ID: 1170324238

View in Genome Browser
Species Human (GRCh38)
Location 20:15138278-15138300
Sequence CTGTTTGCTGAGGTTGAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 280
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 256}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170324235_1170324238 30 Left 1170324235 20:15138225-15138247 CCCACAAGAATTGAAATAGTTTC 0: 2
1: 0
2: 0
3: 23
4: 273
Right 1170324238 20:15138278-15138300 CTGTTTGCTGAGGTTGAGAAAGG 0: 1
1: 0
2: 0
3: 23
4: 256
1170324236_1170324238 29 Left 1170324236 20:15138226-15138248 CCACAAGAATTGAAATAGTTTCA 0: 1
1: 0
2: 2
3: 31
4: 427
Right 1170324238 20:15138278-15138300 CTGTTTGCTGAGGTTGAGAAAGG 0: 1
1: 0
2: 0
3: 23
4: 256

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170324238 Original CRISPR CTGTTTGCTGAGGTTGAGAA AGG Intronic
900572813 1:3367439-3367461 CTCTTTGCTGTGGTTGAGCCAGG + Intronic
902263695 1:15246626-15246648 ATGTTTGCAGAGATAGAGAAAGG + Intergenic
904205116 1:28849283-28849305 CTGTTGGCAGAGCTGGAGAAAGG - Intronic
906235801 1:44208436-44208458 CTGTTTGTTGTTGTTGAGACAGG + Intergenic
907340406 1:53731353-53731375 CTGTTGGCTGAGACTGAGAAAGG + Intronic
908280192 1:62525373-62525395 TGGGTTGCTGTGGTTGAGAAAGG + Intronic
910660740 1:89669628-89669650 CTGTTTTCTCATCTTGAGAATGG - Intronic
910696803 1:90027380-90027402 CTATTTGCTGATCCTGAGAATGG - Exonic
912181109 1:107220196-107220218 CTGTTGGCGGAGGGTGAGGAGGG - Intronic
912978830 1:114352686-114352708 CTCCCTGCTGAGGTTGAGGAGGG - Intergenic
913610629 1:120506500-120506522 CTCTTTGCTGAGGCTGGGGAAGG + Intergenic
913984167 1:143550313-143550335 CTCTTTGCTGAGGCTGGGGAAGG - Intergenic
914580561 1:149015739-149015761 CTCTTTGCTGAGGCTGGGGAAGG - Intronic
916433373 1:164753947-164753969 CTGTTTAGTGTGGTGGAGAAGGG + Intronic
916600326 1:166287009-166287031 GTTTTTGCTGACATTGAGAAAGG + Intergenic
917261154 1:173171824-173171846 CTGTCAGCTGAGGTTGACATTGG + Intergenic
917477040 1:175377915-175377937 CTCTTTGGTGAGTTTGGGAAGGG + Intronic
918322840 1:183381242-183381264 CTGCTTGCAGAGGTTGAGAGAGG - Intronic
920132572 1:203744127-203744149 TTGTCTGTTGAAGTTGAGAAGGG + Intergenic
920374395 1:205499735-205499757 CTGTTTGCTCACCTAGAGAATGG - Intergenic
920606934 1:207398035-207398057 ATGTTTGCTGGAGTAGAGAAGGG - Intergenic
920699936 1:208210226-208210248 CTCTTTGCTGAGGAGGTGAATGG + Intronic
920712143 1:208305367-208305389 CTGGTGCCTGAGGCTGAGAAAGG + Intergenic
921274497 1:213505482-213505504 CTGTTTTCTGATGTGGAAAATGG + Intergenic
922083294 1:222319629-222319651 CTTTCTGCTGAGTTTGTGAAAGG - Intergenic
