAGGCTGAGGCAGG - Intronic
1121638306 14:95468472-95468494 CAGCCTCAGGAGCAAGGCTCTGG - Intronic
1121693254 14:95892847-95892869 ATGCCTCAGGACAAAGTGGCAGG + Intergenic
1121798777 14:96756264-96756286 CAGCCACATGACAAGGAGGCAGG + Intergenic
1122072526 14:99213867-99213889 CAGCATCAGAAGCAAGATGCTGG - Intronic
1122143085 14:99674007-99674029 CAGCCTGAGGAGCAGGAGGTGGG + Intronic
1122200842 14:100121653-100121675 CAGCCTCTGGAGAAACAGGTTGG + Intronic
1122549052 14:102540096-102540118 CAGGCTCTGGAGGAGGAGGCCGG - Intergenic
1123067983 14:105627806-105627828 CAGCCTCAGGTGAAAAGGGCCGG - Intergenic
1123774582 15:23566009-23566031 CAGCCTCAGGAGGAGGAGCCTGG + Exonic
1124212801 15:27777022-27777044 CTCCCTCTGGAGAAAGTGGCAGG - Intronic
1124518840 15:30393127-30393149 CAGTTGCAGGAGAAAGGGGCGGG + Intronic
1125611816 15:40976526-40976548 CAGCCTCAGGGGAAGAAGGAAGG - Intergenic
1125840954 15:42800932-42800954 CAGCCGCAGGAGGGACAGGCTGG + Intronic
1125934817 15:43626031-43626053 CAGCCTCAGGAGGCTGAGACAGG - Intergenic
1126473581 15:49042914-49042936 CAGCTTCAGGAGGCTGAGGCAGG + Intronic
1126758340 15:51946299-51946321 CAGCCTCAGGAGACTGAGGCAGG - Intronic
1127200681 15:56646316-56646338 CAGTCTCAGGAGGCTGAGGCAGG + Intronic
1127932906 15:63609216-63609238 CAGCCTCAGCTGGAAGAAGCAGG + Exonic
1128349133 15:66877488-66877510 CAGAGACAGGAGAAAGAAGCAGG + Intergenic
1128998690 15:72315924-72315946 CAGCCTGAGGAGGAAGAGGCTGG + Exonic
1129034718 15:72642158-72642180 CAGCCCAAGGAGTAAGAGCCTGG - Intergenic
1129171340 15:73810014-73810036 CAGACTCAGGAGAGGGAGGAAGG + Intergenic
1129215164 15:74095058-74095080 CAGCCCAAGGAGTAAGAGCCTGG + Intergenic
1129296974 15:74604935-74604957 CAGCCACAGGAGCAGGATGCAGG - Intronic
1129597844 15:76978966-76978988 CAGCCGCAGGAGGGATAGGCTGG + Intergenic
1129732309 15:77939403-77939425 CAGCCCAAGGAGTAAGAGCCTGG + Intergenic
1129788128 15:78322707-78322729 CAGCCTCAGGAGGAAAAGGGGGG + Intergenic
1130513986 15:84611798-84611820 CAGGCTTATGAGTAAGAGGCTGG - Intronic
1131205916 15:90446737-90446759 CTGCCCCAGGAGAAAGCTGCAGG + Intronic
1131278622 15:91003153-91003175 CAGGTGCATGAGAAAGAGGCCGG + Intronic
1131716267 15:95113963-95113985 CAGCCACAGTGGAAAGAGGAGGG + Intergenic
1131748839 15:95482900-95482922 CAGCCTGAGGTGAAAGAGTAAGG - Intergenic
1132375757 15:101327212-101327234 CAGCCTCCGGAGTGAGAAGCTGG - Intronic
1132804383 16:1768936-1768958 CAGACTCAGGTGAAAGCTGCAGG - Exonic
1132814988 16:1821429-1821451 CTGGCTCAGGAGAAAGGTGCCGG + Intronic
1132829127 16:1918876-1918898 CTGCCAAGGGAGAAAGAGGCCGG + Intergenic
1133115862 16:3577591-3577613 CATGCTCAGGATAAAGTGGCTGG + Intergenic
1133159540 16:3901285-3901307 CAGCTTCAGGAGGCTGAGGCTGG + Intergenic
1133276193 16:4639706-4639728 CACCCCTAAGAGAAAGAGGCCGG - Intronic
1133290041 16:4714314-4714336 CATCTGCATGAGAAAGAGGCAGG + Intronic
1133925193 16:10186689-10186711 CAGCCCCAGGGGAAAGATGGAGG - Intergenic
1134377864 16:13695169-13695191 CAGACTAAGGAAAAAGAGGAGGG + Intergenic
1135190329 16:20349020-20349042 CAGACGCAGGAGAAGGAGCCTGG + Exonic
1135258097 16:20957693-20957715 TAGCCTCAGGAGGCCGAGGCAGG + Intronic
1135510493 16:23078661-23078683 CACTCTCAGAAGACAGAGGCTGG + Intronic
1135721627 16:24822772-24822794 GAGCCTCAGGAAAGAGAGGAGGG + Intronic
1136026387 16:27471612-27471634 CAGCCTCATGTGCAAGATGCCGG - Intronic
1137754850 16:50893102-50893124 CAGACATAGGAGGAAGAGGCAGG + Intergenic
1137980080 16:53062022-53062044 CAGCCCCAGGGGTGAGAGGCGGG - Intronic
1138234499 16:55370558-55370580 CAGCCGCTGGAGAAGGAGGAAGG - Intergenic
1138257567 16:55580068-55580090 CAGCCTCAGGGGAAAGACTGGGG - Intronic
1138657855 16:58501094-58501116 CTTCCTCAGGAGGGAGAGGCAGG + Intronic
1139056708 16:63194550-63194572 AAGTGTCAGGAGACAGAGGCAGG + Intergenic
1139961675 16:70721579-70721601 CAGCCTCATTAGAGAGAAGCCGG - Intronic
1139966187 16:70746677-70746699 CAGCCACAGAAGAAAGACACAGG + Intronic
1140267436 16:73433009-73433031 AAGCCACAGGAGGGAGAGGCTGG + Intergenic
1140459900 16:75131209-75131231 CACCCTCAGGAGCATGAGGAGGG + Intergenic
1141195887 16:81860863-81860885 CAGCCTCAGGAGGCTGAGGCAGG + Intronic
1141635987 16:85314154-85314176 CTGCCTCAGGGGAGGGAGGCTGG - Intergenic
1142698843 17:1647775-1647797 CAGGCTCAGCAGAATGAGGGAGG + Intronic
1142756534 17:2019575-2019597 AAGTCTCAGGAGGAAAAGGCAGG - Intronic
1143229303 17:5338454-5338476 CAGCCTCGGGAGGCTGAGGCAGG + Intronic
1144085407 17:11803876-11803898 CTGAATCAGGAGAGAGAGGCTGG + Intronic
1144792321 17:17867323-17867345 CAGCCTCTGGGGAAAGGGGGTGG + Intronic