923059557 1:230458136-230458158 CTGTTTTCTGAGGCTGGGCACGG - Intergenic
924689318 1:246330415-246330437 TTGTTTGCTGAGTTGGTGAATGG - Intronic
1062967974 10:1625173-1625195 CTGTTTTCTGTGGTGCAGAAAGG + Intronic
1067664036 10:48257984-48258006 CATTTTGCTAAGGTTGAAAATGG - Intronic
1073529158 10:104215742-104215764 CCATTTACTGAGATTGAGAAGGG - Intronic
1073811874 10:107161280-107161302 CTTTTTGCTAAAGGTGAGAAGGG + Intronic
1074573790 10:114649595-114649617 CTGCTTTCTGAGATTGAGAAAGG + Intronic
1076178236 10:128385278-128385300 CTGTGTGCTGAGGAGGTGAATGG - Intergenic
1077244369 11:1528952-1528974 CCGTTTGCTGAGTCAGAGAATGG + Intergenic
1080880600 11:36316512-36316534 CTGATTGGTGAGGTTGGAAATGG + Intronic
1082920832 11:58492012-58492034 CTGCTTGCTGAGCTGGAGATTGG - Intergenic
1084102204 11:66957258-66957280 CTGTTTTCTCAGCTGGAGAACGG + Intronic
1084888952 11:72227264-72227286 CTGTTTCCTCAGCTGGAGAATGG + Intronic
1085722945 11:78929242-78929264 CTGTCAGCTGAGGTTGAAATAGG + Intronic
1086575416 11:88334508-88334530 CTGTTGGCTGAGGTAGTGATAGG - Intronic
1087886953 11:103492957-103492979 CTGTTTGATCAGGTTGAAGATGG + Intergenic
1089645049 11:119873510-119873532 CTGTTTGCTGAGGTTGGAGGGGG + Intergenic
1090377659 11:126302776-126302798 CTTGTTGCTAACGTTGAGAATGG + Intronic
1090644389 11:128755950-128755972 CTGTCCGCTGGGGTGGAGAATGG + Intronic
1090695754 11:129239775-129239797 CTGTTTGCACAGATTGAGGATGG - Intronic
1090883404 11:130854473-130854495 ATGTATGCTAAGGATGAGAATGG + Intergenic
1091087228 11:132733468-132733490 CTACTTGCTGAGATTGAAAAGGG + Intronic
1094689663 12:32756263-32756285 CTGTTCACAGAGGTTGAGAAAGG + Intergenic
1100776825 12:97984545-97984567 GTGTTGGCTGAGCTTGAGAAAGG - Intergenic
1101546764 12:105720837-105720859 CTGTTTGTTGGGGTTGTGAAAGG + Intergenic
1102015558 12:109645706-109645728 CTGCTTGCGGAGCTTGAGACAGG + Intergenic
1102588530 12:113940257-113940279 CTGGTTGCTGAGGTTCCAAATGG - Intronic
1104799564 12:131544520-131544542 CTTTTTGCTGATATGGAGAAGGG + Intergenic
1104822493 12:131685535-131685557 CTGTTTGCTGCTCTTCAGAATGG + Intergenic
1105066338 12:133202391-133202413 CAGTTTGCTCATGTTTAGAATGG - Intergenic
1106358336 13:29006148-29006170 CTGTAAGCTGGGGTTGAGAGTGG + Intronic
1109075156 13:57824532-57824554 AAGTTTGCTGTGTTTGAGAATGG - Intergenic
1109389151 13:61670755-61670777 CTCGTTGATGAGGTAGAGAAGGG + Intergenic
1111983776 13:95044669-95044691 GTGTTTGCTGATGGTGATAAAGG - Intronic
1113631735 13:111892977-111892999 CTGTTTGCCGCTGTTGTGAAGGG - Intergenic
1116133960 14:40896783-40896805 CAGTTACCTGAGGTTGGGAAGGG - Intergenic
1116949923 14:50870262-50870284 CTACTTGCTCAGGTTGAGAGAGG - Intronic
1117351840 14:54888968-54888990 CTGTTTACTGTGGTGGAGGAGGG + Intronic
1117972477 14:61265746-61265768 ATGTTTGCTTAGGGTGAGACTGG + Intronic
1118811963 14:69281723-69281745 CTGTGTGCTGGGATGGAGAAAGG - Intronic
1119748424 14:77060920-77060942 CTGTTTGGTGAGGTCAAGGAAGG + Intergenic
1119963433 14:78885817-78885839 TAGTTTGCTGAGGTTTAGGAGGG - Intronic
1120243013 14:81972122-81972144 CTGTTGGCTGACGTTTTGAAGGG + Intergenic
1120589114 14:86354420-86354442 CTGATTGCTGAATCTGAGAATGG + Intergenic
1120954003 14:90065670-90065692 CTGTCTGGGGAGGATGAGAAAGG + Intronic
1121846704 14:97178294-97178316 ATGTTTGCTGAGTTTCTGAATGG - Intergenic
1122720523 14:103719522-103719544 GTGTTTTCTGAGGCAGAGAATGG + Intronic
1122839342 14:104447706-104447728 CTCTTTGCTGAGTTTTAAAATGG + Intergenic
1125532888 15:40425092-40425114 CTGCTAGCTGAGGACGAGAATGG + Intronic
1126387144 15:48105919-48105941 ATATTTGCTGAGGTTGAGCTGGG + Intergenic
1127587361 15:60391334-60391356 CTGTCTGCCTAGGCTGAGAAGGG + Intronic
1128358047 15:66942210-66942232 CTGTTTGGTGAGGCTGAGGTAGG + Intergenic
1128570037 15:68727042-68727064 CTGGAAGCTGAGGCTGAGAAGGG + Exonic
1128687061 15:69694664-69694686 CTGGGTCCTGATGTTGAGAAGGG - Intergenic
1131262378 15:90894011-90894033 CTGATTGCTGAGGTTGGGATAGG - Exonic
1131828122 15:96335933-96335955 CTGTTTGCAGAGGTTTGGATAGG + Intronic
1132399517 15:101496810-101496832 CTGTCAGCTGAGGGTGAGTATGG - Intronic
1135238381 16:20780053-20780075 ATGTTTGCTGAGGCTGGGCATGG - Intronic
1135606828 16:23832928-23832950 CAGGTTGCTGTGGCTGAGAATGG - Intergenic
1135700817 16:24630925-24630947 CTGTTTGCTGGGGTGGAGGTGGG + Intergenic
1136745963 16:32591502-32591524 CTGTTTGCAGAATCTGAGAAGGG + Intergenic
1137352348 16:47724577-47724599 CTGGTTGATGTGGTTGAGAAAGG + Intergenic
1137487747 16:48905968-48905990 CTGATTGCTGTGGTTGCGAAGGG + Intergenic
1137504084 16:49035821-49035843 CTCTTTGCTGAGGCTGGGATGGG + Intergenic
1138055577 16:53829590-53829612 ATTTTGGTTGAGGTTGAGAAGGG + Intronic
1139129810 16:64129038-64129060 CTCTTTGCTTAGATTGAAAAAGG + Intergenic
1139531164 16:67543332-67543354 GTCTCTGCTGAGGTTGTGAAGGG - Exonic
1139869841 16:70098344-70098366 CTGATTTCTGAGACTGAGAAAGG + Intergenic
1140385601 16:74534203-74534225 CTGATTTCTGAGACTGAGAAAGG - Intronic
1140733680 16:77878830-77878852 CTGTTCTTTGAGGCTGAGAAAGG - Intronic
1142157312 16:88538462-88538484 CTCTGTGCTGAGGCAGAGAAGGG - Intergenic
1203048091 16_KI270728v1_random:850707-850729 CTGTTTGCAGAATCTGAGAAGGG + Intergenic