1145787814 17:27605431-27605453 CAGGCTGAGGAGCCAGAGGCTGG + Exonic
1146382526 17:32341728-32341750 CAGCCGCGAGAGTAAGAGGCTGG + Intronic
1147140165 17:38456128-38456150 CAGCCCCAGGGGACAGAGCCAGG - Intronic
1147636089 17:41965236-41965258 CAAGATCAGGAGAAACAGGCAGG + Exonic
1147820465 17:43238501-43238523 CAGCCTTTAGAGAAAGAAGCAGG + Intergenic
1147822577 17:43250393-43250415 CAGCCTTTAGAGAAAGAAGCAGG + Intergenic
1147825094 17:43265188-43265210 CAGCCTTTAGAGAAAGAAGCAGG + Intergenic
1147828214 17:43282708-43282730 CAGCCTTTAGAGAAAGAAGCAGG + Intergenic
1147829324 17:43288872-43288894 CAGCCTTTAGAGAAAGAAGCAGG + Intergenic
1147830414 17:43295007-43295029 CAGCCTTTAGAGAAAGAAGCAGG + Intergenic
1147911583 17:43859205-43859227 CAGACTCAGGAGAAAGACCCTGG + Intronic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1149567140 17:57648525-57648547 CTGCCTCAGGAGGAGGAGTCTGG + Intronic
1149679003 17:58491380-58491402 GACCTCCAGGAGAAAGAGGCTGG + Exonic
1150061362 17:62071467-62071489 CGGCCTGAGGCCAAAGAGGCAGG - Intergenic
1150166665 17:62950517-62950539 CAGCCTAAGTACAAAAAGGCAGG - Intergenic
1150462870 17:65367088-65367110 AAGCCAAAGGAGAAAGAGTCAGG - Intergenic
1150465091 17:65385944-65385966 GAGCCTCAGCAGGAAGGGGCTGG - Intergenic
1150469526 17:65424998-65425020 CAGCCACAGCAGAAAGATTCAGG + Intergenic
1150613013 17:66748899-66748921 CAGCTTCAGGAGGAAGGGGAGGG + Intronic
1151175436 17:72284274-72284296 CAACCTCAGGAGAATGAGGTTGG + Intergenic
1151853015 17:76702258-76702280 CAGCCTCAGGAGGCAGAGGCAGG + Intronic
1152245311 17:79182321-79182343 CAGCGCCAGGAGGAAGAGACAGG + Intronic
1152428016 17:80229140-80229162 CAGCCACAGAAGAGAGAGGGTGG + Intronic
1203165393 17_GL000205v2_random:88663-88685 TAGTCTAAGGAGAAAGAGGCCGG - Intergenic
1153004129 18:482225-482247 CAGCCTCAGAAGGCTGAGGCAGG - Intronic
1153285766 18:3452596-3452618 CGGCCTCAAGTGAAACAGGCCGG - Intronic
1153596402 18:6729691-6729713 CAGCCGCGGGAGAGAGCGGCTGG + Intergenic
1154022501 18:10676766-10676788 CACCCTCAGTGGAAAGAGGTGGG - Intronic
1154964682 18:21345020-21345042 CAGCCTGCTGAGAAAGGGGCAGG - Intronic
1154989237 18:21584738-21584760 GAGCCCAAGGAGATAGAGGCTGG + Intronic
1155096517 18:22560685-22560707 CAGCCAAAGGAGAAAGTGGAGGG - Intergenic
1155160258 18:23189749-23189771 CAGGCTCAGAAGGAAGAGCCAGG - Intronic
1155958592 18:31974950-31974972 TGGCATCAGGAGACAGAGGCTGG + Intergenic
1156196609 18:34781120-34781142 CAGGGGCAGGAGAAAGAGGCAGG + Intronic
1156394997 18:36691364-36691386 CTGCCACAGGATAAAGGGGCAGG - Intronic
1157314849 18:46578886-46578908 GAGGCTCAGGAGAATGAAGCAGG + Intronic
1157709811 18:49842653-49842675 CAGCCACTGCAGAAACAGGCTGG - Intronic
1157729669 18:49992610-49992632 CATCCTCAGGAGTAAGAGGCTGG - Intronic
1157818489 18:50748504-50748526 GAGCCCCAGGAGAGGGAGGCAGG - Intergenic
1158328505 18:56336275-56336297 GAGACTCAGGAGGATGAGGCAGG - Intergenic
1158830466 18:61271998-61272020 CAGCCTAAGGACAAAGACTCAGG + Intergenic
1159063659 18:63543706-63543728 CTGCCTCAGGAGGCTGAGGCAGG - Intergenic
1159556528 18:69951495-69951517 CAGCCTGAGGACAAACAGGGTGG + Intronic
1160259667 18:77280542-77280564 AAGGGTCAGGAGACAGAGGCAGG - Intergenic
1160397527 18:78583356-78583378 AGGCCTCAGGAGCATGAGGCTGG - Intergenic
1160397582 18:78583571-78583593 AGGCCTCAGGAGCACGAGGCTGG - Intergenic
1160397591 18:78583610-78583632 AGGCCTCAGGAGCACGAGGCTGG - Intergenic
1160843831 19:1158031-1158053 CGGACTCAGGAGAGAGAGACGGG - Intronic
1160843840 19:1158071-1158093 CAGGCTCAGAAGAAAGAGGCGGG - Intronic
1160878397 19:1308499-1308521 CAGCCCAGGGAGAATGAGGCTGG + Intergenic
1161528537 19:4772682-4772704 CAGCCCCAAGAGAGAGAGCCAGG + Intergenic
1161768310 19:6218620-6218642 CAGCTGCAGGAGGAGGAGGCGGG - Intronic
1161935375 19:7368625-7368647 CAGATGCAGGAGAAAGAGGGAGG + Intronic
1162217136 19:9145526-9145548 CAGCCAGAGGAGAAAAAGACAGG - Intronic
1163314524 19:16532879-16532901 CAGCCTCAGGAGCTCCAGGCGGG + Intronic
1164201469 19:23022360-23022382 CAGCCTGGGGAAAAAGAGTCAGG + Intergenic
1164424542 19:28129217-28129239 CAGCAGCAGGAGAAAGAGAGAGG - Intergenic
1164430681 19:28185853-28185875 CAGCCTCATGAGGAGGAGGCTGG + Intergenic
1166100648 19:40569685-40569707 CAGCTGCAGGAGAAAGAGGCAGG + Exonic
1166107302 19:40603772-40603794 CAGCCCCGGGAGAGAGAGGGAGG + Intronic
1166216998 19:41342294-41342316 CAGCCCCTGGAGGAAGAGGAAGG + Intronic
1166840068 19:45691936-45691958 CTGCCTGAGGAGAGAGAGGCGGG + Exonic
1167261175 19:48459126-48459148 CAGCCTCGGGAGGCTGAGGCAGG + Intronic