1143849534 17:9799842-9799864 CTGTTTCTTGAGGTGGAGCACGG + Intronic
1143864722 17:9915857-9915879 GTGTTTGCTGTGGTAGAGAAAGG + Exonic
1144180191 17:12744464-12744486 CTGTGGGCAGAGGTTGGGAAGGG + Intronic
1144430226 17:15184330-15184352 TTGTTAGCAGAGGTTGGGAAGGG + Intergenic
1146616995 17:34364470-34364492 CTGTGTGCTGATGTGGAGAGGGG + Intergenic
1147585537 17:41652325-41652347 CTGTGTCCTGTGGTTGAGGATGG - Intergenic
1147991165 17:44334415-44334437 CCTTTTGCTAAGGTTGAGAATGG - Intergenic
1151829403 17:76540741-76540763 CTGTTTTCTGCGGTTGGGAATGG + Intronic
1152586689 17:81192504-81192526 CTGAGGGCTGAGTTTGAGAAGGG - Exonic
1153492602 18:5664805-5664827 CTGTTCTCTGAAGTTTAGAATGG + Intergenic
1155562015 18:27088921-27088943 CTGTTTACAGAGGTTCTGAAGGG - Intronic
1156518061 18:37697906-37697928 CCCTGTGCTGGGGTTGAGAATGG + Intergenic
1157389159 18:47287010-47287032 CTGCTTGCTGGGGCTGAGAAAGG + Intergenic
1159437859 18:68441590-68441612 CTGGCTGTTGAGGATGAGAAAGG + Intergenic
1160402986 18:78624637-78624659 CTGTTTACTGAGGTTGCTAGAGG + Intergenic
1161209683 19:3059899-3059921 CAGTTTGCCCAGCTTGAGAATGG + Intronic
1162784319 19:13024781-13024803 CTGGCTGCTGAGGCTGAGATGGG + Intronic
1163508957 19:17724197-17724219 CTGTATGATGAGGTAGGGAATGG + Exonic
1163727811 19:18932491-18932513 CTGATTGCTGAGCTTGGGGATGG + Intronic
1164772944 19:30826140-30826162 TTGTTTTCTGAGTTTGAAAAGGG - Intergenic
1165735696 19:38174071-38174093 CTGTGTGCTGAGGCTGGGGAAGG + Intronic
1166496749 19:43308354-43308376 ATGCTTCCTGATGTTGAGAACGG + Intergenic
926132117 2:10310074-10310096 CTGTTTGCTCAGGTGCAGAAAGG + Intronic
927463252 2:23317772-23317794 GTGTTTGAAGAGTTTGAGAAGGG - Intergenic
932408674 2:71531435-71531457 TTGGTTGCTGAGGTTGAACAAGG + Intronic
933151163 2:78916952-78916974 TTGTTTGCTGAGACTGACAAAGG - Intergenic
934772343 2:96915024-96915046 GTGTTTGCTGAGATGGAAAATGG + Intronic
935078817 2:99772084-99772106 TTGTTTTCTGAGGTGGAGGATGG - Intronic
936041476 2:109153370-109153392 ATTTTTGCTGAGGTTTGGAAAGG + Intronic
936064803 2:109322778-109322800 CTGATTTCTGAGTTGGAGAAGGG - Intronic
936657827 2:114508263-114508285 TGGTTACCTGAGGTTGAGAATGG - Intronic
940003563 2:148991092-148991114 CTGTTTGCTGCGGTTCACCAGGG - Exonic
941389384 2:164892669-164892691 CTGTCTGCTGAAGTTAAGCAAGG + Intergenic
942302680 2:174577109-174577131 TTGTTTGCTGAAATTGTGAAAGG + Intronic
946077814 2:217089955-217089977 CTTTTTGGTGAGGTTGGAAAAGG - Intergenic
946145199 2:217725374-217725396 CTGTTTGCTGAGCTGGAAGAGGG - Intronic
947104105 2:226650263-226650285 CCTTTTGCTGTTGTTGAGAAAGG + Intergenic
947546556 2:231014741-231014763 GTGTTTGTAGAGGGTGAGAATGG + Intronic
948391350 2:237613703-237613725 ATGTCTGCTGAGGTTGATCATGG + Intergenic
1169195749 20:3681324-3681346 TTGTTTGGTGAGATAGAGAAGGG - Intronic
1169398836 20:5262088-5262110 CTTTTAAGTGAGGTTGAGAAAGG - Intergenic
1170324238 20:15138278-15138300 CTGTTTGCTGAGGTTGAGAAAGG + Intronic
1170602814 20:17854569-17854591 CTGTGTGATGGGGATGAGAAGGG + Intergenic
1170654594 20:18274305-18274327 CTGTTTGATATGGTTGAGCAGGG + Intergenic
1173120082 20:40280905-40280927 CTGTCTGGTGAGGCTGAGACTGG - Intergenic
1173279671 20:41617815-41617837 CTGTTTGCAGGGGTGGAGGAGGG - Intronic
1173420180 20:42894268-42894290 CTGTGAGCTGAGCTTGATAACGG + Intronic
1174133456 20:48362234-48362256 CTATTTGCTGAGGTTAAGGTGGG + Intergenic
1177198244 21:17925343-17925365 TTGATTGCTCAGGTGGAGAATGG + Intronic
1177420939 21:20855747-20855769 TTGTTTCCTAAGGTTGAAAATGG - Intergenic
1178342997 21:31801782-31801804 CCCTTTGCTGAGGTTGGGGAGGG + Intergenic
1178699569 21:34821492-34821514 CGGTTTGCAGAGGGGGAGAAGGG + Intronic
1181063403 22:20293070-20293092 CTGTCTCCTGAGCTGGAGAACGG + Intergenic
1181402060 22:22655855-22655877 CTGGATGCTGAAGTTGAGACTGG + Intergenic
1182371956 22:29817440-29817462 TGGTTTTCTGAGGTTGAGAATGG - Intronic
1182430780 22:30297719-30297741 CTGAATGCTGAGGTTGGGATGGG + Intronic
1184098460 22:42329255-42329277 CTGTGTGCTGGGGATGAGGATGG - Intronic
1184432294 22:44448577-44448599 CTGTTGGCTGGGGTGGAGATGGG + Intergenic
1184906989 22:47494877-47494899 TTGTTTACGCAGGTTGAGAATGG + Intergenic
949133697 3:536430-536452 CTCTTTCTTGAGGATGAGAAGGG - Intergenic
949143582 3:666447-666469 CAGTTTCCTGAAGTTGATAAAGG + Intergenic
950104206 3:10378102-10378124 CTGGGTGCTGTGGTAGAGAAAGG + Intronic
951138037 3:19127001-19127023 CTGTTTGCATAGGTGGACAAAGG + Intergenic
951402167 3:22246386-22246408 ATATTTGCTGATGTTGAGTAAGG - Intronic
951702482 3:25510136-25510158 CAGTTTCCTGAGATTGAGAGAGG + Intronic
952805590 3:37348037-37348059 CTGTGTGCCGTGGCTGAGAATGG + Intronic
955491075 3:59483386-59483408 CTGGTTGCTGAGTTAGAAAAGGG - Intergenic
955711451 3:61783577-61783599 ATGTGTGCTGTGGTTGAGGAGGG + Intronic
955813144 3:62812899-62812921 CTGTTTTCTGAGGCTGTGGATGG + Intronic
955849112 3:63200724-63200746 CTGTTTCCTGAATTAGAGAAAGG + Intergenic
956185354 3:66557216-66557238 CTGTTGCCTGAGATTGAGAGTGG + Intergenic
957825122 3:85431713-85431735 TTGTTTGCTGAGAGTCAGAAGGG + Intronic
958627516 3:96645237-96645259 GTTTTTGCTTAGGTGGAGAAAGG - Intergenic