1167640070 19:50676467-50676489 CAGGCTCAGGAGGAATAGGAAGG + Intronic
1167745536 19:51349557-51349579 CAGCCTCAGGAGGCTGAGGTGGG - Intronic
1167750473 19:51376454-51376476 CAGACTCAGGAGACTGAGGTAGG + Intergenic
1167756890 19:51418314-51418336 CAGACTCAGGAGGCTGAGGCAGG - Intergenic
1168148155 19:54430796-54430818 CAGCCTCTGCAGAAAGAGAAAGG - Exonic
1168165933 19:54547863-54547885 TAGACTCAGGAGACTGAGGCAGG - Intergenic
1168358995 19:55722458-55722480 ACCCATCAGGAGAAAGAGGCAGG - Intronic
1168447312 19:56431445-56431467 TAACCCCAGCAGAAAGAGGCTGG + Intronic
925333581 2:3077065-3077087 CAGCCAAAGGAGACAGATGCAGG + Intergenic
926023044 2:9513897-9513919 GCTGCTCAGGAGAAAGAGGCAGG + Intronic
927562810 2:24085301-24085323 CAGCCCCAGGAGAAGGATGCTGG + Intronic
928135186 2:28682599-28682621 CAGACTCAGGAGAGATAGACAGG - Intergenic
928325881 2:30319167-30319189 CAGCAGCAGCAGAAAGAGGTGGG + Intronic
929043849 2:37772112-37772134 CAGCTTCAGGACAGAGAGGCTGG - Intergenic
929233518 2:39584047-39584069 CAGCCTCAGTAAAAGGAGCCTGG + Intergenic
929234830 2:39594610-39594632 GATACTCAGGAGAATGAGGCAGG - Intergenic
929427346 2:41856684-41856706 CAGACGCAGTAGAGAGAGGCAGG - Intergenic
929788157 2:45006571-45006593 CAGCCTCGGGAGACAGATCCCGG + Intronic
929871120 2:45760188-45760210 CATCCTGAGAAGACAGAGGCAGG - Intronic
929915540 2:46132583-46132605 CAGGCTCAGGCGAATGAGGCCGG - Intronic
929979171 2:46662938-46662960 CAGCCTCAGGAGAGCCAGGATGG + Intergenic
930198325 2:48530226-48530248 CAGCCCCAGGGGACAGAGACGGG + Intronic
933161106 2:79026140-79026162 CTGACACAGGAGAATGAGGCAGG - Exonic
933215516 2:79625690-79625712 TAGGCTCAGGAGCAAGAGCCTGG - Intronic
933721082 2:85398206-85398228 CAGCCTGAGGAGGGGGAGGCTGG + Intronic
933849239 2:86352429-86352451 CAGCTCCAGGAGACAGAGGGAGG - Intergenic
934566078 2:95342155-95342177 CAGCCACACGAGAAAGAGAGAGG + Intronic
934759845 2:96848441-96848463 CAGCCTGTGGAGAGAAAGGCTGG + Exonic
935112331 2:100104844-100104866 CTCCCGGAGGAGAAAGAGGCGGG - Intronic
936472925 2:112814743-112814765 AAGCCTCAGGAGAGAGAAGTTGG - Intergenic
937064746 2:119009402-119009424 GAGCCTCAGGACAAAAAGGGTGG - Intergenic
937505147 2:122528354-122528376 CAGGGACAGGAGAAAGAAGCTGG + Intergenic
937898055 2:126993586-126993608 CAGCCTCAGGAGGCTGAGGCAGG + Intergenic
938027070 2:127958903-127958925 CAGCTTCAGGAGACCAAGGCAGG - Intronic
938078993 2:128359285-128359307 CAGCCTCAGGGCTGAGAGGCAGG - Intergenic
938548944 2:132361715-132361737 CAGCCTCAGGCGCAGGAGGGAGG - Intergenic
939094299 2:137816381-137816403 CAGGCTCAGGATCAACAGGCAGG - Intergenic
939734981 2:145833084-145833106 CAGCTTCAGGAGGCTGAGGCAGG - Intergenic
939911452 2:147988470-147988492 CTGCCTCAGGAGATAGGAGCTGG + Intronic
940048696 2:149437731-149437753 CAGGCTCAGGAGCAGGAGCCAGG - Exonic
940224185 2:151384505-151384527 CAGCTTCACGAGAAAAAGACAGG + Intergenic
941721395 2:168816746-168816768 CAGCCTCTAGGGAAAGAGACAGG - Intronic
942429738 2:175898022-175898044 CAGCTTCAGGACAGAAAGGCAGG + Intergenic
942490442 2:176484500-176484522 AAGCCTCAGGAGAGGGAGGGAGG - Intergenic
942522334 2:176817489-176817511 CAGTCTGAGGAGCAAGAGGCTGG + Intergenic
942610629 2:177738693-177738715 CAGCCTCACCAGAGAGAGGGAGG + Intronic
942665407 2:178311809-178311831 CACTCTCAGGAGCAAGAGGAAGG - Intronic
942925398 2:181426094-181426116 CTGCCTCAGAAGAAAGAGTTTGG - Intergenic
943080528 2:183253934-183253956 CCCCCTCAGCAGCAAGAGGCGGG - Intergenic
943685489 2:190813344-190813366 CAGCCTGAAGATCAAGAGGCTGG - Intergenic
943713563 2:191125208-191125230 CTGCCTCAGTAGAAAGATACGGG - Intronic
944882388 2:204026682-204026704 AAGCCACAGGAGAATGAGGAAGG + Intergenic
945642508 2:212446421-212446443 CCAACTCAGGAGAAAGATGCAGG - Intronic
946156736 2:217811934-217811956 CAGCCTCAGGAAAGAGAAGGCGG - Intronic
946195673 2:218032070-218032092 CAGCCTCAGGAGCAAGAGGTTGG - Intergenic
947443614 2:230145207-230145229 GGGCCTCAGCCGAAAGAGGCTGG + Intergenic
948384778 2:237574709-237574731 CAGCCTCTGGACAGAGAGGAAGG - Exonic
948544103 2:238714172-238714194 AACTCTCAGAAGAAAGAGGCTGG - Intergenic
949028261 2:241776383-241776405 CAGGCTCAGGAGGAGGAGGAGGG + Intergenic
1169036944 20:2461709-2461731 CAGCCTTACGGGAAACAGGCAGG + Exonic
1169133358 20:3179830-3179852 CCTCCTCAGGAGACTGAGGCAGG - Intergenic
1170317895 20:15062202-15062224 CAGCCTCAGGAGAAAGAGGCTGG + Intronic
1170787143 20:19477363-19477385 CAAATCCAGGAGAAAGAGGCAGG + Intronic
1170857250 20:20068535-20068557 CAGCCACAGGGGAATGAAGCAGG - Intronic