960445028 3:117737521-117737543 CTGCCTACTGAGGTTCAGAAAGG - Intergenic
960965982 3:123105069-123105091 CTTGATGCTGAGGTGGAGAAGGG + Intronic
960996193 3:123342165-123342187 CTGTTGGCTGAGGGTGTGAGTGG + Intronic
962058854 3:131904115-131904137 CTGTTTGCTGTGCTTGTGCAAGG - Intronic
964165389 3:153698283-153698305 CTATTTGCTCAGGTACAGAATGG - Intergenic
965776046 3:172232438-172232460 TTGTTTTCTTAGGTTGAGAAGGG + Intronic
966410635 3:179642842-179642864 CTGCTTGCTGAGCTTGGGGATGG - Intergenic
966794374 3:183699251-183699273 CTGTTTACTGAGATGAAGAATGG + Intronic
967946662 3:194809340-194809362 CTGTATCCTGGGGTTTAGAATGG + Intergenic
970059563 4:12016317-12016339 CTGTTTGCTGAGGTTCTTGATGG - Intergenic
970391723 4:15618863-15618885 CTTTTGGCAGAGCTTGAGAAAGG - Intronic
971159054 4:24114468-24114490 CTGTCTGGTGAGGTGGAGCAAGG - Intergenic
972591548 4:40492882-40492904 CTGCCTGCTGAGGCTGGGAAGGG - Intronic
973271127 4:48264330-48264352 TTTTTTGCTGGGGTAGAGAAGGG - Intronic
974100738 4:57413136-57413158 CTGTTTCCTGAGCTTAATAAGGG - Intergenic
976015463 4:80547451-80547473 CTCTTTGCTGATGTCCAGAATGG - Intronic
979409874 4:120363967-120363989 CTGTTTACTGTGGTAGAGATTGG - Intergenic
979472638 4:121118758-121118780 TTGATTGGTGAGGTGGAGAAAGG - Intergenic
980652179 4:135732428-135732450 CTGTTTGCTGCGCTAAAGAAAGG - Intergenic
981762178 4:148206743-148206765 CTATCTGCTGAGACTGAGAAGGG + Intronic
982366167 4:154581506-154581528 ATGATTGCAGAGGTTGAAAATGG + Intergenic
982575724 4:157107469-157107491 CTTATTGCTGAGCTGGAGAAAGG + Intronic
983607402 4:169604798-169604820 TTGTTTTCTAAGGTAGAGAAAGG - Intronic
983905820 4:173181725-173181747 CTGTTTGCTTAGCCTGAGAAAGG + Intronic
986003779 5:3650600-3650622 CAGTGTGCTGGGGTTGAGAGTGG + Intergenic
986082452 5:4409121-4409143 TTTTTTGCAGAGGTTGACAAGGG + Intergenic
986683993 5:10259848-10259870 CAGGTTGCTGAGAATGAGAAGGG + Intronic
986759823 5:10869746-10869768 CAGTTTGCTGAGGTGCAAAAAGG + Intergenic
986830168 5:11568230-11568252 TTGTTTGCTGAATATGAGAAAGG + Intronic
988655550 5:33207614-33207636 CTTCTTGCTGATGTGGAGAAAGG + Intergenic
989740204 5:44761972-44761994 TTGTATGCTGAGGTTCAGATAGG - Intergenic
989988250 5:50728927-50728949 ATGTTTGTTGATGTTGAAAAAGG + Intronic
990053214 5:51534129-51534151 ATTTTGGATGAGGTTGAGAAGGG + Intergenic
991080005 5:62588598-62588620 CTGTTGGGTCAGGTAGAGAATGG - Intronic
991381953 5:66037543-66037565 TTGTTTGCTGAGGAACAGAAAGG + Intronic
993225077 5:85159410-85159432 CTGATGGGTGAGCTTGAGAAGGG - Intergenic
994100854 5:95891021-95891043 GTGATGGCTGAGGTTGAGCAGGG + Intronic