1171543037 20:25978987-25979009 CAGCCTCAGAAAACAGAGGCGGG - Intergenic
1172654646 20:36529440-36529462 CAGCCTCGGGAGGCTGAGGCAGG - Intergenic
1172952026 20:38728479-38728501 CAGGCGCAGGTGAAAGAGGCTGG - Exonic
1173150280 20:40561456-40561478 CAGTCTCAGGCAAAGGAGGCTGG - Intergenic
1174044563 20:47724358-47724380 CAGCCTCACTAAAAACAGGCAGG - Intronic
1174860340 20:54085386-54085408 TAGCCTCACCAGAAAAAGGCTGG - Intergenic
1175040578 20:56046461-56046483 GAGACTCAGAAGAAAGAGGGTGG + Intergenic
1175420052 20:58825989-58826011 CAAGCTCAGGAGAAAGAGAATGG - Intergenic
1175494502 20:59404287-59404309 CTGCCTCTGGTGAACGAGGCGGG - Intergenic
1175505518 20:59481694-59481716 CAGGCTCAGGAAAAGGAGGGGGG + Intergenic
1176027277 20:62992477-62992499 CATCCTTAGAAGAGAGAGGCAGG + Intergenic
1176336296 21:5602788-5602810 TAGTCTAAGGAGAAAGAGGCAGG + Intergenic
1176342843 21:5714288-5714310 CAGCCCCAGGAGAAAAGGGCTGG + Intergenic
1176391461 21:6218160-6218182 TAGTCTAAGGAGAAAGAGGCAGG - Intergenic
1176406359 21:6370416-6370438 TAGTCTAAGGAGAAAGAGGCCGG + Intergenic
1176469958 21:7098014-7098036 TAGTCTAAGGAGAAAGAGGCAGG + Intergenic
1176475097 21:7146439-7146461 CAGCCCCAGGAGAAAAGGGCTGG + Intergenic
1176493519 21:7479792-7479814 TAGTCTAAGGAGAAAGAGGCAGG + Intergenic
1176501984 21:7610168-7610190 CAGCCCCAGGAGAAAAGGGCTGG - Intergenic
1176507123 21:7658591-7658613 TAGTCTAAGGAGAAAGAGGCAGG - Intergenic
1176537164 21:8112357-8112379 CAGCCCCAGGAGAAAAGGGCTGG + Intergenic
1178643129 21:34362778-34362800 CCGCCTTAGGAGACTGAGGCTGG + Intergenic
1179831541 21:44000254-44000276 CAGGCATGGGAGAAAGAGGCAGG - Intergenic
1179928708 21:44552420-44552442 CATCCCCAGCTGAAAGAGGCTGG - Intronic
1179959328 21:44759330-44759352 GAGCCTCAGCAGAAGGAGCCAGG - Intergenic
1180021272 21:45129115-45129137 CAGCCTCGGGAGACTGAGGCAGG + Intronic
1180095078 21:45552645-45552667 CAGCCCCAGCAGAGAGGGGCTGG + Intergenic
1180854228 22:19036223-19036245 CAGGCTAAGGTGGAAGAGGCTGG - Intergenic
1182106755 22:27695205-27695227 CAGGAAGAGGAGAAAGAGGCGGG + Intergenic
1182163152 22:28144065-28144087 CAGGCTCAGGAAATAGTGGCTGG - Intronic
1183035109 22:35135207-35135229 CAGCCTCAGGAGCCACAGGGGGG + Intergenic
1183316888 22:37141837-37141859 CAGCCTGGGCAGAAGGAGGCGGG + Intronic
1184163971 22:42716626-42716648 CAGCCCCAGGCAAATGAGGCTGG - Intronic
1184242795 22:43220297-43220319 CAGCTTCTGGAGACAGAGGCAGG - Intronic
1184272636 22:43393389-43393411 CCTCTTCAGCAGAAAGAGGCCGG - Intergenic
1184314362 22:43672703-43672725 CACCCTCAGGAGAATGAGGATGG + Intronic
1184484664 22:44769202-44769224 GAGCCTCAGGTGAAAGATGATGG - Intronic
1184536289 22:45089443-45089465 GAGCTTTAGGAGACAGAGGCAGG + Intergenic
1184724009 22:46332497-46332519 CATCCTATGGAGAAAGGGGCTGG - Intronic
1185232760 22:49692948-49692970 CAGCCGCAGGTGACAGAGGCAGG - Intergenic
1203242112 22_KI270733v1_random:28761-28783 CAGCTCCAGGAGAAAAGGGCTGG + Intergenic
950822484 3:15775900-15775922 CAGTCTCTGGAGAAAGAAGAGGG - Intronic
951235975 3:20236763-20236785 CAGCCTCAGGTGAAAATGGACGG + Intergenic
952075647 3:29694123-29694145 CAGCCTCTGGAGAGTGAGGCAGG + Intronic
952282176 3:31934518-31934540 CAGCTTCAGGAGGCTGAGGCAGG - Intronic
952509773 3:34041365-34041387 CAGCTTCAGGAGGCTGAGGCAGG + Intergenic
953855993 3:46499427-46499449 CAGCCTCACGGCAAAGGGGCTGG + Intronic
954273509 3:49527408-49527430 CAGCTACAGGAGAATGAGGCAGG + Intronic
955390684 3:58520337-58520359 AAGCCACAGGAGACTGAGGCTGG + Intronic
956464605 3:69506645-69506667 CAGACTCAGGAGGCTGAGGCAGG - Intronic
957221044 3:77382566-77382588 GAGACTCAGAAGAAAGAGGTTGG - Intronic
960349837 3:116578284-116578306 CATCCACAGGAGAAAGATGTAGG - Intronic
960458127 3:117899187-117899209 CAGCCTCTGGGGAGAGAGGAAGG + Intergenic
960959404 3:123058746-123058768 CAGCTTCAGGAGAATGAAGCTGG - Intergenic
961765524 3:129207552-129207574 CAGCCTCTGGAGACAGTGGCTGG - Intergenic
961829651 3:129616955-129616977 AAGCCACAGGGGAAAGAGGGTGG - Intergenic
961954493 3:130787546-130787568 CACCCGCAGGAGAAGGAGGGTGG + Intergenic
962044544 3:131741767-131741789 CAGCCTCTGCAGTAGGAGGCTGG - Intronic
962640048 3:137376652-137376674 AAGCTTCCAGAGAAAGAGGCAGG - Intergenic
962899801 3:139751289-139751311 CAACCTCAGGAGGTTGAGGCAGG + Intergenic
963012695 3:140787785-140787807 AGGCCTCTGGAGAAAGAGGAAGG - Intergenic
963791120 3:149583448-149583470 CAGCCTCGGGAGGCTGAGGCAGG - Intronic
963926608 3:150957768-150957790 CAGCCTCAGGAGGCTGAGGCAGG - Intronic
964123276 3:153208799-153208821 CAGCCTCATGAGATATGGGCAGG - Intergenic
964203717 3:154147297-154147319 CATCCTCAGGAGGCTGAGGCAGG + Intronic
964255327 3:154768629-154768651 CCGCCTCAGGAGTCTGAGGCAGG + Intergenic
964385728 3:156145564-156145586 CCCCCTCAGGAAAAAGAGGGTGG + Intronic
965096344 3:164232143-164232165 CAGCTTCAGGAGGCTGAGGCAGG - Intergenic
966736128 3:183188544-183188566 CAGCCTCTTGAGAGTGAGGCGGG - Intronic
966924524 3:184635774-184635796 CAGCGTGGGGAGAGAGAGGCAGG + Intronic
967941154 3:194767689-194767711 CAGCCTCAGAACTCAGAGGCTGG + Intergenic
967993638 3:195150599-195150621 CACCCTGAGGAGGAAGCGGCAGG - Intronic
968048725 3:195638902-195638924 CAGCTCCAGGAGAAACAGGGTGG - Intergenic
968075836 3:195815812-195815834 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075848 3:195815857-195815879 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075860 3:195815902-195815924 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075872 3:195815947-195815969 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075897 3:195816037-195816059 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075909 3:195816082-195816104 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075921 3:195816127-195816149 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075933 3:195816172-195816194 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075945 3:195816217-195816239 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968076095 3:195816780-195816802 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968076131 3:195816908-195816930 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968076195 3:195817125-195817147 CTGCATAAGGAGAAGGAGGCCGG - Intergenic
968076231 3:195817253-195817275 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968076318 3:195817564-195817586 CTGCTTAAGGAGAAGGAGGCCGG - Intergenic
968098680 3:195950722-195950744 CAGCTCCAGGAGAAACAGGGTGG + Intergenic
968305893 3:197651022-197651044 CAGCTCCAGGAGAAACAGGGTGG + Intergenic
968811495 4:2801470-2801492 CAGGCCCAGGAGCAAGAGGGAGG - Intronic
969054563 4:4393538-4393560 CAGCCACAGGAGGTAGAGGCAGG - Intronic
969290677 4:6237297-6237319 GAGCCTCTGGAGGAAGAGGAGGG + Intergenic
969432501 4:7163938-7163960 CAGACTCAGGAGGCTGAGGCAGG + Intergenic
969433837 4:7172585-7172607 CAGCCTCAGGAAAGGGATGCAGG - Intergenic
969624640 4:8296197-8296219 CTGTCTCAGGAGAAAGAGAGAGG - Intronic
970648645 4:18152739-18152761 TAAACTCAGGAGAATGAGGCAGG + Intergenic
970754579 4:19409717-19409739 CAGTCTCAGGAGAAGAAAGCTGG - Intergenic
971207012 4:24580625-24580647 CAGCCTCCGGAGTAAGTAGCTGG + Intronic
971323359 4:25623307-25623329 CAGCCTCTGGAGGAGGAGGAGGG - Intergenic
971444191 4:26724850-26724872 AAGCCTGGGAAGAAAGAGGCTGG - Intronic
973020928 4:45205772-45205794 CAGTTCCAGGAGAAAGAGACAGG - Intergenic
973214073 4:47649187-47649209 CAGTCTCCCGTGAAAGAGGCAGG + Intronic
974440832 4:61914807-61914829 TTGCATCAGGAGAAAAAGGCAGG + Intronic
975668056 4:76753705-76753727 TTACCTCTGGAGAAAGAGGCTGG - Intronic
975982163 4:80173390-80173412 CAGGTTCAGGAGGAAGAGACAGG + Intergenic
976318728 4:83687077-83687099 TAGCCTCAGAAGAGAGAGGAGGG - Intergenic
976610363 4:87024700-87024722 CAGCCTCAGGAGGCTGAGGCAGG - Intronic
976633486 4:87263947-87263969 CAGTATCAGGAGGCAGAGGCAGG - Intergenic
977574754 4:98663891-98663913 CATCCTCTGCAGAAAGAGGAAGG + Intergenic
977609849 4:99020482-99020504 GAGCCTGAGGAGGAGGAGGCGGG + Intronic
977609863 4:99020537-99020559 CTGCCTGAGGAGGAGGAGGCGGG + Intronic
978233010 4:106423703-106423725 CAGCCTCAGGAGGCTGAGGTGGG + Intergenic
978284685 4:107061998-107062020 CAGGCTCAGGAGGCTGAGGCAGG + Intronic
978831044 4:113085423-113085445 TAGTCCCAGGAGAATGAGGCAGG - Intronic
979279309 4:118847323-118847345 CAGCCTCAGGAACAGGAGGAAGG - Intergenic
980714228 4:136611178-136611200 CAGGCTAAGGAGGAAGAGGGAGG - Intergenic
981216624 4:142177084-142177106 CTGAATTAGGAGAAAGAGGCAGG - Intronic
981463129 4:145034363-145034385 CCAGCTCAGGAGAAAGATGCAGG - Intronic
982566620 4:156995163-156995185 CGGCTTCAGGTGGAAGAGGCAGG + Intergenic
982948474 4:161658215-161658237 CAGCATCGGGAGGCAGAGGCAGG + Intronic
983033864 4:162838030-162838052 CAGCCTTAGGAAGAATAGGCAGG + Intergenic
983295267 4:165859018-165859040 CTGCCTCAGGAGGCTGAGGCAGG + Intergenic
983550949 4:169016902-169016924 CAGGCTCAGGCCAAATAGGCAGG + Intergenic
983686496 4:170415579-170415601 CATAATCAGGAGAAACAGGCAGG + Intergenic
983946760 4:173594945-173594967 CAGCTACAGGAGGATGAGGCAGG - Intergenic
984548754 4:181136157-181136179 GAGCCTCAGGTGGAAGATGCTGG + Intergenic