995673307 5:114632771-114632793 CTTTTTGCTGAGGGTGAGATAGG - Intergenic
995806757 5:116061354-116061376 CTGATTCCTGAGGTTGGGGATGG - Intergenic
996599636 5:125246760-125246782 CTGTTTGCTGAAGCAGATAATGG - Intergenic
997486633 5:134236459-134236481 CTGTCTGCTTAGCTTGAGAAAGG + Intergenic
998677417 5:144425293-144425315 CTGTTTCCTGGGGTAGAGATTGG + Intronic
1000650741 5:163815372-163815394 CTGCATGCTGAGGTTGGGGATGG - Intergenic
1002146069 5:177182358-177182380 CTGCTTGCTGAAGGTCAGAATGG - Intronic
1005908212 6:30284161-30284183 CAGTTTCCTGAGGTTGTGCAGGG + Intergenic
1005930643 6:30481577-30481599 CTGTCTGCTTAGGTTGCAAATGG + Intergenic
1006309787 6:33249554-33249576 CTGCTTCCTGAGGCTGAGAGTGG - Intergenic
1007344830 6:41221751-41221773 CTTTTCTCTGGGGTTGAGAATGG - Intergenic
1009358750 6:62788187-62788209 ATTTTTGGTGAGGTGGAGAAAGG + Intergenic
1010636309 6:78262898-78262920 CTTTTCACTGAGGTTGAGGAAGG - Intergenic
1011702604 6:89969655-89969677 CTGGTTTCTCAGGTAGAGAAGGG - Intronic
1012092382 6:94915569-94915591 TTGTTTCCTTAAGTTGAGAATGG - Intergenic
1012340267 6:98112760-98112782 TGGTTTCCAGAGGTTGAGAAAGG + Intergenic
1012503722 6:99920340-99920362 TTGTTTGCTAAGGCTCAGAAAGG - Exonic
1013650415 6:112188965-112188987 CCATTTGCTGAGGTGCAGAAAGG + Intronic
1014714082 6:124843462-124843484 CCATTTGCTGAGAGTGAGAAAGG - Intergenic
1018471818 6:164104320-164104342 GTGTTTTCTGTGGTTGGGAAAGG - Intergenic
1018737830 6:166702157-166702179 CTGTTTGGTGATGTTCCGAATGG + Intronic
1021704251 7:23351316-23351338 CTGTTTGGTGATGTTCCGAATGG + Exonic
1024430890 7:49286525-49286547 CTGGTTACTGAGATTGAGAAGGG + Intergenic
1027963088 7:84971766-84971788 CTCTTTGCTAAGTTTGAGGAGGG - Intergenic
1028410934 7:90529893-90529915 CTGTTTGCAGAGGATGTGGATGG - Intronic
1030741140 7:113111062-113111084 CTGTTTGCTGTGAGTGAGAGTGG + Intergenic
1031940105 7:127779549-127779571 CTGTTTGCTCCGATTTAGAATGG + Intronic
1034512352 7:151546451-151546473 GTGATTGCTGAGGTGGAGCAAGG + Intergenic
1034873271 7:154702513-154702535 CTGGTTGCTGATATGGAGAAAGG + Intronic
1034915155 7:155032833-155032855 CTGTTGGGGGATGTTGAGAACGG - Intergenic
1035050173 7:155994188-155994210 CTGTTTGCTGAGGGAGAGCCAGG - Intergenic
1036387870 8:8297452-8297474 CTGTTTGGCGATCTTGAGAAAGG + Intergenic
1036928475 8:12930466-12930488 CTGTTTGCTGATCTTGAGATGGG + Intergenic
1038173037 8:25155681-25155703 CTGATAGCTGATGATGAGAATGG - Intergenic
1039096285 8:33889771-33889793 CTGTTTGCTGATTTTGGCAAAGG + Intergenic
1041939513 8:63371213-63371235 CTTTTTGCTGAGGTTAATTAAGG - Intergenic
1042323533 8:67504055-67504077 CATTTTGCTGAGGCTTAGAAAGG + Intronic