985511242 5:315410-315432 AAGCGTCTGGAGAATGAGGCTGG - Intronic
985696219 5:1342118-1342140 CAGCCTCCTGAGATGGAGGCAGG - Intronic
985742922 5:1630237-1630259 CAGCTCCAGGAGAAACAGGGTGG + Intergenic
986339496 5:6776971-6776993 CAGCCTCAGGAGTAAAATGAAGG - Intergenic
986378496 5:7159413-7159435 CAGCTTCAGGAGGCTGAGGCAGG - Intergenic
987065355 5:14284912-14284934 CAGCCTAAGCAGGAAGAGGCAGG - Intronic
987358908 5:17088988-17089010 CAGCCTCAGGAGGCTGAGGTGGG - Intronic
988547521 5:32172747-32172769 CTGCCTCAGGAGGCTGAGGCAGG + Intronic
989374879 5:40750444-40750466 CCTACTCAGGAGACAGAGGCAGG + Intronic
989983737 5:50672037-50672059 AAGGCTCAGGAGAAAGAGGAAGG - Intronic
990985082 5:61633949-61633971 CAGCCACAGAAGAAAGACACAGG + Intergenic
991061469 5:62380789-62380811 TAGGCTGAGGAGGAAGAGGCAGG + Intronic
992461133 5:76961335-76961357 CAGACTCAGGAGAGAGAAGTAGG - Intronic
992595225 5:78339925-78339947 CAGACTCAGGAAAAAGAGGAAGG - Intergenic
992777236 5:80099030-80099052 CACCCTCAGGAGAATGGGCCAGG + Intergenic
992799043 5:80279412-80279434 CAGTCTCAGAAAAAAGAGGCCGG + Intergenic
993902397 5:93593530-93593552 CAGCCACAGGAGGGAGAGACAGG - Intronic
994804234 5:104422531-104422553 TAGGCTAAGGAGAAAGAGGAGGG + Intergenic
995548421 5:113255665-113255687 CAGCCTTAGGAGGAATATGCTGG + Intronic
995562258 5:113395604-113395626 CAGCCTGGGGGGAAAGAGGGAGG - Intronic
995870014 5:116734663-116734685 CAGCCCAAGGAGGCAGAGGCAGG + Intergenic
996329395 5:122312180-122312202 CAGCCTCAGCCGAAGTAGGCGGG - Exonic
996342983 5:122458491-122458513 CAGCCTTAAGAGATACAGGCAGG - Intronic
997681096 5:135751232-135751254 CAGGCCCAGGAGAAGGAGGAGGG - Intergenic
997963732 5:138341448-138341470 CAGCCTCAGAAAAAAGGGGGAGG - Intronic
998558801 5:143151842-143151864 CAGGCTCAGGAGGCTGAGGCAGG + Intronic
998673096 5:144375920-144375942 CTGCCTCAGGAGGCTGAGGCAGG - Intronic
999257049 5:150215594-150215616 CAGCCTGGGGAGAAAGAGGCTGG + Intronic
1000328062 5:160187247-160187269 GCTACTCAGGAGAAAGAGGCGGG + Intergenic
1000912409 5:167038050-167038072 CAGGTACAGGAGAAAGAGACTGG + Intergenic
1001401005 5:171446389-171446411 AGGCCCCAGTAGAAAGAGGCAGG + Intronic
1001527521 5:172439341-172439363 CAGCATCAGGCTATAGAGGCAGG - Intronic
1002167249 5:177355853-177355875 CAGCTGAAGGAGAAAGAGGGAGG + Intergenic
1002544177 5:179927698-179927720 CATACTCAGGAGACTGAGGCAGG - Intronic
1003113878 6:3270503-3270525 CAGCCTGAGGAGGAGGAGGCCGG - Exonic
1003364122 6:5456617-5456639 CAGCCTCATGAGGCTGAGGCAGG + Intronic
1003414606 6:5896774-5896796 CAGGGTCGGGAGGAAGAGGCTGG + Intergenic
1004112105 6:12729063-12729085 AAGCCTCAGAGGAAATAGGCAGG + Intronic
1005380789 6:25232170-25232192 CTGCCTCAGGAGGCTGAGGCAGG + Intergenic
1005661953 6:28007397-28007419 CAGTCTCAGGAGGCTGAGGCAGG - Intergenic
1005822180 6:29607195-29607217 CAGGCCCAGGAGCCAGAGGCGGG + Exonic
1005962496 6:30704040-30704062 TAGGCTCAGGGGAAATAGGCTGG + Exonic
1006171966 6:32098148-32098170 CAGCACCAGGAGAACCAGGCTGG + Intronic
1006283220 6:33073008-33073030 CAGCCACAAAAGATAGAGGCTGG + Intronic
1006796860 6:36737537-36737559 AGGGCTCAGGAGCAAGAGGCAGG - Intergenic
1008077205 6:47157322-47157344 GAGGCTCAGGAGACAGAGACTGG + Intergenic
1008154406 6:47996169-47996191 CAGAATCAGGAGAGAGTGGCTGG + Intronic
1008401886 6:51072690-51072712 CAGACTCAGGAGAAAGGGTAAGG - Intergenic
1008759400 6:54835467-54835489 CATTGTCAGGAGAAAGAGCCAGG - Intergenic
1008925110 6:56884017-56884039 CCTTCTCAGGAGACAGAGGCAGG + Intronic
1009380552 6:63023521-63023543 AAGACTCAGGAGAAAGAGAGAGG - Intergenic
1012011228 6:93788603-93788625 CTGCCTCAGGAGGCTGAGGCAGG - Intergenic
1012602958 6:101120290-101120312 CAACCTCAGGAGGGAGAGGGTGG + Intergenic
1012769261 6:103408021-103408043 CAGTCTCAGGAAAAGGAGACAGG - Intergenic
1013031745 6:106340555-106340577 CTGCCTCAGGAGCCTGAGGCAGG - Intergenic
1013210661 6:107983898-107983920 GAGCCTCAAGATAAAAAGGCAGG + Intergenic
1013684304 6:112561339-112561361 TAACCTCAGGAGAACCAGGCTGG - Intergenic
1015984700 6:138873445-138873467 AAGCCTCAGGAGACAAAGGAGGG + Intronic
1016891693 6:149014105-149014127 CAGAGTGAGGAGAAGGAGGCAGG + Intronic
1016924478 6:149329226-149329248 CAGACTTGGGAGGAAGAGGCAGG + Intronic
1017212812 6:151875900-151875922 GAGCCTCAGGACATTGAGGCAGG + Intronic
1017658104 6:156649136-156649158 CAGCCTGAGCAGACAGAAGCTGG + Intergenic
1018033619 6:159863894-159863916 CAGCCTCAGGGTAAAGAGCACGG - Intergenic
1018686549 6:166308167-166308189 CAGCCCCTGGAAAGAGAGGCGGG + Exonic