1043006982 8:74831920-74831942 ATGTTTGATGAAGTTGAGGAAGG + Intronic
1043839501 8:85086133-85086155 CTGTTTGCTGTGCTTCTGAAAGG - Intergenic
1044731635 8:95233059-95233081 CTGTTGGCAGGGATTGAGAATGG - Intergenic
1045380926 8:101624945-101624967 CTCTTTGTTGAGGTTTTGAATGG - Intronic
1046690043 8:117272962-117272984 CTGTTTTCTGAACTAGAGAAAGG + Intergenic
1046782724 8:118232696-118232718 TGGTGTGCTGAGGGTGAGAAAGG + Intronic
1046838060 8:118825152-118825174 CTGGTTGCTGAGTTTGGGAGGGG + Intergenic
1047124391 8:121944444-121944466 AGGTTTGCTGAGGTTGTTAATGG + Intergenic
1048927847 8:139286716-139286738 GAGTGTGATGAGGTTGAGAAGGG - Intergenic
1049262255 8:141646055-141646077 ATGTCTGCTGAGGTTGAGTGAGG - Intergenic
1049905089 9:209118-209140 ATGTGAGCTCAGGTTGAGAAAGG + Intergenic
1050656637 9:7835873-7835895 CTGTTTGGGGATGTGGAGAAAGG - Intronic
1055000564 9:71445005-71445027 CTGTTTGCTAAGGGTGATGATGG - Intronic
1055873955 9:80920225-80920247 CTTATTGCTGATGTTGAGAAAGG - Intergenic
1056463274 9:86828611-86828633 TTGTCTGCTGTGGTTGAGCATGG + Intergenic
1056504047 9:87239839-87239861 GTCTTTGCTGAGTTTGAGAATGG + Intergenic
1056959595 9:91111272-91111294 CTTATTGCTGATGTGGAGAAAGG - Intergenic
1057530290 9:95839099-95839121 CTCTTTGCTGAGGATGGGCAAGG + Intergenic
1057559560 9:96116638-96116660 CTGTGTTCAGAGGATGAGAAGGG + Intergenic
1058412149 9:104745986-104746008 CAGTTTCCTGAGGCTGAGGAGGG - Intergenic
1058992641 9:110269419-110269441 GTGTTTGAAGAGGGTGAGAATGG + Intergenic
1059477375 9:114558389-114558411 CTGCTGGCTGAGGTTGAGGGTGG - Intergenic
1185991734 X:4898918-4898940 GTATTAGCTGAGGTTTAGAAAGG + Intergenic
1187068155 X:15861304-15861326 CTGTGTGCTAAGGAAGAGAACGG - Intergenic
1187832410 X:23395816-23395838 ATGTCTGCTAAGGTTCAGAAAGG - Exonic
1188238276 X:27754773-27754795 CAGTTTCCTGAGGCTGAGTAGGG + Intergenic
1189403808 X:40699231-40699253 TAGTTTTCTGAGGTTGGGAATGG + Intronic
1192153992 X:68729830-68729852 CTGTTACCAGAGGTTGGGAAGGG + Intergenic
1192271415 X:69583248-69583270 CTGTCTTCTTAGGTTGAGAGGGG + Intergenic
1193006496 X:76625207-76625229 CTGTTTCCAGAGTGTGAGAAGGG + Intergenic
1193555493 X:82948932-82948954 CTCTTTGCAGAGATTGTGAATGG - Intergenic
1196357814 X:114813998-114814020 CTGTGTGTGGAGGTTTAGAAAGG + Intronic
1196479508 X:116130385-116130407 CGGTTTCCAGAGGTTGGGAAGGG - Intergenic
1198047025 X:132913365-132913387 CTGTTTGCTCAGGCTGTGGATGG + Intronic
1198047754 X:132919560-132919582 CTGTATGCAGATGTTAAGAAAGG - Intronic
1201685402 Y:16696356-16696378 GTATTAGCTGAGGTTTAGAAAGG - Intergenic