1018770269 6:166964522-166964544 CAGCTTCAGGAGGCTGAGGCAGG - Intergenic
1018795274 6:167180300-167180322 CAGACACAGGAGAGAAAGGCCGG - Intronic
1018813475 6:167314449-167314471 CAGCCTGAGGCGAAGTAGGCAGG - Intronic
1018951694 6:168382433-168382455 AAGCTTTAGGGGAAAGAGGCAGG + Intergenic
1019088493 6:169503126-169503148 CAGAGTGACGAGAAAGAGGCAGG + Intronic
1019220947 6:170472366-170472388 CAGCCTCAGCAGACAGTAGCTGG - Intergenic
1019554274 7:1620885-1620907 CAACCGCAGGAGAAACAGCCGGG + Intergenic
1019660734 7:2222690-2222712 CAGCTTCAGGAGCGGGAGGCCGG - Exonic
1019807882 7:3141933-3141955 CAGCCTCAGGAGGCTGAGGTGGG + Intronic
1020138596 7:5599861-5599883 CACCCACAGGAGAGGGAGGCTGG - Intronic
1020748018 7:12102299-12102321 CAGCCTCAGGAGACTGAAGTGGG + Intergenic
1021446293 7:20737044-20737066 CAGCTTCAGGAGGTGGAGGCAGG + Intronic
1022306687 7:29153248-29153270 AAGCCTCCAAAGAAAGAGGCAGG + Intronic
1022475858 7:30709085-30709107 CAGCCTCCCAAGAATGAGGCTGG - Intronic
1022538159 7:31110984-31111006 CAGCATCAGGAGTAAGGGGGAGG + Exonic
1022565773 7:31399501-31399523 GAGCTTCAGGAGGCAGAGGCAGG - Intergenic
1023980585 7:45067774-45067796 CAGCCTCAGGAGGGAGAAGAAGG - Intronic
1024075521 7:45816051-45816073 CCGTCTCAAAAGAAAGAGGCAGG + Intergenic
1024100666 7:46029455-46029477 AAGCCTGAGAAGCAAGAGGCTGG - Intergenic
1024387810 7:48773613-48773635 CTGTCACAGGAGAAAGAGGATGG - Intergenic
1025035066 7:55588805-55588827 CAGAGTCAGGAGAATGGGGCAGG - Intergenic
1025158730 7:56634813-56634835 CATACCCATGAGAAAGAGGCGGG + Intergenic
1025997048 7:66534511-66534533 CATACTCAGGAGACTGAGGCAGG + Intergenic
1025998895 7:66545785-66545807 ATGTTTCAGGAGAAAGAGGCAGG - Intergenic
1026594595 7:71723855-71723877 CAGCCTCCAGAGACTGAGGCAGG + Intergenic
1026991953 7:74591131-74591153 ATGTTTCAGGAGAAAGAGGCAGG - Intronic
1028897481 7:96058744-96058766 CTGCCTCAGGAGGCTGAGGCAGG - Intronic
1029479085 7:100802209-100802231 CAGCCACTGGAGAGGGAGGCTGG - Intergenic
1029813203 7:103069523-103069545 CAGTCTGAGGAGACAGAGACTGG + Intronic
1031648780 7:124260021-124260043 TATCCTCATGAGAAAGAGGCTGG - Intergenic
1032157486 7:129480828-129480850 CAGCCTCAGGAGGTTGATGCAGG - Exonic
1032298976 7:130668972-130668994 CAGTCTCAAGAGAGCGAGGCGGG + Exonic
1032522733 7:132558737-132558759 CAGGCAAAGGCGAAAGAGGCGGG - Intronic
1032865182 7:135917698-135917720 CATCCTCAGGAGAGGGAAGCAGG + Intergenic
1033319469 7:140326728-140326750 CAGCCTCTGGATAAAGGGGTTGG - Intronic
1034523552 7:151639579-151639601 CAGCTCCAGGAGAAAGAGCAAGG - Intronic
1034590221 7:152132180-152132202 CATCCTCAGGACAAAGTGGATGG + Intergenic
1035070413 7:156140568-156140590 CAGAGAGAGGAGAAAGAGGCAGG + Intergenic
1035259206 7:157650769-157650791 CAGCTGCAGCAGAAAGGGGCTGG - Intronic
1036009890 8:4709779-4709801 AAGTCACAGGGGAAAGAGGCAGG + Intronic
1036434332 8:8719458-8719480 CAGCCACAGGAGTAACAGCCTGG + Intergenic
1036686311 8:10913955-10913977 CAGCCTGGGGTGCAAGAGGCTGG + Intronic
1036783211 8:11664782-11664804 GAGACTCAGAAGAAAGAGGGAGG - Intergenic
1036810720 8:11866528-11866550 CAGCTCCTGGAGAAAGGGGCTGG - Intronic
1037654750 8:20873289-20873311 CATGCTAAGGAGAGAGAGGCTGG - Intergenic
1038315589 8:26481924-26481946 CAGCCTCAGGAGAAGGCGATGGG - Intronic
1038392578 8:27217627-27217649 CAGCATCAGGAGAAAGACGATGG + Intergenic
1038913096 8:31989133-31989155 CAGACTCAGGAGGCTGAGGCAGG + Intronic
1039310381 8:36312140-36312162 CAGCTTCAGGAGAAATATGTAGG + Intergenic
1040427836 8:47307330-47307352 CAGCCTCAGGAGGCTGAGGCAGG - Intronic
1040669796 8:49676206-49676228 CAGCTTCAGGACAGAAAGGCAGG - Intergenic
1041277981 8:56182785-56182807 CATGCTGAGGACAAAGAGGCGGG + Intronic
1041926142 8:63238636-63238658 CAGCCTCAGGAGGCTAAGGCAGG - Intergenic
1041948148 8:63470147-63470169 CAGTCTCAGCAGAAAGAGAGAGG + Intergenic
1042212362 8:66393301-66393323 TGGCGTCAGGAGAAAGATGCAGG - Intergenic
1042529721 8:69802664-69802686 GAGCCTCAGCAGGAAGAGGCTGG - Intronic
1042642426 8:70951121-70951143 CAGGCTCAGGAGAAAGGGCCTGG + Intergenic
1043544056 8:81295408-81295430 CAGGCTCAGGAACCAGAGGCAGG + Intergenic
1044590818 8:93913149-93913171 CAGTCACAGGGGAAAGAGGCTGG - Intronic
1044935240 8:97287640-97287662 CACTCTTAAGAGAAAGAGGCTGG + Intergenic
1045051966 8:98335675-98335697 CAGCCCCAGGAGCAGAAGGCTGG - Intergenic
1045055466 8:98364444-98364466 CAGCCTCCGGGGAAACAGACTGG - Intergenic
1045889014 8:107132115-107132137 CAGCCAAAGGAGAAAGAGAAAGG - Intergenic
1046554922 8:115762436-115762458 CTGCTACAGGAGTAAGAGGCAGG - Intronic
1046689710 8:117268749-117268771 CAGCCTCTTCACAAAGAGGCAGG + Intergenic
1048462384 8:134632148-134632170 TAGGCTGAGGAGAAAGAGGAGGG - Intronic
1048498227 8:134953377-134953399 CAGCCTGTGGAGATTGAGGCTGG - Intergenic
1048573187 8:135671644-135671666 CAGCCTGAGGAGGCAGGGGCTGG + Intergenic
1048914438 8:139168212-139168234 GAGACTCAGGAGAAAAAAGCAGG + Intergenic
1048965026 8:139609036-139609058 ATGCCTCAGGAGGAAGAGGGAGG - Intronic
1049222496 8:141434393-141434415 CAGCATCAGGACAAAGACACAGG - Intergenic
1049846252 8:144803258-144803280 CAGCATCAGGAGAGGGAGGATGG - Intronic
1051913850 9:22184981-22185003 CAGCCCCTGGAAAGAGAGGCAGG + Intergenic
1053751954 9:41266195-41266217 CAGCCTCAGGCGCAGGAGGGAGG + Intergenic
1054257477 9:62830525-62830547 CAGCCTCAGGCGCAGGAGGGAGG + Intergenic
1055103952 9:72493215-72493237 TGACCTCAGTAGAAAGAGGCTGG - Intergenic
1055599560 9:77901519-77901541 CGGCCTAAGGAGGAAGAGGCAGG - Intronic
1056169015 9:83964744-83964766 AAATCTCAGGAGAAAGAGTCTGG + Intergenic
1056579548 9:87880836-87880858 CAGCAGCAGGAGCAAGGGGCTGG + Intergenic
1056690343 9:88802977-88802999 CAGCCTCAAGAGCAAGACTCAGG + Intergenic
1056714272 9:89015095-89015117 CAACCTCAGTAGAAAGATGCTGG - Intronic
1056740210 9:89247965-89247987 CAGCCTCCTGACAAGGAGGCAGG + Intergenic
1057180780 9:93028918-93028940 CAGGCACAGGAGACAGAGGAGGG + Intronic
1057249840 9:93492436-93492458 CTGCCACATGAGAAAGTGGCTGG - Intronic
1057267374 9:93627870-93627892 CCAGCTCAGGAGAAAGAGCCAGG + Intronic
1057364861 9:94410205-94410227 CCTCCTCAGGAGACTGAGGCAGG - Intronic
1057524596 9:95787139-95787161 CAGCTTCAGGATAAAGAGAGTGG - Intergenic
1057658469 9:96977886-96977908 CCTCCTCAGGAGACTGAGGCAGG + Intronic
1057803739 9:98206098-98206120 CTGCCTCAGGAGGCTGAGGCAGG - Intronic
1058171777 9:101690097-101690119 CAGGCTCAGAAGAGAGAGGTGGG + Intronic
1059662061 9:116411531-116411553 CAGCCTGAGGAGAAGGAGTTTGG - Intergenic
1059679599 9:116572942-116572964 CAGCCTCAAGAGGAAGAGAAAGG + Intronic
1059766528 9:117388785-117388807 GAGACTCTGGGGAAAGAGGCTGG - Intronic
1060148397 9:121270649-121270671 CGACCTCTGGGGAAAGAGGCGGG - Intronic
1060152599 9:121298469-121298491 CAGCCTCATTAGATAGAGGCTGG + Intronic
1060552830 9:124493685-124493707 CAGGCTCAGGAGGAGGAGGGAGG + Intronic
1060798133 9:126526469-126526491 AAGCCTCAGGAGCTGGAGGCTGG + Intergenic
1060889528 9:127179291-127179313 CAGCCTCAGAAGACAGAGAGTGG + Intronic
1061825742 9:133257184-133257206 CAGCCTCTGGAGAAGGAGCTGGG + Intronic
1061885293 9:133588190-133588212 CGGTCTCAGCAGAAAGGGGCTGG - Intergenic
1062050181 9:134443107-134443129 GGGCCTCAGGAGGAAGGGGCTGG + Intergenic
1062090731 9:134677511-134677533 CAGCATCAGGGGCAAGAGCCTGG - Intronic
1062491019 9:136804950-136804972 CAGCCTCTGGAGGGAGAGGCAGG - Intronic
1062509072 9:136894864-136894886 CAGCCACTGGAGAAACTGGCGGG + Intronic
1062613669 9:137386698-137386720 CAGCCTCAGGCCCAAGGGGCAGG - Intronic
1203425349 Un_GL000195v1:32114-32136 TAGTCTAAGGAGAAAGAGGCAGG - Intergenic
1203458432 Un_GL000220v1:11838-11860 CAGCCCCAGGAGAAAAGGGCTGG + Intergenic
1185550658 X:980776-980798 CAGCCCCAGGAGAGAGAGTGTGG - Intergenic
1185650776 X:1646376-1646398 CTGCCTCAGGAAAGAGAAGCTGG - Intergenic
1185728042 X:2438554-2438576 CTGCCTCAGGAGGGTGAGGCAGG + Intronic
1186350845 X:8737715-8737737 CAGCCTCGGGAGGCTGAGGCAGG + Intergenic
1186526075 X:10249515-10249537 GATCCTTAGAAGAAAGAGGCAGG + Intergenic
1186751631 X:12627500-12627522 GAGCCTGAGGAGAAAGAGGTTGG + Intronic
1187009759 X:15267299-15267321 CTGCCTCAGGAGGGAGAGGCAGG - Intronic
1187859092 X:23664732-23664754 CTCCCTCAGCAGAAGGAGGCTGG + Intronic
1189504030 X:41593223-41593245 CAGCCACAGGATAGAGAGGATGG + Intronic
1194091401 X:89584312-89584334 CAGCCTAAGGAGATGGAGCCCGG + Intergenic
1195997596 X:110746647-110746669 CAGCCTCAGGGAAAAGATGAGGG - Intronic
1197698488 X:129576709-129576731 AAGCCTAAGGGGAAAGAGGGGGG + Intronic
1197868373 X:131042439-131042461 CAGAGTCTGGAGAAAGAGGATGG + Intergenic
1198209050 X:134499002-134499024 CTGCCTCCAGAGTAAGAGGCAGG - Intronic
1199600806 X:149540183-149540205 CAGCCACAGGAGAAGCAGGTCGG - Intergenic
1199649676 X:149939398-149939420 CAGCCACAGGAGAAACAGGGCGG + Intergenic
1200251712 X:154557562-154557584 CAGGCTCAGGTGAAAGATGACGG + Intronic
1200253919 X:154569246-154569268 CAGGCTCAGGTGAAAGATGACGG + Intergenic
1200263850 X:154635162-154635184 CAGGCTCAGGTGAAAGATGACGG - Intergenic
1200266055 X:154646854-154646876 CAGGCTCAGGTGAAAGATGACGG - Intergenic
1201486141 Y:14496479-14496501 CAGCCTCAAGAAGAGGAGGCAGG - Intergenic